Data Dictionary

general


age_at_DCDate

Description :

Age of participant at time of data collection

Variable Name Type
age_at_DCDate.general numeric

date_diff

Description :

The difference in days between one instrument and the date of a participants neuropsych appointment

Variable Name
date_diff.general

DCDate

Description :

Date instrument was administered

Variable Name Type
DCDate.general Date

instr_type

Variable Name
instr_type.general

PIDN

Description :

Participant ID

Variable Name Type
PIDN.general numeric

source

Variable Name
source.general

UnQID

Variable Name Type
UnQID.general numeric

1back

Description :

NIH-EXAMINER N-back task. The n-back paradigm is a widely used measure of working memory that requires flexible updating capabilities. NIH-EXAMINER includes spatial 1-back and 2-back tasks to assess spatial working memory. The 1-back requires maintaining and updating 1 location at a time, whereas the more difficult 2-back requires maintaining and updating 2 locations.

References :

  • Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., … & Widmeyer, M. (2014). NIH EXAMINER: conceptualization and development of an executive function battery. Journal of the international neuropsychological society, 20(1), 11-19.

nb1dprime

Description :

Discrimination (raw)

Variable Name Type Min Possible Max Possible
nb1dprime.1back numeric -Infinity Infinity

nb1FalseAlarms

Description :

Number of false positive errors (raw)

Variable Name Type Min Possible Max Possible
nb1FalseAlarms.1back numeric 0 Infinity

nb1Hits

Description :

Number of correct hits (raw)

Variable Name Type
nb1Hits.1back numeric

nb1TotalNo

Description :

Total number of items completed?

Variable Name Type Min Possible Max Possible
nb1TotalNo.1back numeric 0 Infinity

nb1ZFA

Description :

Number of false positive errors (z-score)

Variable Name Type Min Possible Max Possible
nb1ZFA.1back numeric -Infinity Infinity

nb1ZHIT

Description :

Number of correct hits (z-score)

Variable Name Type
nb1ZHIT.1back numeric

task

Variable Name All Possible Values (Categorical) Type
task.1back 1-Back, AgingCog_1Back character

version

Variable Name All Possible Values (Categorical) Type
version.1back 1, 1.0.1, 1.0.2, 2 character

2back

Description :

NIH-EXAMINER N-back task. The n-back paradigm is a widely used measure of working memory that requires flexible updating capabilities. NIH-EXAMINER includes spatial 1-back and 2-back tasks to assess spatial working memory. The 1-back requires maintaining and updating 1 location at a time, whereas the more difficult 2-back requires maintaining and updating 2 locations.

References :

  • Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., … & Widmeyer, M. (2014). NIH EXAMINER: conceptualization and development of an executive function battery. Journal of the international neuropsychological society, 20(1), 11-19.

nb2bias

Variable Name Type Min Possible Max Possible
nb2bias.2back numeric 0.007 -0.731

nb2dprime

Description :

Discrimination (raw)

Variable Name Type Min Possible Max Possible
nb2dprime.2back numeric 0.007 -1.749

nb2FalseAlarms

Description :

Number of false positive errors (raw)

Variable Name Type Min Possible Max Possible
nb2FalseAlarms.2back numeric 0.025 0.992

nb2Hits

Description :

Number of correct hits (raw)

Variable Name Type Min Possible Max Possible
nb2Hits.2back numeric 0.177 0.984

nb2TotalNo

Description :

Total number of items completed?

Variable Name Type Min Possible Max Possible
nb2TotalNo.2back numeric 0 59

nb2ZFA

Description :

Number of false positive errors (z-score)

Variable Name Type Min Possible Max Possible
nb2ZFA.2back numeric 0.000 -1.967

nb2ZHIT

Description :

Number of correct hits (z-score)

Variable Name Type Min Possible Max Possible
nb2ZHIT.2back numeric 0.000 -0.925

task

Variable Name All Possible Values (Categorical) Type
task.2back 2-Back, AgingCog_2-Back, AgingCog_2Back character

version

Variable Name All Possible Values (Categorical) Type
version.2back 1, 1.0.1, 1.0.2, 2 character

adrcneuroexam

Description :

Summary rating scores for parkinsonian motor symtpoms and PSP supranuclear ocular, limb, and gait function from ADRC research visit neurological exam

References :

  • Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.

  • Movement Disorder Society Task Force on Rating Scales for Parkinson’s Disease. (2003). The unified Parkinson’s disease rating scale (UPDRS): status and recommendations. Movement Disorders, 18(7), 738-750.


psp_gait

Description :

PSP Gait Rating Scale

References :

  • Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.
Variable Name Type Min Possible Max Possible
psp_gait.adrcneuroexam numeric 0 20

psp_limb

Description :

PSP Limb Rating Scale

References :

  • Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.
Variable Name Type Min Possible Max Possible
psp_limb.adrcneuroexam numeric 0 16

psp_oc

Description :

PSP Supranuclear Ocular Motor Rating Scale

References :

  • Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.
Variable Name Type Min Possible Max Possible
psp_oc.adrcneuroexam numeric 0 16

updrs

Description :

The Unified Parkinson’s Disease Rating Scale (UPDRS) Motor Score

References :

  • Movement Disorder Society Task Force on Rating Scales for Parkinson’s Disease. (2003). The unified Parkinson’s disease rating scale (UPDRS): status and recommendations. Movement Disorders, 18(7), 738-750.
Variable Name Type Min Possible Max Possible
updrs.adrcneuroexam numeric 0 77

apnea

Description :

ApneaLink records the following data: patient respiratory nasal airflow, snoring, blood oxygen saturation, pulse and respiratory effort during sleep.


apnea_hypopnea_index

Description :

Mean number of all apnea classes (unclassified, central, mixed, obstructive) and hypopneas per hour in the evaluation period, high AHI (>5) = high likelihood of OSA, low AHI (<5) = lower likelihood of OSA

Variable Name Type Min Possible Max Possible
apnea_hypopnea_index.apnea numeric 0.3 37.0

oxygen_desaturation_index

Description :

Mean value that shows the number of desaturations within the SpO2 evaluation period, high ODI (>5)= more desaturation events (more risk of OSA), low ODI (<5) = few desaturation events (lower risk of OSA)

Variable Name Type Min Possible Max Possible
oxygen_desaturation_index.apnea numeric 0.0 34.5

bedside

Description :

The bedside cognitive screen was developed at the UCSF Memory & Aging Center (MAC). This battery of 21 measures has been designed to probe multiple cognitive domains (e.g., memory, executive function, language, visual-spatial function, and mood) in a time-limited fashion (typically 60 minutes). The specific tests utilized in the bedside have been developed to assist with the differential diagnosis of the most common referral questions at the MAC (e.g., Alzheimer’s Disease vs. Frontotemporal Dementia). The level of difficulty has been tailored to patients/research participants presenting with substantial cognitive deficits. Thus, the bedside screen may have low sensitivity to subtle cognitive deficits, especially for participants with high levels of education.


Animals

an_corr

Description :

Animals is a verbal fluency/generativity task requiring the participant to generate as many words as they can think of that belong to the semantic category ‘Animals’ in one minute. This variable captures the number of correct responses.

Variable Name Type Min Possible Max Possible
an_corr.bedside numeric 0 Infinity

an_reps

Description :

Number of word repetitions on the semantic verbal fluency task (Animals)

Variable Name Type Min Possible Max Possible
an_reps.bedside numeric 0 Infinity

an_rule_v

Description :

Number of rule violations on the semantic verbal fluency task (Animals) e.g., words that do not belong to the correct semantic category

Variable Name Type
an_rule_v.bedside numeric

Benson Figure

bensonrecall

Description :

The Benson figure is a simplified version of the Rey-Osterrieth complex figure. The participant is asked to make a copy of the figure, which they are asked to draw again from memory after a 10 minute delay. The recalled figure is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total). The recall condition is viewed as a task of visual memory. However, it should be noted that recall performance can be impacted by difficulties with visuo-constructional ability and/or a poorly organised approach (executive dysfunction) on the initial copy condition of the task.

Variable Name Type Min Possible Max Possible
bensonrecall.bedside numeric 0 17

bensonrecallz

Description :

Z-score for Benson Figure recall condition performance

Variable Name Type Min Possible Max Possible
bensonrecallz.bedside numeric Infinity Infinity

mod_rey_b

Description :

An alternative version of the Benson figure (version B) is used. In this condition, the participant is asked to make a copy of the figure. The figure copy is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total).

Variable Name Type
mod_rey_b.bedside numeric

mod_rey

Description :

The Benson figure is a simplified version of the Rey-Osterrieth complex figure. In this condition the participant is asked to make a copy of the figure. The figure copy is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total).

Variable Name Type Min Possible Max Possible
mod_rey.bedside numeric 0 17

rey_b_recg

Description :

Participant is asked to recognize the original benson figure (version B) they were presented with from 4 options. This score indicates whether they were able to accurately recognise the figure

Label Value
0 Incorrect
1 correct
Variable Name All Possible Values (Categorical) Type Value Labels
rey_b_recg.bedside 0, 1 numeric Incorrect, correct

rey_b10m

Description :

Participant is asked to draw the benson figure (version B) from memory after a delay of 10-15 minutes. The drawing is scores for the accuracy (1 point) and placement (1 point) of 8 different elements, along with a bonus point given for a perfect copy (17 points total)

Variable Name Type Min Possible Max Possible
rey_b10m.bedside numeric 0 17

rey_recg

Description :

Participant is asked to recognize the original benson figure they were presented with from 4 options. This score indicates whether they were able to accurately recognise the figure

Label Value
0 Incorrect
1 correct
Variable Name All Possible Values (Categorical) Type Value Labels
rey_recg.bedside 0, 1 numeric Incorrect, correct

rey10m

Description :

Participant is asked to draw the benson figure from memory after a delay of 10-15 minutes. The drawing is scores for the accuracy (1 point) and placement (1 point) of 8 different elements, along with a bonus point given for a perfect copy (17 points total)

References :

  • *Duplicate of Bensonrecall.bedside. Delete?
Variable Name Type Min Possible Max Possible
rey10m.bedside numeric 0 17

Boston Naming-15

bnt_corr

Description :

The 15-item version of the Boston Naiming Test (BNT) is a task which examines confrontational naming. The participant is required to name 15 different items presented as pictures, one at a time. This varibale represents the number of correct spontaneously named items (without any cueing).

Variable Name Type Min Possible Max Possible
bnt_corr.bedside numeric 0 15

bnt_mult

Description :

Number of correct items named following a multiple choice cue (e.g., is it a bed, bell or bear?) on the 15-item version of the Boston Naming Test (BNT)

Variable Name Type Min Possible Max Possible
bnt_mult.bedside numeric 0 15

bnt_num_s

Description :

Number of semantic cues given (e.g., it’s a piece of furniture) on the 15-item version of the Boston Naming Test (BNT)

Variable Name Type Min Possible Max Possible
bnt_num_s.bedside numeric 0 15

bnt_phon

Description :

Number of correct items named following a phonemic cue (e.g., it starts with “be”) on the 15-item version of the Boston Naming Test (BNT)

Variable Name Type
bnt_phon.bedside numeric

bnt_stim

Description :

Number of correct items named following a semantic cue (e.g., it’s a piece of furniture) on the 15-item version of the Boston Naming Test (BNT)

Variable Name Type
bnt_stim.bedside numeric

bnt_tot

Description :

The total score for the 15-item version of the Boston Naming Test (BNT) is the number of correct spontaneously named items (uncued) + the number of correctly named items with a semantic cue.

Variable Name Type Min Possible Max Possible
bnt_tot.bedside numeric 0 15

Composites

bsexzscore

Description :

A composite z-score for executive functioning tasks in the bedside battery. This composite includes 1) total number of items recalled on the interference condition of the Stroop task (strp_cor.bedside), Digits Backwards span (digit_bw.bedside), Modified Trails total completion time (mt_time.bedside), total number of correct words generated in D Words (d_corr.bedside), and total correct designs generated in Design Fluency (df_corr.bedside).

Variable Name Type Min Possible Max Possible
bsexzscore.bedside numeric Infinity Infinity

memoryzscore

Description :

A composite z-score for memory tasks in the bedside battery. This composite includes 1) Summed total of words recalled across all five learning trails of the CVLT-II, 2) words spontaneously recalled following a long delay on the CVLT-II (cv2lfrc.bedside), 3) CVLT-II recognition discriminability (cv2rd.bedside), 4) recall score for the Benson figure following a long delay (bensonrecall.bedside).

Variable Name Type Min Possible Max Possible
memoryzscore.bedside numeric Infinity Infinity

CVLT-BF

corr_long

Description :

An optional sub-measure indicating total correct words spontaeously recalled following a long (unspecified) delay. If administered, this is usually collected upon the completion of the testing session.

Variable Name Type
corr_long.bedside numeric

corr10

Description :

Total correct words spontaeously recalled following a 10-minute delay

Variable Name Type
corr10.bedside numeric

corr30

Description :

Total correct words spontaeously recalled following a 30 second delay (with distractor task)

Variable Name Type
corr30.bedside numeric

cue_intr

Description :

Total number of intrusion errors (incorrect words) recalled following a 10-minute delay with the provision of category cues (e.g., “tell me all of the words from the list that are fruits”)

Variable Name Type Min Possible Max Possible
cue_intr.bedside numeric 0 Infinity

cued_cor

Description :

Total number of correct words recalled following a 10-minute delay with the provision of category cues (e.g., “tell me all of the words from the list that are fruits”)

Variable Name Type
cued_cor.bedside numeric

intr_long

Description :

An optional sub-measure indicating total number of intrusion errors (incorrect words) spontaeously recalled following a long (unspecified) delay. If administered, this is usually collected upon the completion of the testing session.

Variable Name Type
intr_long.bedside numeric

intr10

Description :

Total number of intrusion errors (incorrect words) spontaeously recalled following a 10-minute delay

Variable Name Type
intr10.bedside numeric

intr30

Description :

Total number of intrusion errors (incorrect words) spontaeously recalled following a 30-second delay (with distractor task).

Variable Name Type
intr30.bedside numeric

recog_fp

Description :

Total number of false positive errors (incorrect words recalled) when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.

Variable Name Type Min Possible Max Possible
recog_fp.bedside numeric 0 18

recog_np

Description :

Total number of ‘novel prototype’ words (e.g., novel words belonging to the same category) incorrectly recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.

Variable Name Type
recog_np.bedside numeric

recog_nu

Description :

Total number of ‘novel unrelated’ words (e.g., novel words unrelated to those on the original list) incorrectly recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.

Variable Name Type
recog_nu.bedside numeric

recog

Description :

Total number of correct words recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.

Variable Name Type
recog.bedside numeric

t1corr

Description :

The California Verbal Learning Test, Brief Form (CVLT-BF) is a 9-item list learning task. Four learning trails are first administered where the examiner reads the word list out loud and the participant is asked to recall as many words as they can from the list following each repetition. Following the learning trials, a distractor task requires the participant to count backwards from 100 for 30 seconds. Immediatley following the distractor task the participant is then asked to recall as many items from the list as they can. Then, following a 10-minute delay, the participant is again asked to recall as many words from the list as they can, following by a cued recall condition (i.e., “tell me all the owrds from the list that were fruits”) and a recognition (Yes/No) condition. The task also includes an optional long delay condition (timing unspecified) where the participant is again asked to recall as many words from the list as they can at the conclusion of the testing session. This variable represents the total correct words recalled on learning trial 1.

Variable Name Type
t1corr.bedside numeric

t1intr

Description :

Total intrusions (incorrect words) incorrectly recalled on learning trial 1

Variable Name Type
t1intr.bedside numeric

t2corr

Description :

Total correct words recalled on learning trial 2

Variable Name Type
t2corr.bedside numeric

t2intr

Description :

Total intrusions (incorrect words) incorrectly recalled on learning trial 2

Variable Name Type
t2intr.bedside numeric

t3corr

Description :

Total correct words recalled on learning trial 3

Variable Name Type
t3corr.bedside numeric

t3intr

Description :

Total intrusions (incorrect words) incorrectly recalled on learning trial 3

Variable Name Type
t3intr.bedside numeric

t4corr

Description :

Total correct words recalled on learning trial 4

Variable Name Type
t4corr.bedside numeric

t4intr

Description :

Total intrusions (incorrect words) incorrectly recalled on learning trial 4

Variable Name Type
t4intr.bedside numeric

tr_co_tot

Description :

Sum of total correct words recalled across learning trails 1-4

Variable Name Type Min Possible Max Possible
tr_co_tot.bedside numeric 0 36

CVLT-II

cv2b_r

Description :

Distractor list (list B) related false positives

Variable Name Type
cv2b_r.bedside numeric

cv2b_u

Description :

Distractor list (list B) unrelated false positives

Variable Name Type
cv2b_u.bedside numeric

cv2bias

References :

  • *Unclear what this refers to
Variable Name Type Min Possible Max Possible
cv2bias.bedside numeric 0.000 -1.863

cv2dprime

References :

  • *Unclear what this refers to
Variable Name Type Min Possible Max Possible
cv2dprime.bedside numeric 0.000 -0.384

cv2dprimez

References :

  • *Unclear what this refers to
Variable Name Type Min Possible Max Possible
cv2dprimez.bedside numeric 0.021 -4.917

cv2form

Description :

Indicates the form of the CVLT2 that was administered (Form A or B)

Label Value
A A
B B
Variable Name All Possible Values (Categorical) Type Value Labels
cv2form.bedside A, B character A, B

cv2fptot

Description :

Total false positive responses for List A when participant is presented with a recognition (Yes/No) format

Variable Name Type Min Possible Max Possible
cv2fptot.bedside numeric 0 16

cv2hit

Description :

Total correct words recalled from List A when participant is presented with a recognition (Yes/No) format

Variable Name Type Min Possible Max Possible
cv2hit.bedside numeric 0 16

cv2lcc

Description :

Total correct words recalled from List A following a long delay (20 min) in cued condition i.e., “Tell me all the words from the list that are furniture”.

Variable Name Type Min Possible Max Possible
cv2lcc.bedside numeric 0 16

cv2lci

Description :

Total intrusions (incorrect words) recalled for List A following a long delay (20 min) in cued condition i.e., “Tell me all the words from the list that are furniture”.

Variable Name Type Min Possible Max Possible
cv2lci.bedside numeric 0 Infinity

cv2lfrc

Description :

Total correct words spontaneously recalled from List A following a long delay (20 min)

Variable Name Type Min Possible Max Possible
cv2lfrc.bedside numeric 0 16

cv2lfrcz

Description :

Z-score for correct words spontaneously recalled from List A following a long delay (20 min)

Variable Name Type Min Possible Max Possible
cv2lfrcz.bedside numeric Infinity Infinity

cv2lfri

Description :

Total intrusions (incorrect words) spontaneously recalled for List A following a long delay (20 min)

Variable Name Type
cv2lfri.bedside numeric

cv2np

Description :

Total ‘novel prototype’ words (e.g., novel words belonging to the same category) incorrectly recalled when the participant is presented with a recognition (Yes/No) format for List A.

Variable Name Type
cv2np.bedside numeric

cv2nu

Description :

Total ‘novel unrelated’ words (e.g., novel words unrelated to those on List A) incorrectly recalled when the participant is presented with a recognition (Yes/No) format.

Variable Name Type
cv2nu.bedside numeric

cv2pfp

References :

  • *Unclear what this refers to
Variable Name Type Min Possible Max Possible
cv2pfp.bedside numeric 0.016 0.969

cv2phit

References :

  • *Unclear what this refers to
Variable Name Type Min Possible Max Possible
cv2phit.bedside numeric 0.031 0.969

cv2rd

Description :

Recognition discriminibility (d’) for List A = z(hits) - z(false positive errors).

Variable Name All Possible Values (Categorical) Type
cv2rd.bedside 0, 3, 4 numeric

cv2sdcc

Description :

Total correct words recalled from List A following a short delay (immediatley after distractor trial B) in cued condition i.e., “Tell me all the words from the list that are furniture”.

Variable Name Type Min Possible Max Possible
cv2sdcc.bedside numeric 0 16

cv2sdci

Description :

Total intrusions (incorrect words) recalled for List A following a short delay (immedatley after distractor trial B) in cued condition i.e., “Tell me all the words from the list that are furniture”.

Variable Name Type Min Possible Max Possible
cv2sdci.bedside numeric 0 Infinity

cv2sfrc

Description :

Total correct words from List A recalled spontaneously following a short delay (immediatley after distractor trial B)

Variable Name Type Min Possible Max Possible
cv2sfrc.bedside numeric 0 16

cv2sfri

Description :

Total intrusions (incorrect words) spontaeously recalled following a short delay (immediatley after distractor trial B)

Variable Name Type
cv2sfri.bedside numeric

cv2t1c

Description :

The California Verbal Learning Test, second edition (CVLT-II) is a 16-item list learning task. Five learning trails are first administered where the examiner reads a word list (List A) out loud and the participant is asked to recall as many words as they can from the list following each repetition. Following the learning trials, a distractor list (List B) is read allowed by the examiner and the participant is asked to recall as many words as they can from List B only. Immediatley following this task (short delay), the participant is again required to recall as many words as they can from List A only. A cued condition following the short delay is also administered (i.e., “tell me all the words from the list that are furniture”). Then, following a 20-minute delay (long delay), the participant is again asked to recall as many words from List A as they can, following by the cued recall condition (i.e., “tell me all the words from the list that are furniture”) and a recognition (Yes/No) condition. This variable represents the total correct words recalled on learning trial 1 (List A).

Variable Name Type Min Possible Max Possible
cv2t1c.bedside numeric 0 16

cv2t1i

Description :

Total intrusions (incorrect words) recalled on learning trial 1 (List A)

Variable Name Type
cv2t1i.bedside numeric

cv2t2c

Description :

Total correct words recalled on learning trial 2 (List A)

Variable Name Type Min Possible Max Possible
cv2t2c.bedside numeric 0 16

cv2t2i

Description :

Total intrusions (incorrect words) recalled on learning trial 2 (List A)

Variable Name Type
cv2t2i.bedside numeric

cv2t3c

Description :

Total correct words recalled on learning trial 3 (List A)

Variable Name Type Min Possible Max Possible
cv2t3c.bedside numeric 0 16

cv2t3i

Description :

Total intrusions (incorrect words) recalled on learning trial 3 (List A)

Variable Name Type
cv2t3i.bedside numeric

cv2t4c

Description :

Total correct words recalled on learning trial 4 (List A)

Variable Name Type Min Possible Max Possible
cv2t4c.bedside numeric 0 16

cv2t4i

Description :

Total intrusions (incorrect words) recalled on learning trial 4 (List A)

Variable Name Type
cv2t4i.bedside numeric

cv2t5c

Description :

Total correct words recalled on learning trial 5 (List A)

Variable Name Type Min Possible Max Possible
cv2t5c.bedside numeric 0 16

cv2t5i

Description :

Total intrusions (incorrect words) recalled on learning trial 5 (List A)

Variable Name Type
cv2t5i.bedside numeric

cv2tb_c

Description :

Total correct words recalled from List B

Variable Name Type Min Possible Max Possible
cv2tb_c.bedside numeric 0 16

cv2tb_i

Description :

Total intrusions (incorrect words) recalled from List B

Variable Name Type
cv2tb_i.bedside numeric

cv2zfp

Description :

Z-score for total false positive responses for List A when participant is presented with a recognition (Yes/No) format

Variable Name Type Min Possible Max Possible
cv2zfp.bedside numeric Infinity Infinity

cv2zhit

Description :

Z-score for total correct words recalled for List A when participant is presented with a recognition (Yes/No) format

Variable Name Type Min Possible Max Possible
cv2zhit.bedside numeric Infinity Infinity

D Words

d_corr

Description :

A verbal fluency/generativity task requiring the participant to generate as many words as they can think of that begin with the letter ‘D’ (a phonemic category) in one minute. Participants are not permitted to give names of people or places, and must not give the same word with different endings (e.g., bake, baked, baking). This variable captures the number of correct responses generated.

Variable Name Type Min Possible Max Possible
d_corr.bedside numeric 0 Infinity

d_reps

Description :

Number of word repetitions on the phonemic verbal fluency task (d words)

Variable Name Type
d_reps.bedside numeric

d_rule_v

Description :

Number of rule violations on the phonemic verbal fluency task (d words). Rule violations include giving words that do not start with the letter ‘D’, giving the names of people or places, or repeating a word with different endings (e.g., bake, baked, baking).

Variable Name Type
d_rule_v.bedside numeric

dcorrz

Description :

Z-score for D Words performance

Variable Name Type Min Possible Max Possible
dcorrz.bedside numeric Infinity Infinity

Design Fluency

df_co_rep

Description :

Number of repeated correct designs

Variable Name Type Min Possible Max Possible
df_co_rep.bedside numeric 0 34

df_corr

Description :

Design Fluency is the Filled Dots condition from the Delis-Kaplan Executive Function Scale (DKEFS), measuring visual generativity. Participants are asked to generate as many different designs as they can in one minute by connecting dots with four straight lines. This task involves the ability to generate novel designs, remember the rules, accurately monitor for repetitions, and perform necessary shifting. Decreased processing speed may also cause poor performance.

Variable Name Type Min Possible Max Possible
df_corr.bedside numeric 0 35

df_rule_v

Description :

Total number of unique rule violations

Variable Name Type Min Possible Max Possible
df_rule_v.bedside numeric 0 35

DFCorrz

Description :

Z-score for Design Fluency performance

Variable Name Type Min Possible Max Possible
DFCorrz.bedside numeric Infinity Infinity

dfrv_rep

Description :

Number of repeated rule violations

Variable Name Type Min Possible Max Possible
dfrv_rep.bedside numeric 0 34

Digit Span

digit_bw

Description :

Digits Backwards was adapted from the version present in the WAIS-III and is considered a task of working memory. The examiner reads a string of numbers and the participant is asked to repeat them in backwards order. The length of the number string increases until the participant can no longer complete the task correctly. The bedside version of this task is focused on recording span length (number of digits that can be reversed correctly), rather than total number of items correct. This task requires both the adequate short-term store of verbal information (i.e., representing the presented digits forward) and the ability to manipulate that information within working memory (i.e., the backwards transform).

Variable Name Type
digit_bw.bedside numeric

digit_fw

Description :

Digits Forwards was adapted from the version present in the WAIS-III and is considered a task of basic attention span. The examiner reads a string of numbers and the participant is asked to repeat them in the same order. The length of the number string increases until the participant can no longer complete the task correctly. The bedside version of this task is focused on recording span length (number of digits that can be recalled correctly), rather than total number of items correct. Patients with reduced levels of attention (e.g., delirium) or reduced short-term auditory store (e.g., logopenic PPA) will do poorly on this task. Patients with reduced forward span will likely due poorly on many other tasks due to an inability to effectively maintain auditorily-presented instructions and/or more general difficulties with attention.

Variable Name Type
digit_fw.bedside numeric

DigitBWz

Description :

Z-score for Digits Backwards performance

Variable Name Type
DigitBWz.bedside numeric

Geriatric Depression Scale

gds_tot

Description :

Sum of scores for all 30 items of the GDS

Variable Name Type Min Possible Max Possible
gds_tot.bedside numeric 0 30

gds1

Description :

The GDS is a self-reported scale of current depressive symptoms. Participants are asked to rate a series of 30 statements as ‘Yes’ or ‘No’ regarding how they have been feeling in the previous two weeks. GDS item 1: “Are you basically satisfied with your life?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds1.bedside 0, 1 numeric Yes, No

gds10

Description :

GDS item 10: “Do you often feel helpless?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds10.bedside 0, 1 numeric Yes, No

gds11

Description :

GDS item 11: “Do you often get restless and fidgety?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds11.bedside 0, 1 numeric Yes, No

gds12

Description :

GDS item 12: “Do you prefer to stay at home rather than go out and do things?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds12.bedside 0, 1 numeric Yes, No

gds13

Description :

GDS item 13: “Do you frequently worry about the future?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds13.bedside 0, 1 numeric Yes, No

gds14

Description :

GDS item 14: “Do you feel you have problems with memory more than most?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds14.bedside 0, 1 numeric Yes, No

gds15

Description :

GDS item 15: “Do you think it is wonderful to be alive now?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds15.bedside 0, 1 numeric Yes, No

gds15to

Description :

Sum of scores for the 15 items included in the Geriatric Depression Scale, short form (15-items)

Variable Name Type Min Possible Max Possible
gds15to.bedside numeric 0 15

gds16

Description :

GDS item 16: “Do you feel downhearted and blue?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds16.bedside 0, 1 numeric Yes, No

gds17

Description :

GDS item 17: “Do you feel pretty worthless the way you are now?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds17.bedside 0, 1 numeric Yes, No

gds18

Description :

GDS item 18: “Do you worry a lot about the past?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds18.bedside 0, 1 numeric Yes, No

gds19

Description :

GDS item 19: “Do you find life very exciting?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds19.bedside 0, 1 numeric Yes, No

gds2

Description :

GDS item 2: “Have you dropped many of your activities and interests?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds2.bedside 0, 1 numeric Yes, No

gds20

Description :

GDS item 20: “Is it hard for you to get started on new projects?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds20.bedside 0, 1 numeric Yes, No

gds21

Description :

GDS item 21: “Do you feel full of energy?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds21.bedside 0, 1 numeric Yes, No

gds22

Description :

GDS item 22: “Do you feel that your situation is hopeless?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds22.bedside 0, 1 numeric Yes, No

gds23

Description :

GDS item 23: “Do you think that most people are better off than you are?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds23.bedside 0, 1 numeric Yes, No

gds24

Description :

GDS item 24: “Do you frequently get upset over little things?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds24.bedside 0, 1 numeric Yes, No

gds25

Description :

GDS item 25: “Do you frequently feel like crying?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds25.bedside 0, 1 numeric Yes, No

gds26

Description :

GDS item 26: “Do you have trouble concentrating?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds26.bedside 0, 1 numeric Yes, No

gds27

Description :

GDS item 27: “Do you enjoy getting up in the morning?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds27.bedside 0, 1 numeric Yes, No

gds28

Description :

GDS item 28: “Do you prefer to avoid social occasions?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds28.bedside 0, 1 numeric Yes, No

gds29

Description :

GDS item 29: “Is it easy for you to make decisions?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds29.bedside 0, 1 numeric Yes, No

gds3

Description :

GDS item 3: “Do you feel that your life is empty?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds3.bedside 0, 1 numeric Yes, No

gds30

Description :

GDS item 30: “Is your mind as clear as it used to be?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds30.bedside 0, 1 numeric Yes, No

gds4

Description :

GDS item 4: “Do you often get bored?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds4.bedside 0, 1 numeric Yes, No

gds5

Description :

GDS item 5: “Are you hopeful about the future?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds5.bedside 0, 1 numeric Yes, No

gds6

Description :

GDS item 6: “Are you bothered by thoughts you can’t get out of your head?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds6.bedside 0, 1 numeric Yes, No

gds7

Description :

GDS item 7: “Are you in good spirits most of the time?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds7.bedside 0, 1 numeric Yes, No

gds8

Description :

GDS item 8: “Are you afraid that something bad is going to happen to you?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds8.bedside 0, 1 numeric Yes, No

gds9

Description :

GDS item 9: “Do you feel happy most of the time?”

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
gds9.bedside 0, 1 numeric Yes, No

Mini Mental State Exam

mmse_tot

Description :

The Mini Mental State Exam is a brief screening measure of global cognitive functioning (orientation, memory, language, executive function, visuospatial skills). Performance is scored out of a possible total of 30 points. The widely accepted cut off score to screening for cognitive impairment on the MMSE is <26.

Variable Name Type Min Possible Max Possible
mmse_tot.bedside numeric 0 30

Modified Trails

mt_corr

Description :

Total number of correct switches made on the Modified Trail Making Task

Variable Name Type Min Possible Max Possible
mt_corr.bedside numeric 0 14

mt_error

Description :

Total number of switching errors made on the Modified Trail Making Test

Variable Name Type
mt_error.bedside numeric

mt_ln

References :

  • *Unclear what this is - delete?
Variable Name Type Min Possible Max Possible
mt_ln.bedside numeric Inf 4.796

mt_ratio

Description :

A ratio measure representing number of correct lines per minute

Variable Name Type Min Possible Max Possible
mt_ratio.bedside numeric Infinity Infinity

mt_time

Description :

The Modified Trail Making Test (MTT) is an adapted version of the traditional Trail Making Test (e.g., from the Delis-Kaplan Executive Function Scale), and is designed to be sensitive to problems with mentally manipulating information, including sequencing and cognitive flexibility. Numbers and days of the week are presented in an random pattern on an A4 sheet of paper and participants are asked to draw a line alternating between numbers and days of the week in order, as quickly as they can (maximum of 120 seconds allowed). Although classically thought of as a task of executive function, the MTT task requires multiple cognitive processes, including visual scanning, speed of processing, and set-shifting abilities. Thus, impairment on this task can be due to a variety of causes. This variable represents the total time (in seconds) taken to complete the task.

Variable Name Type Min Possible Max Possible
mt_time.bedside numeric 0 120

MTTimez

Description :

Z-score for Modified Trails performance

Variable Name Type Min Possible Max Possible
MTTimez.bedside numeric Infinity Infinity

Number Location

numb_loc

Description :

The Number Location test is a subtest on the Visual-Object Spatial Perception Test (VOSP). A box with the numbers 1-9 scattered in random positions is located above another box with a single dot that matches the location (within the box) of one on the numbers above. The participant is asked to identify the number that matches the position of the dot. A total of 10 trials are administered. This task is considered a measure of visuo-perception (dorsal visual stream function), however, patients can frequently demonstrate difficulties on this task due to an inability to understand the abstract nature of the task instructions and/or impulsivity regarding their decision-making.

Variable Name Type
numb_loc.bedside numeric

Stroop

strp_cn_cor

Description :

The Stroop task requires participants to state the colour of ink in which blocks of letters are printed in as quickly as they can. In the color naming condition, blocks of X’s are presented in either blue, green or red across a page. The participant is asked to state the color of the ink the blocks of letters are printed in as quickly as they can without making mistakes. A total of 60 seconds is allowed. This score represents the number of correctly named colors within 60 seconds. This task is considered a measure of information processing speed.

Variable Name Type Min Possible Max Possible
strp_cn_cor.bedside numeric 0 126

strp_cn_err

Description :

Total number of errors made on Stroop (color naming condition)

Variable Name Type Min Possible Max Possible
strp_cn_err.bedside numeric 0 126

strp_cor

Description :

The Stroop task requires participants to state the colour of ink in which blocks of letters are printed in as quickly as they can. In the interference condition, the blocks of letters spell the word of a colour that is different to the colour of the ink the word is printed in. This task is viewed as a measure of executive functioning because the patient has to inhibit the overlearned/automatic reading response, and instead focus on the perceptual attributes of the stimuli (i.e., name the color of the ink). Deficits in response inhibition can be subtle, reflected in disproportionate slowing in color naming on the interference condition relative to the color naming condition, or as frank errors (i.e., reading the words). Thus, comparative analysis of speed between the color naming condition and interference condition are helpful.

Variable Name Type Min Possible Max Possible
strp_cor.bedside numeric 0 77

strp_err

Description :

Total number of uncorrected errors made on Stroop (interference condition)

Variable Name Type Min Possible Max Possible
strp_err.bedside numeric 0 77

strp_sce

Description :

Total number of self-corrected errors made on Stroop (interference condition)

Variable Name Type
strp_sce.bedside numeric

StrpCorz

Description :

Z-score for Stroop (interference condition) performance

Variable Name Type Min Possible Max Possible
StrpCorz.bedside numeric Infinity Infinity

WRAT

wrat_baseline_date

Description :

Date of the particpant’s baseline WRAT performance

Variable Name Type Min Possible Max Possible
wrat_baseline_date.bedside Date N/A N/A

wrat_baseline

Description :

This task is adapted from the Wide Range Achievement Test-Fourth Edition (WRAT-4) and provides an estimate of premorbid verbal skills and reading level. 55 words of increasing length/difficulty are presented on a page and the participant is asked to pronounce each one. The task is discontinued if the participant makes 10 consecutive errors. If the participant can not pronounce at least 5 words on the task, they are asked to identify 15 single letters (when administration of letters is not required, 15 points is added to the total score). The total possible score on this task is therefore 70 (55 + 15). This variable represents the participants WRAT score at their baseline research visit.

Variable Name Type Min Possible Max Possible
wrat_baseline.bedside numeric 0 70

wrat_on_or_before_current_date

Description :

Stating whether current visit is on or before the baseline WRAT

References :

  • *Possibly delete?
Variable Name All Possible Values (Categorical) Type
wrat_on_or_before_current_date.bedside FALSE, TRUE logical

wrat_tot

Description :

Total WRAT score on the current research assessment

Variable Name Type Min Possible Max Possible
wrat_tot.bedside numeric 0 70

wrat_baseline_date

Description :

Date of the particpant’s baseline WRAT performance

Variable Name Type Min Possible Max Possible
wrat_baseline_date.bedside Date N/A N/A

wrat_baseline

Description :

This task is adapted from the Wide Range Achievement Test-Fourth Edition (WRAT-4) and provides an estimate of premorbid verbal skills and reading level. 55 words of increasing length/difficulty are presented on a page and the participant is asked to pronounce each one. The task is discontinued if the participant makes 10 consecutive errors. If the participant can not pronounce at least 5 words on the task, they are asked to identify 15 single letters (when administration of letters is not required, 15 points is added to the total score). The total possible score on this task is therefore 70 (55 + 15). This variable represents the participants WRAT score at their baseline research visit.

Variable Name Type Min Possible Max Possible
wrat_baseline.bedside numeric 0 70

wrat_on_or_before_current_date

Description :

Stating whether current visit is on or before the baseline WRAT

References :

  • *Possibly delete?
Variable Name All Possible Values (Categorical) Type
wrat_on_or_before_current_date.bedside FALSE, TRUE logical

wrat_tot

Description :

Total WRAT score on the current research assessment

Variable Name Type Min Possible Max Possible
wrat_tot.bedside numeric 0 70

berlin_sleep


Berlin_apneaRisk

Variable Name All Possible Values (Categorical) Type
Berlin_apneaRisk.berlin_sleep high risk, low risk character

brainhealthassessment

Description :

The Brain Health Assessment (BHA) battery is part of the Tablet-based Cognitive Assessment Tool (TabCAT). This battery includes two required tests (Favorites, Match), two optional tests (Line Orientation, Animal Fluency), and an optional informant survey (Brain Health Survey [BHS]).

References :

  • Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.

digitsymbol_corr

Description :

Total correct score for Match, which follows a digit-symbol test paradigm. This task requires multiple cognitive processes, including processing speed, working memory, and visual scanning, and thus is sensitive to executive dysfunction.

Variable Name Type Min Possible Max Possible
digitsymbol_corr.brainhealthassessment numeric 0 200

digitsymbol_err

Description :

Total errors made during Match

Variable Name Type
digitsymbol_err.brainhealthassessment numeric

favorites_delay

Description :

Favorites is an associative memory test. This is the total correct at a 10-minute delay.

Variable Name Type
favorites_delay.brainhealthassessment numeric

favorites_recall1

Description :

Favorites is an associative memory test. This is the total correct at the first immediate recall trial.

Variable Name Type
favorites_recall1.brainhealthassessment numeric

favorites_recall2

Description :

Favorites is an associative memory test. This is the total correct at the second immediate recall trial.

Variable Name Type
favorites_recall2.brainhealthassessment numeric

favorites_recog_corr

Description :

Favorites is an associative memory test. This is the total correct at the 10-minute delay recognition trial.

Variable Name Type
favorites_recog_corr.brainhealthassessment numeric

favorites_recog_err

Description :

Favorites is an associative memory test. This is the number of intrusion errors at the 10-minute delay recognition trial (i.e., a previously learned face incorrectly paired with a novel food or animal).

Variable Name Type
favorites_recog_err.brainhealthassessment numeric

favorites_recog_sme

Description :

Favorites is an associative memory test. This is the number of source memory errors at the 10-minute delay recognition trial (i.e., a previously learned food or animal incorrectly paired with a difference face).

Variable Name Type
favorites_recog_sme.brainhealthassessment numeric

favorites_total

Description :

Favorites is an associative memory test. This is the Total Recall score, which is the total number correct summed across the two immediate recall and one 10-minute delayed recall trials

Variable Name Type Min Possible Max Possible
favorites_total.brainhealthassessment numeric 0 24

lo_catchtrial

Description :

TabCAT BHA Line Orientation is modeled after the Benton Judgment of Line Orientation Task. 10 easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicate that the Threshold Score may not be valid.

Variable Name Type
lo_catchtrial.brainhealthassessment numeric

lo_score

Description :

TabCAT BHA Line Orientation is modeled after the Benton Judgment of Line Orientation Task. This is the Threshold Score, which represents the average angle difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.

Variable Name Type Min Possible Max Possible
lo_score.brainhealthassessment numeric 1 90

par_line_catchtrial

Description :

TabCAT BHA Line Length is a visuospatial test in which examinees have to select the longer of two parallel lines. 10 very easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicates that the Threshold Score may not be valid.

Variable Name Type
par_line_catchtrial.brainhealthassessment numeric

par_line_score

Description :

TabCAT BHA Line Length is a visuospatial test in which examinees have to select the longer of two parallel lines. This is the Threshold Score, which represents the average length difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.

Variable Name Type Min Possible Max Possible
par_line_score.brainhealthassessment numeric Anything > 0 Infinity

v_type

Variable Name All Possible Values (Categorical) Type
v_type.brainhealthassessment on-site character

bu_tbi


bu_amfball_yn

Variable Name All Possible Values (Categorical) Type
bu_amfball_yn.bu_tbi 0, 1, 2 numeric

bu_amfball_yrs_ages

Variable Name Type
bu_amfball_yrs_ages.bu_tbi numeric

bu_boxing_yn

Variable Name All Possible Values (Categorical) Type
bu_boxing_yn.bu_tbi 0, 1, 2 numeric

bu_boxing_yrs_selfreport

Variable Name All Possible Values (Categorical) Type
bu_boxing_yrs_selfreport.bu_tbi 1 numeric

bu_concussion_agelast

Variable Name Type Min Possible Max Possible
bu_concussion_agelast.bu_tbi numeric 0 -99

bu_concussiontotal_maxest

Variable Name Type
bu_concussiontotal_maxest.bu_tbi numeric

bu_icehockey_yn

Variable Name All Possible Values (Categorical) Type
bu_icehockey_yn.bu_tbi 0, 1, 2 numeric

bu_icehockey_yrs_ages_all

Variable Name All Possible Values (Categorical) Type
bu_icehockey_yrs_ages_all.bu_tbi 0, 12 numeric

bu_military_blast100_total

Variable Name All Possible Values (Categorical) Type
bu_military_blast100_total.bu_tbi 0, 1, 2, 16, 44 numeric

bu_military_highrisk_yn

Variable Name All Possible Values (Categorical) Type
bu_military_highrisk_yn.bu_tbi 0, 1 numeric

bu_military_yn

Variable Name All Possible Values (Categorical) Type
bu_military_yn.bu_tbi 0, 1 numeric

bu_military_yrs

Variable Name Type
bu_military_yrs.bu_tbi numeric

bu_soccer_yn

Variable Name All Possible Values (Categorical) Type
bu_soccer_yn.bu_tbi 0, 1, 2 numeric

bu_soccer_yrs_selfreport

Variable Name Type
bu_soccer_yrs_selfreport.bu_tbi numeric

cdr

Description :

The Clinical Dementia Rating is a 5-point scale used to characterize six domains of cognitive and functional performance applicable to Alzheimer disease and related dementias: Memory, Orientation, Judgment & Problem Solving, Community Affairs, Home & Hobbies, and Personal Care.

References :

  • Morris, J. C. (1997). Clinical dementia rating: a reliable and valid diagnostic and staging measure for dementia of the Alzheimer type. International psychogeriatrics, 9(S1), 173-176.

cdr_box

Variable Name Type Min Possible Max Possible
cdr_box.cdr numeric 0.0 18.0

cdr_global

Variable Name All Possible Values (Categorical) Type
cdr_global.cdr 0.0, 0.5, 1.0, 2.0, 3.0 numeric

ftld_cdr_box

Variable Name Type Min Possible Max Possible
ftld_cdr_box.cdr numeric 0.0 24.0

ftld_cdr_global

Variable Name All Possible Values (Categorical) Type
ftld_cdr_global.cdr 0.0, 0.5, 1.0, 2.0, 3.0 numeric

champs

Description :

The Community Healthy Activities Model Program for Seniors physical activity questionnaire (CHAMPS) assesses the variety of physical activity that older adult participants may engage in, from less intensive forms such as walking or stretching to more vigorous exercise routine. The questionnaire includes 41 items to evaluate the frequency and duration of light, moderate, and vigorous activities that were performed weekly over the last four weeks. Individuals will select whether they participated in an activity during the four-week period and then select the hours per week spent participating in the activity, rating the duration on a 6-point scale from less than 1 hour to 9 or more hours. Each activity corresponds to a metabolic weight or MET value. Estimated caloric expenditure is then calculated by multiplying the estimated duration of each activity by the corresponding MET value.

References :

  • Stewart, A. L., Mills, K. M., King, A. C., Haskell, W. L., Gillis, D., & Ritter, P. L. (2001). CHAMPS physical activity questionnaire for older adults: outcomes for interventions. Medicine and science in sports and exercise, 33(7), 1126–1141. https://doi.org/10.1097/00005768-200107000-00010

DCDate_physical

Variable Name Type Min Possible Max Possible
DCDate_physical.champs Date 2015-05-21 2023-04-26

METWeightcompleted

Variable Name Type
METWeightcompleted.champs numeric

METWeighted_Q13

Description :

MET weighted score for ch11 (Errands). Score is creating by taking the estimated duration of running errands (0.5 - 9.75)*met value of 2.5

Variable Name Type
METWeighted_Q13.champs numeric

METWeighted_Q15

Description :

MET weighted score for ch13 (golf). Score is creating by taking the estimated duration of time playing golf (0.5 - 9.75)*met value of 2.5

Variable Name Type
METWeighted_Q15.champs numeric

METWeighted_Q20

Description :

MET weighted score for ch18 (tennis). Score is creating by taking the estimated duration of time playing tennis (0.5 - 9.75)*met value of 5

Variable Name All Possible Values (Categorical) Type
METWeighted_Q20.champs 2.50, 8.75, 18.75, 28.75, 48.75 numeric

METWeighted_Q21

Description :

MET weighted score for ch19 (skateboarding). Score is creating by taking the estimated duration of time skateboarding (0.5 - 9.75)*met value of 4.5

Variable Name All Possible Values (Categorical) Type
METWeighted_Q21.champs 4 numeric

METWeighted_Q24

Description :

MET weighted score for ch22 (chores). Score is creating by taking the estimated duration of time doing chores (0.5 - 9.75)*met value of 2.75

Variable Name Type
METWeighted_Q24.champs numeric

METWeighted_Q25

Description :

MET weighted score for ch23 (gardening). Score is creating by taking the estimated duration of time gardening (0.5 - 9.75)*met value of 3.125

Variable Name Type
METWeighted_Q25.champs numeric

METWeighted_Q26

Description :

MET weighted score for ch24 (car). Score is creating by taking the estimated duration of time working on car/lawn/machinery (0.5 - 9.75)*met value of 3

Variable Name All Possible Values (Categorical) Type
METWeighted_Q26.champs 1.50, 5.25, 11.25, 29.25 numeric

METWeighted_Q27

Description :

MET weighted score for ch25 (jogrun). Score is creating by taking the estimated duration of time jogging or running (0.5 - 9.75)*met value of 7

Variable Name All Possible Values (Categorical) Type
METWeighted_Q27.champs 3.50, 12.25, 26.25, 40.25, 68.25 numeric

METWeighted_Q28

Description :

MET weighted score for ch26 (briskwalk). Score is creating by taking the estimated duration of time brisk walking (0.5 - 9.75)*met value of 3.5

Variable Name Type
METWeighted_Q28.champs numeric

METWeighted_Q29

Description :

MET weighted score for ch27 (leisure walk). Score is creating by taking the estimated duration of time leisurely walking (0.5 - 9.75)*met value of 2.5

Variable Name Type
METWeighted_Q29.champs numeric

METWeighted_Q30

Description :

MET weighted score for ch28 (bike ). Score is creating by taking the estimated duration of time riding a bike (0.5 - 9.75)*met value of 4

Variable Name Type
METWeighted_Q30.champs numeric

METWeighted_Q31

Description :

MET weighted score for ch29 (aero). Score is creating by taking the estimated duration of time doing aerobics, rowing, step machines (not treadmill or stationary bike)!! (0.5 - 9.75)*met value of 5

Variable Name Type
METWeighted_Q31.champs numeric

METWeighted_Q32

Description :

MET weighted score for ch30 (swim). Score is creating by taking the estimated duration of time swimming (not treadmill or stationary bike)!! (0.5 - 9.75)*met value of 3.66

Variable Name All Possible Values (Categorical) Type
METWeighted_Q32.champs 1.8330, 6.4155, 13.7475, 21.0795 numeric

METWeighted_Q33

Description :

MET weighted score for ch31 (flexb). Score is creating by taking the estimated duration of time doing stretching or flexibility exercises (not yoga or tai chi)!! (0.5 - 9.75)*met value of 2

Variable Name All Possible Values (Categorical) Type
METWeighted_Q33.champs 1.0, 3.5, 7.5, 11.5, 15.5 numeric

METWeighted_Q34

Description :

MET weighted score for ch32 (yoga). Score is creating by taking the estimated duration of time doing yoga, barre, tai chi, pilates (0.5 - 9.75)*met value of 2

Variable Name Type
METWeighted_Q34.champs numeric

METWeighted_Q35

Description :

MET weighted score for ch33 (danceb). Score is creating by taking the estimated duration of time doing dance (such as square, folk, line, ballroom), not aerobic dance (0.5 - 9.75)*met value of 4.5

Variable Name Type
METWeighted_Q35.champs numeric

METWeighted_Q36

Description :

MET weighted score for ch34 (danceb). Score is creating by taking the estimated duration of time doing aerobics or aerobic dance (0.5 - 9.75)*met value of 3.5

Variable Name All Possible Values (Categorical) Type
METWeighted_Q36.champs 1.750, 6.125, 13.125, 20.125, 27.125 numeric

METWeighted_Q37

Description :

MET weighted score for ch35 (strength). Score is creating by taking the estimated duration of time doing strength training (0.5 - 9.75)*met value of 3.33

Variable Name Type
METWeighted_Q37.champs numeric

METWeighted_Q38

Description :

MET weighted score for ch36 (sport). Score is creating by taking the estimated duration of time playing sports (0.5 - 9.75)*met value of 5

Variable Name All Possible Values (Categorical) Type
METWeighted_Q38.champs 2.50, 8.75, 18.75, 48.75 numeric

New_ALL

Description :

Number of new activities that were began in the past year (irrespective of activity type). Value is calculated by summing the total number of new cognitive, physical, and social activities. **Not 36 because movies is not included in these categories

Variable Name Type Min Possible Max Possible
New_ALL.champs numeric 0 35

New_Cog

Description :

Number of new cognitive activities that were began in the past year (“ch6emailc”,“ch7financc”,“ch8workc”,“ch9cookc”,“ch10medicc”,“ch12craftc”,“ch14attendc”,“ch20instrumc”,“ch21readc”,“ch24carc”)

Variable Name Type
New_Cog.champs numeric

New_Phys

Description :

Number of new physical activities that were began in the past year (ch11errandc”,“ch13golfc”,“ch18tennisc”,“ch19skatec”,“ch22chorec”,“ch23gardenc”,“ch25jogrunc”,“ch26briskwalkc”,“ch27leiswalkc”,“ch28bikec”,“ch29aerobothc”,“ch30swimc”,“ch31flexc”,“ch32yogac”,“ch33dancec”,“ch34aerobc”,“ch35strengthc”,“ch36sportc”)

Variable Name Type
New_Phys.champs numeric

New_Soc

Description :

Number of new social activities that were began in the past year (“ch1friendsc”,“ch2srcenterc”,“ch3volunc”,“ch4worshc”,“ch5clubc”,“ch15gamec”,“ch17billiardc”)

Variable Name All Possible Values (Categorical) Type
New_Soc.champs 0, 1, 2, 3, 4 numeric

TotalCaloricExpenditure

Description :

Sum of all METweighted variables (19) * (weight*0.4539)

Variable Name Type Min Possible Max Possible
TotalCaloricExpenditure.champs numeric 0 12528.99

TotalNum_ALL

Description :

Total # of activities completed in the last 4 weeks, on a typical week (irrespective of activity type). Value is calculated by summing the total number of cognitive, physical, and social activities.

Variable Name Type Min Possible Max Possible
TotalNum_ALL.champs numeric 0 35

TotalNum_Cog

Description :

Total # of cognitive activities completed in the last 4 weeks, on a typical week (“ch6emailc”,“ch7financc”,“ch8workc”,“ch9cookc”,“ch10medicc”,“ch12craftc”,“ch14attendc”,“ch20instrumc”,“ch21readc”,“ch24carc”)

Variable Name Type
TotalNum_Cog.champs numeric

TotalNum_Phys

Description :

Total # of physical activities completed in the last 4 weeks, on a typical week (ch11errandc”,“ch13golfc”,“ch18tennisc”,“ch19skatec”,“ch22chorec”,“ch23gardenc”,“ch25jogrunc”,“ch26briskwalkc”,“ch27leiswalkc”,“ch28bikec”,“ch29aerobothc”,“ch30swimc”,“ch31flexc”,“ch32yogac”,“ch33dancec”,“ch34aerobc”,“ch35strengthc”,“ch36sportc”)

Variable Name Type Min Possible Max Possible
TotalNum_Phys.champs numeric 0 18

TotalNum_Soc

Description :

Total # of social activities completed in the last 4 weeks, on a typical week (“ch1friendsc”,“ch2srcenterc”,“ch3volunc”,“ch4worshc”,“ch5clubc”,“ch15gamec”,“ch17billiardc”)

Variable Name Type
TotalNum_Soc.champs numeric

version

Variable Name All Possible Values (Categorical) Type
version.champs 2 numeric

weight

Description :

Participants weight. Max and min values are to provide very broad possible range

Variable Name Type Min Possible Max Possible
weight.champs numeric 98 400

WklyCount_ALL

Description :

Sum of the count for the times/week the participant completes a given activity (sum of cognitive, physical and social weekly hours variables)

Variable Name Type Min Possible Max Possible
WklyCount_ALL.champs numeric 0 2123.00

WklyCount_Cog

Description :

Sum of the count for the times/week the participant completes all cognitive activites

Variable Name Type Min Possible Max Possible
WklyCount_Cog.champs numeric 0 2098.00

WklyCount_Phys

Description :

Sum of the count for the times/week the participant completes all physical activites

Variable Name Type Min Possible Max Possible
WklyCount_Phys.champs numeric 0 68.00

WklyCount_Soc

Description :

Sum of the count for the times/week the participant completes all social activites

Variable Name Type Min Possible Max Possible
WklyCount_Soc.champs numeric 0 35.00

WklyHrs_ALL

Description :

Sum of the hours spent on all activities per week (cognitive + physical + social weekly hours)

Variable Name Type Min Possible Max Possible
WklyHrs_ALL.champs numeric 0 341.25

WklyHrs_Cog

Description :

Sum of the hours spent on cognitive activities per week

Variable Name Type Min Possible Max Possible
WklyHrs_Cog.champs numeric 0 97.5

WklyHrs_Phys

Description :

Sum of the hours spent on physical activities per week

Variable Name Type Min Possible Max Possible
WklyHrs_Phys.champs numeric 0 175.5

WklyHrs_Soc

Description :

Sum of the hours spent on social activities per week

Variable Name Type Min Possible Max Possible
WklyHrs_Soc.champs numeric 0 68.25

clinical_labs

Description :

Our clinical labs capture routine labs. (Glucose, Hemoglobin, Insulin, Total Cholesterol, triglyceride, HDL, LDL, Choleterol HDL Ratio, NonHDL Cholesterol, hsCRP, and HOMA-IR).


cholesterol_hdl_ratio

Description :

Cholesterol HDL Ratio (mg/dl)

Variable Name Type Min Possible Max Possible
cholesterol_hdl_ratio.clinical_labs numeric 0.3 17.3

glucose_mg_d_l

Description :

Glucose (mg/dl)

Variable Name Type Min Possible Max Possible
glucose_mg_d_l.clinical_labs numeric 37 222

hdl_mg_d_l

Description :

High density lipoprotein (mg/dl)

Variable Name Type Min Possible Max Possible
hdl_mg_d_l.clinical_labs numeric 10 131

hemoglobin_a1c_percent

Description :

Hemoglobin A1C (%)

Variable Name Type Min Possible Max Possible
hemoglobin_a1c_percent.clinical_labs numeric 4.1 9.1

homa_ir

Description :

Homeostatic Model Assessment of insulin resistance

Variable Name Type Min Possible Max Possible
homa_ir.clinical_labs numeric 0.28 79.90

hs_crp_mg_l

Description :

High sensitivity C reactive protein test in mg/l

Variable Name Type Min Possible Max Possible
hs_crp_mg_l.clinical_labs numeric 0.1 97.0

insulin_u_u_ml

Description :

Insulin levels (uU/ml)

Variable Name Type Min Possible Max Possible
insulin_u_u_ml.clinical_labs numeric 1.5 70.6

ldl_mg_d_l

Description :

LDL (low density lipoprotein) levels (mg/dl)

Variable Name Type Min Possible Max Possible
ldl_mg_d_l.clinical_labs numeric 10 349

non_hdl_cholesterol

Description :

Non HDL(high density lipoprotein) cholesterol

Variable Name Type Min Possible Max Possible
non_hdl_cholesterol.clinical_labs numeric 25 277

total_cholesterol_mg_dl

Description :

Total cholesterol (mg/dl)

Variable Name Type Min Possible Max Possible
total_cholesterol_mg_dl.clinical_labs numeric 52 345

triglycerides

Description :

Triglyceride levels

Variable Name Type Min Possible Max Possible
triglycerides.clinical_labs numeric 16 411

cogntive_activity_scale

Description :

The Cognitive Activity Scale (CAS) assesses the frequency of cognitive stimulation throughout life. The CAS is a 25-item interview in which participants are asked to report how often they engaged in common cognitively demanding activities that depend minimally on socioeconomic status, such as reading books or newspapers, writing letters or e-mails, going to the library, and playing games, at 5 age epochs: 6, 12, 18, and 40 years and the current age. Responses for each item were made using a 5-point frequency scale: 5, every day or almost every day; 4, several times a week; 3, several times a month; 2, several times a year; and 1, once a year or less.

References :

  • Wilson, R., Barnes, L., & Bennett, D. (2003). Assessment of lifetime participation in cognitively stimulating activities. Journal of clinical and experimental neuropsychology, 25(5), 634–642. https://doi.org/10.1076/jcen.25.5.634.14572

  • Landau, S. M., Marks, S. M., Mormino, E. C., Rabinovici, G. D., Oh, H., O’Neil, J. P., Wilson, R. S., & Jagust, W. J. (2012). Association of lifetime cognitive engagement and low β-amyloid deposition. Archives of neurology, 69(5), 623–629. https://doi.org/10.1001/archneurol.2011.2748


cas_score

Description :

Final score: Total points/# of questions, not including value “9” which indicates don’t know

Variable Name All Possible Values (Categorical) Type Value Labels
cas_score.cogntive_activity_scale 1, 2, 3, 4, 5, 9 categorical 9= I don’t know, the rest of the values represent the total points/# of questions, where higher scores indicate greater cognitive activity

cas_tot_pts

Description :

Total points for questions 1 through 25, inverse scoring

Variable Name Type Min Possible Max Possible
cas_tot_pts.cogntive_activity_scale numeric 25 125

lca_reading

Description :

Reading total score (sum) from lifetime cognitive activities questions that ask about how many hours per day are spent reading newspapers (#3), magazines (#4), and books (#5), higher scores = more hours spent reading

Variable Name Type Min Possible Max Possible
lca_reading.cogntive_activity_scale numeric 0 12

lca_total

Description :

Total score (sum) of lifetime cognitive activities questions (1, 1a, 2, 2a, 3, 4, 5, 5a, 6, 7, 8)

Variable Name Type Min Possible Max Possible
lca_total.cogntive_activity_scale numeric 2 51

cpt

Description :

The Continuous Performance Test (CPT) is an NIH-EXAMINER response inhibition task, which requires subjects to respond to a certain type of stimulus and withhold a response to another. The examinee is presented with different images and instructed to press a key for only the target image, responding as quickly and accurately as possible. The task consists of 100 experimental trials, 80% of which were the target image. The five non-target images that were presented were of a similar shape and size to the target.

References :

  • Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., Bostrom, A., Sinha, L., Berhel, A., & Widmeyer, M. (2014). NIH EXAMINER: conceptualization and development of an executive function battery. Journal of the International Neuropsychological Society : JINS, 20(1), 11–19. https://doi.org/10.1017/S1355617713001094

total_corr

Description :

Total number of trials where the subject response/non-response was correct

Variable Name Type Min Possible Max Possible
total_corr.cpt numeric 67 250

total_errors

Description :

Total number of trials where the subject response/non-response was incorrect

Variable Name Type Min Possible Max Possible
total_errors.cpt numeric 0 33

csf


ab1_40_pg_m_l

Variable Name Type Min Possible Max Possible
ab1_40_pg_m_l.csf numeric 4445 20511

ab1_42_pg_m_l

Variable Name Type Min Possible Max Possible
ab1_42_pg_m_l.csf numeric 214 1942

csf_spec_id

Variable Name Type Min Possible Max Possible
csf_spec_id.csf numeric 775239 3452428

gap43_156_10000_pg_ml_csf

Variable Name Type Min Possible Max Possible
gap43_156_10000_pg_ml_csf.csf numeric 1301.7 6394.2

ng36_pg_m_l

Variable Name Type Min Possible Max Possible
ng36_pg_m_l.csf numeric 82.610 460.390

p_tau_pg_m_l

Variable Name Type Min Possible Max Possible
p_tau_pg_m_l.csf numeric 15.5 226.9

snap25long_p_m

Variable Name Type Min Possible Max Possible
snap25long_p_m.csf numeric 6.4 33.1

snap25tot_p_m

Variable Name Type Min Possible Max Possible
snap25tot_p_m.csf numeric 16.8 88.0

syt1_p_m

Variable Name Type Min Possible Max Possible
syt1_p_m.csf numeric 9.0 64.4

t_tau_pg_m_l

Variable Name Type Min Possible Max Possible
t_tau_pg_m_l.csf numeric 104 1140

demographics

Description :

The demeographic information collected on each participant comes as a self reported measure collected at their first visit, and updated thereafter with any changes that might occur.


deceased

Description :

Variable marking if participant is deceased or alive

Label Value
0 Alive
1 Deceased
Variable Name All Possible Values (Categorical) Type Value Labels
deceased.demographics 0, 1 categorical Alive, Deceased

educ

Description :

Years of education a participant has

Variable Name Type Min Possible Max Possible
educ.demographics numeric 0 35

gender

Description :

Self-reported gender of the participant. 1 = Male, 2=Female

Label Value
1 Male
2 Female
Variable Name All Possible Values (Categorical) Type Value Labels
gender.demographics 1, 2 categorical Male, Female

hand

Description :

Self-reported handiness of participant

Variable Name All Possible Values (Categorical) Type
hand.demographics AMBIDEXTROUS, LEFT, RIGHT categorical

if_span_or_country_text

Description :

Plain text version of which country themselves or their family report as their ethnicity if they are Hispanic/Latino

Variable Name Type
if_span_or_country_text.demographics character

if_span_or_ctry

Description :

If a participant is Hispanic/Latino, which country themselves or their family report as their ethnicity

Variable Name Type
if_span_or_ctry.demographics categorical

if_span_or_reg_text

Description :

Plain text version of Geographical region of Hispanic/Latin descent - automatically population from Spanish Origin: Country Variable

Variable Name All Possible Values (Categorical) Type
if_span_or_reg_text.demographics North American, South American, Central American, Carribbean, Spain, Other Region, Unknown/Refused to Answer character

if_span_or_reg

Description :

Geographical region of Hispanic/Latin descent - automatically population from Spanish Origin: Country Variable

Label Value
1 North American
2 South American
3 Central American
4 Carribbean
5 Spain
6 Other Region
99 Unknown/Refused to Answer
Variable Name All Possible Values (Categorical) Type Value Labels
if_span_or_reg.demographics 1, 2, 3, 4, 5, 6, 99 categorical North American, South American, Central American, Carribbean, Spain, Other Region, Unknown/Refused to Answer

if_span_or_text

Description :

Plain text version of older version of how Spanish origin was collected: General regions in which the participant may be from

Variable Name Type
if_span_or_text.demographics character

if_span_or

Description :

Older version of how Spanish origin was collected: General regions in which the participant may be from

Variable Name Type
if_span_or.demographics categorical

mult_rac

Description :

Self-reported measure of whether the participant identifies as multi-racial

Label Value
1 Yes
2 No
Variable Name All Possible Values (Categorical) Type Value Labels
mult_rac.demographics 1, 2 categorical Yes, No

primary_language

Description :

Primary language the participant speaks and prefers to communicate in

Variable Name Type
primary_language.demographics character

race_simple_text

Description :

Plain text version of participant’s self reported race

Variable Name Type
race_simple_text.demographics character

race_simple

Description :

Self-reported race of participant

Variable Name Type Min Possible Max Possible
race_simple.demographics categorical 1 99

span_or_text

Description :

Whether the participant reports being of Hispanic/Latino descent

Variable Name All Possible Values (Categorical) Type
span_or_text.demographics No, Yes character

span_or

Description :

Whether the participant reports being of Hispanic/Latino descent

Label Value
1 Yes
2 No
9 Unknown
Variable Name All Possible Values (Categorical) Type Value Labels
span_or.demographics 1, 2, 9 categorical Yes, No, Unknown

testing_language

Description :

Language the participant is tested in

Variable Name Type
testing_language.demographics character

diagnosis

Description :

Clinical syndrome and research diagnoses assigned during case consensus conference review of all available data collected (e.g., history, neurologic exam, cognitive performance, neuroimaging) by a multidisciplinary team including neurologists and neuropsychologists.


clin_syn_best_est

Description :

Best estimate of clinical syndrome based on case consensus conference

Variable Name Type
clin_syn_best_est.diagnosis character

clin_syn_sec_est

Description :

Second best estimate of clinical syndrome based on case consensus conference

Variable Name Type
clin_syn_sec_est.diagnosis character

res_dx_a

Description :

Primary diagnosis per published research diagnostic criteria discussed based on case consensus conference review

Variable Name Type
res_dx_a.diagnosis character

res_dx_b

Description :

Secondary diagnosis per published research diagnostic criteria based on case consensus conference review

Variable Name Type
res_dx_b.diagnosis character

diagnosis_latest

Description :

All participants are given a diagnosis at each time point. These diagnoses are classified through a case consensus conference with board-certified neurologists and neuropsychologists, after a review of cognitive testing, informant interviews, and a thorough neurological exam. Participants are given a clinical syndrome, a research diagnosis, and an estimated predicted neuropathology given the data available at the time of the consensus conference. The diagnosis_latest variable is defined as the diagnosis most recent to a specified date.


clin_syn_best_est

Description :

Based on clinical features, the clinicians best estimate of the syndrome that best characterizes the patient’s CURRENT presentation.

Variable Name Type
clin_syn_best_est.diagnosis_latest character

clin_syn_sec_est

Description :

Based on clinical features, the clinicians secondary (optional) estimate of the syndrome that best characterizes the patient’s CURRENT presentation.

Variable Name Type
clin_syn_sec_est.diagnosis_latest character

res_dx_a

Description :

The subject meets established research criteria for this diagnosis [no priority of diagnosis implied by A,B,C,D,E]

Variable Name Type
res_dx_a.diagnosis_latest character

res_dx_b

Description :

The subject meets established research criteria for this diagnosis [no priority of diagnosis implied by A,B,C,D,E]

Variable Name Type
res_dx_b.diagnosis_latest character

diet

Description :

The diet score comes from the Mediterranean-DASH Diet Intervention for Neurodegenerative Delay (MIND) Diet: MIND Diet Score. The MIND diet score is based on a combination of 10 healthy food groups (leafy green vegetables, other vegetables, nuts, berries, beans, whole grains, fish, poultry, olive oil, and wine) and 5 unhealthy food groups (red meats, butter and stick margarine, cheese, pastries and sweets, fried food, and fast food). The frequency of consumption of each food item for a given score component is summed and then given a concordance score of 0, 0.5, or 1, where 1 represented the highest concordance. The final MIND diet score is the sum of the 15 component scores.

References :

  • Morris, M. C., Tangney, C. C., Wang, Y., Sacks, F. M., Barnes, L. L., Bennett, D. A., & Aggarwal, N. T. (2015). MIND diet slows cognitive decline with aging. Alzheimer’s & dementia : the journal of the Alzheimer’s Association, 11(9), 1015–1022. https://doi.org/10.1016/j.jalz.2015.04.011

  • Panagiotakos, D. B., Pitsavos, C., Arvaniti, F., & Stefanadis, C. (2007). Adherence to the Mediterranean food pattern predicts the prevalence of hypertension, hypercholesterolemia, diabetes and obesity, among healthy adults; the accuracy of the MedDietScore. Preventive medicine, 44(4), 335–340. https://doi.org/10.1016/j.ypmed.2006.12.009


dietq_mindscore

Description :

Total MIND Diet Score (Sum of Q1 - Q15); higher scores indicate greater diet concordance

Variable Name Type Min Possible Max Possible
dietq_mindscore.diet numeric 0 15

dot_counting

Description :

Dot Counting is a working memory task where participants are presented with a series of screens with an array of blue and green circles and squares. The participant is instructed to count the number of blue circles out loud, remembering the total for later recall. The task gets progressively more challenging as more screens are shown.

References :

  • Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., … Widmeyer, M. (2014). NIH EXAMINER: Conceptualization and Development of an Executive Function Battery. Journal of the International Neuropsychological Society, 20(1), 11–19. doi:10.1017/S1355617713001094

  • Bettcher, B. M., Mungas, D., Patel, N., Elofson, J., Dutt, S., Wynn, M., Watson, C. L., Stephens, M., Walsh, C. M., & Kramer, J. H. (2016). Neuroanatomical substrates of executive functions: Beyond prefrontal structures (-1st ed.). Neuropsychologia. https://www.sciencedirect.com/science/article/pii/S0028393216300665


dot_counting_lava

Variable Name Type Min Possible Max Possible
dot_counting_lava.dot_counting numeric 0 27

dot_counting_t1

Description :

trial 1 score

Variable Name All Possible Values (Categorical) Type
dot_counting_t1.dot_counting 0, 1, 2 numeric

dot_counting_t2

Description :

trial 2 scpre

Variable Name All Possible Values (Categorical) Type
dot_counting_t2.dot_counting 0, 1, 2, 3 numeric

dot_counting_t3

Description :

trial 3 score

Variable Name All Possible Values (Categorical) Type
dot_counting_t3.dot_counting 0, 1, 2, 3, 4 numeric

dot_counting_t4

Description :

trial 4 score

Variable Name Type
dot_counting_t4.dot_counting numeric

dot_counting_t5

Description :

trial 5 score

Variable Name Type
dot_counting_t5.dot_counting numeric

dot_counting_t6

Description :

trial 6 score

Variable Name Type
dot_counting_t6.dot_counting numeric

dot_counting_task_duration

Description :

time duration

Variable Name Type Min Possible Max Possible
dot_counting_task_duration.dot_counting numeric 0 748

dot_counting_task_form

Description :

Form Version

Variable Name All Possible Values (Categorical) Type
dot_counting_task_form.dot_counting A, B, C character

dot_counting_task_language

Variable Name All Possible Values (Categorical) Type
dot_counting_task_language.dot_counting English, Spanish (Argentina, Uruguay), Spanish (MEX, ESP, Central America), Spanish-MEX character

dot_counting_task_version

Variable Name All Possible Values (Categorical) Type
dot_counting_task_version.dot_counting 1.0.0, 3.0.0 character

dot_counting_total_score_z

Description :

Z-score

Variable Name Type
dot_counting_total_score_z.dot_counting numeric

dot_counting_total_tabcat

Variable Name Type Min Possible Max Possible
dot_counting_total_tabcat.dot_counting numeric 0 27

earlydevhistory

Description :

The Early Developmental History Screening Questionnaire is a comprehensive survey of early-childhood behavioral and cognitive performance. Individuals were asked to select Likert scale responses (never, sometimes, often, or always) to questions regarding early childhood development and scholastic performance across multiple cognitive domains.

References :

  • Shwe, W., Allen, I., Welch, A. E., Chung, D. H., Pakvasa, M., Pham, J. Q., … & Miller, Z. A. (2019). The UCSF Memory and Aging Center: Early Developmental History Screening Questionnaire (P2. 1-029).

edh_anti

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_anti.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_anx

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_anx.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_art

Label Value
1 Yes
2 No
3 I don’t know
Variable Name All Possible Values (Categorical) Type Value Labels
edh_art.earlydevhistory 1, 2, 3 numeric Yes, No, I don’t know

edh_att

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_att.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_dep

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_dep.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_dys

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_dys.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_f_lan

Label Value
1 Yes
2 No
3 I don’t know
Variable Name All Possible Values (Categorical) Type Value Labels
edh_f_lan.earlydevhistory 1, 2, 3 numeric Yes, No, I don’t know

edh_hyp

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_hyp.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_imp

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_imp.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_lan

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_lan.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_math

Label Value
1 Yes
2 No
3 I don’t know
Variable Name All Possible Values (Categorical) Type Value Labels
edh_math.earlydevhistory 1, 2, 3 numeric Yes, No, I don’t know

edh_mech

Label Value
1 Yes
2 No
3 I don’t know
Variable Name All Possible Values (Categorical) Type Value Labels
edh_mech.earlydevhistory 1, 2, 3 numeric Yes, No, I don’t know

edh_mot

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_mot.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_music

Label Value
1 Yes
2 No
3 I don’t know
Variable Name All Possible Values (Categorical) Type Value Labels
edh_music.earlydevhistory 1, 2, 3 numeric Yes, No, I don’t know

edh_obs

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_obs.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_oth

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_oth.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_read

Label Value
1 Yes
2 No
3 I don’t know
Variable Name All Possible Values (Categorical) Type Value Labels
edh_read.earlydevhistory 1, 2, 3 numeric Yes, No, I don’t know

edh_shy

Label Value
0 Never
1 Sometimes
2 Often
3 Always
9 N/A
Variable Name All Possible Values (Categorical) Type Value Labels
edh_shy.earlydevhistory 0, 1, 2, 3, 9 numeric Never, Sometimes, Often, Always, N/A

edh_spell

Label Value
1 Yes
2 No
3 I don’t know
Variable Name All Possible Values (Categorical) Type Value Labels
edh_spell.earlydevhistory 1, 2, 3 numeric Yes, No, I don’t know

edh_sport

Label Value
1 Yes
2 No
3 I don’t know
Variable Name All Possible Values (Categorical) Type Value Labels
edh_sport.earlydevhistory 1, 2, 3 numeric Yes, No, I don’t know

edinburgh_handedness

Description :

The Edinburgh Handedness Inventory is a questionnaire used to assess the handedness of a subject in activities of daily living (ADLs). The participant is asked to indicate their preference for using their left or right hand for a variety of daily tasks, on a scale of “Only use left hand”, “Prefer left hand”, “Indifferent”, “Prefer right hand”, and “Only use right hand”.

References :

  • Oldfield R. C. (1971). The assessment and analysis of handedness: the Edinburgh inventory. Neuropsychologia, 9(1), 97–113. https://doi.org/10.1016/0028-3932(71)90067-4

ehi_tot

Description :

Total score

Variable Name Type Min Possible Max Possible
ehi_tot.edinburgh_handedness numeric 2 60

ehi1

Description :

Hand preference for “Writing”

Label Value
1 Only use left hand
2 Prefer left hand
3 Indifferent
4 Prefer right hand
5 Only use right hand
Variable Name All Possible Values (Categorical) Type Value Labels
ehi1.edinburgh_handedness 1, 2, 3, 4, 5 numeric Only use left hand, Prefer left hand, Indifferent, Prefer right hand, Only use right hand

ehi10

Description :

Hand preference for “Opening Box (lid)”

Variable Name Type
ehi10.edinburgh_handedness numeric

ehi11

Description :

Which foot the subject prefers to kick with

Variable Name Type
ehi11.edinburgh_handedness numeric

ehi12

Description :

Which eye the subject uses when only needing one

Variable Name Type
ehi12.edinburgh_handedness numeric

ehi2

Description :

Hand preference for “Drawing”

Variable Name Type
ehi2.edinburgh_handedness numeric

ehi3

Description :

Hand preference for “Throwing”

Variable Name Type
ehi3.edinburgh_handedness numeric

ehi4

Description :

Hand preference for “Scissors”

Variable Name Type
ehi4.edinburgh_handedness numeric

ehi5

Description :

Hand preference for “Toothbrush”

Variable Name Type
ehi5.edinburgh_handedness numeric

ehi6

Description :

Hand preference for “Knife (without a fork)”

Variable Name Type
ehi6.edinburgh_handedness numeric

ehi7

Description :

Hand preference for “Spoon”

Variable Name Type
ehi7.edinburgh_handedness numeric

ehi8

Description :

Hand preference for “Broom (upper hand)”

Variable Name Type
ehi8.edinburgh_handedness numeric

ehi9

Description :

Hand preference for “Striking Match”

Variable Name Type
ehi9.edinburgh_handedness numeric

natural_l

Description :

Whether the subject was naturally left handed and taught (or forced) to switch handedness at a young age

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
natural_l.edinburgh_handedness 0, 1 numeric Yes, No

natural_r

Description :

Whether the subject was naturally right handed and taught (or forced) to switch handedness at a young age

Label Value
0 Yes
1 No
Variable Name All Possible Values (Categorical) Type Value Labels
natural_r.edinburgh_handedness 0, 1 numeric Yes, No

enclosedflanker


flankerinc

Variable Name Type Min Possible Max Possible
flankerinc.enclosedflanker numeric 0.666 10.109

flkincacc

Variable Name Type Min Possible Max Possible
flkincacc.enclosedflanker numeric 0.000 1.000

flkincaccscore

Variable Name Type Min Possible Max Possible
flkincaccscore.enclosedflanker numeric 0.000 5.000

flkinclog

Variable Name Type Min Possible Max Possible
flkinclog.enclosedflanker numeric 2.595 3.287

flkincrtscore

Variable Name Type Min Possible Max Possible
flkincrtscore.enclosedflanker numeric 0.032 -6.369

flkincstem

Variable Name Type Min Possible Max Possible
flkincstem.enclosedflanker numeric 0.014 -0.022

task

Variable Name All Possible Values (Categorical) Type
task.enclosedflanker AgingCog_EnclosedFlanker, Flanker_RO1_Behavioral character

version

Variable Name All Possible Values (Categorical) Type
version.enclosedflanker 1, 1.0.1, 1.0.2 character

epworth_sleepiness

Description :

The Epworth Sleepiness Scale is widely used in the field of sleep medicine as a subjective measure of a patient’s sleepiness. The questionnaire is a list of eight situations in which you rate your tendency to become sleepy on a scale of 0, no chance of dozing, to 3, high chance of dozing. The scale estimates whether you are experiencing excessive sleepiness that possibly requires medical attention.

References :

  • Johns, M. W. (1991). A new method for measuring daytime sleepiness: the Epworth sleepiness scale. sleep, 14(6), 540-545.

ESStotal

Description :

Total score on questionnaire. The higher the total the higher daytime sleepiness a participant experiences.

Variable Name Type Min Possible Max Possible
ESStotal.epworth_sleepiness numeric 0 21

everydaycogself

Description :

This is a 51-item self-report questionnaire combinining items from the Everyday Cognition (ECog) questionnaire and the Daily Function Questionnaire (DFQ). Participants are asked to rate whether they’ve experienced a change in their ability to do different domain-specific tasks compared to 10 years ago. Response options include: 1=Better or no change; 2=Questionable/occasionally worse; 3=Consistently a little worse; 4=Consistently much worse

References :

  • Farias, S. T., Mungas, D., Reed, B. R., Cahn-Weiner, D., Jagust, W., Baynes, K., & DeCarli, C. (2008). The measurement of everyday cognition (ECog): scale development and psychometric properties. Neuropsychology, 22(4), 531.

  • Farias, S. T., Mungas, D., & Jagust, W. (2005). Degree of discrepancy between self and other‐reported everyday functioning by cognitive status: dementia, mild cognitive impairment, and healthy elders. International Journal of Geriatric Psychiatry: A journal of the psychiatry of late life and allied sciences, 20(9), 827-834.


ec_attn_score

Description :

Executive Function/Attention composite score averaging the responses from 5 attention-specific items

Variable Name Type Min Possible Max Possible
ec_attn_score.everydaycogself numeric 1 4

ec_concern

Description :

Single item asking about concern about memory or thinking problems (yes/no)

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
ec_concern.everydaycogself 0, 1 categorical No, Yes

ec_lang_score

Description :

Language composite score averaging the responses from 9 language-specific items

Variable Name Type Min Possible Max Possible
ec_lang_score.everydaycogself numeric 1 4

ec_mem_score

Description :

Memory composite score averaging the responses from 11 memory-specific items

Variable Name Type Min Possible Max Possible
ec_mem_score.everydaycogself numeric 1 4

ec_org_score

Description :

Executive Function/Organization composite score averaging the responses from 7 organization-specific items

Variable Name Type Min Possible Max Possible
ec_org_score.everydaycogself numeric 1 4

ec_other_score

Description :

Composite score averaging the responses from 7 “other” items

Variable Name Type
ec_other_score.everydaycogself numeric

ec_plan_score

Description :

Executive Function/Planning composite score averaging the responses from 5 planning-specific items

Variable Name Type Min Possible Max Possible
ec_plan_score.everydaycogself numeric 1 4

ec_score

Description :

Total Score: Average of all item responses

Variable Name Type Min Possible Max Possible
ec_score.everydaycogself numeric 1 4

ec_vis_score

Description :

Visuospatial composite score averaging the responses from 7 visuospatial-specific items

Variable Name Type Min Possible Max Possible
ec_vis_score.everydaycogself numeric 1 4

faq

Description :

The Functional Activities Questionnaire (FAQ) measures instrumental activities of daily living (IADLs), such as preparing balanced meals and managing personal finances

References :

  • Pfeffer, R.I., Kurosaki, T.T., Harrah, C.H. Jr., Chance, J.M., & Filos, S. (1982). Measurement of functional activities in older adults in the community. Journal of Gerontology, 37(3), 323-329. Reprinted with permission of Oxford University Press.

  • Mayo, A. M. (2016). Use of the Functional Activities Questionnaire in older adults with dementia. Hartford Inst Geriatr Nurs, 13(2).


faq_tot

Description :

10-item questionnaire in which patient is rated as follows on different activities of daily living (Dependent = 3 • Requires assistance = 2 • Has difficulty but does by self = 1 • Never did and would have difficulty now = 1, Normal = 0 • Never did [the activity] but could do now = 0). Total score ranges from 0-30 with higher numbers indicating more functional impairment.

References :

  • Mayo, A. M. (2016). Use of the Functional Activities Questionnaire in older adults with dementia. Hartford Inst Geriatr Nurs, 13(2).
Variable Name Type Min Possible Max Possible
faq_tot.faq numeric 0 30

fishermanstory

Description :

The Fishermen Story is a 20-unit story that is read aloud to the examinee across a minimum of 5 learning trials. Additional learning trials are administered until the examinee reaches a 90% mastery criterion (18/20 units) to help control for initial learning levels. The examinee is then asked to recall the story 30 minutes after and one week later.

References :

  • Lindbergh, C. A., Walker, N., La Joie, R., Weiner-Light, S., Staffaroni, A. M., Casaletto, K. B., … Kramer, J. H. (2021). Worth the Wait: Delayed Recall after 1 Week Predicts Cognitive and Medial Temporal Lobe Trajectories in Older Adults. Journal of the International Neuropsychological Society, 27(4), 382–388. doi:10.1017/S1355617720001009

total30min

Description :

How much of the story the participant recalls after 30 minutes.

Variable Name Type Min Possible Max Possible
total30min.fishermanstory numeric 0 20

totalweek

Description :

How much of the story the participants recalls after one week.

Variable Name Type Min Possible Max Possible
totalweek.fishermanstory numeric 0 20

fitbit

Description :

Participants are asked to wear a Fitbit device for 30 days. Daily aggregate and minute-level information about step counts, sleep, and heart rate are collected. Step cadence metrics were based on published data summarized in Tudor-Locke et al., 2018.

References :

  • Paolillo, E. W., Lee, S. Y., VandeBunte, A., Djukic, N., Fonseca, C., Kramer, J. H., & Casaletto, K. B. (2022). Wearable use in an observational study among older adults: adherence, feasibility, and effects of clinicodemographic factors. Frontiers in Digital Health, 4, 884208.

  • Tudor-Locke, C., Han, H., Aguiar, E. J., Barreira, T. V., Schuna Jr, J. M., Kang, M., & Rowe, D. A. (2018). How fast is fast enough? Walking cadence (steps/min) as a practical estimate of intensity in adults: a narrative review. British journal of sports medicine, 52(12), 776-788


average_daily_calories

Description :

An average of the daily estimated total energy expenditure (in kilocalories) across study days.

Variable Name Type Min Possible Max Possible
average_daily_calories.fitbit numeric 1 Infinity

average_mins_asleep

Description :

Average number of minutes classified as being asleep per night across study days

Variable Name Type Min Possible Max Possible
average_mins_asleep.fitbit numeric 0 1440

average_mins_deep

Description :

Average number of minutes classified as being in deep sleep per night across study days

Variable Name Type Min Possible Max Possible
average_mins_deep.fitbit numeric 0 1440

average_mins_light

Description :

Average number of minutes classified as being in light sleep per night across study days

Variable Name Type Min Possible Max Possible
average_mins_light.fitbit numeric 0 1440

average_mins_REM

Description :

Average number of minutes classified as being in REM sleep per night across study days

Variable Name Type Min Possible Max Possible
average_mins_REM.fitbit numeric 0 1440

average_time_awake

Description :

Average number of minutes classified as being in awake per night across study days

Variable Name Type Min Possible Max Possible
average_time_awake.fitbit numeric 0 1440

average_time_in_bed

Description :

Average number of minutes classified as being in bed (including awake, light, deep, and REM sleep) during defined sleep periods across study days

Variable Name Type Min Possible Max Possible
average_time_in_bed.fitbit numeric 0 1440

calorie_days

Description :

Number of days with Fitbit calorie data

Variable Name Type Min Possible Max Possible
calorie_days.fitbit numeric 7 75

daily_days

Description :

Number of days with daily aggregate step count data

Variable Name Type Min Possible Max Possible
daily_days.fitbit numeric 7 75

daily_step_variability_rmssd_daily

Description :

The Root Mean Square of Successive Differences (RMSSD) of total daily step counts across study days

Variable Name Type Min Possible Max Possible
daily_step_variability_rmssd_daily.fitbit numeric 0 Infinity

daily_steps_avg_daily

Description :

Average number of steps taken per day across study days

Variable Name Type Min Possible Max Possible
daily_steps_avg_daily.fitbit numeric 100 Infinity

end

Description :

End date of Fitbit monitoring period

Variable Name Type Min Possible Max Possible
end.fitbit Date 2017-10-25 Infinity

fitbit_model

Description :

Fitbit model used for monitoring

Variable Name All Possible Values (Categorical) Type
fitbit_model.fitbit Charge 2, Charge 4, Flex 2, Inspire 2 character

heartrate_days

Description :

Number of days with Fitbit daily aggregate heartrate data

Variable Name Type Min Possible Max Possible
heartrate_days.fitbit numeric 7 75

HRV_average_daily_rmssd

Description :

The Root Mean Square of Successive Differences (RMSSD) between heart beats during sleep (i.e., all sleep stages). It measures short-term variability in the user’s heart rate in milliseconds (ms). This nightly value is then averaged across study days.

Variable Name Type Min Possible Max Possible
HRV_average_daily_rmssd.fitbit numeric Anything >0 Infinity

HRV_average_deep_rmssd

Description :

The Root Mean Square of Successive Differences (RMSSD) between heart beats during deep sleep only. It measures short-term variability in the user’s heart rate in milliseconds (ms). This nightly value is then averaged across study days.

Variable Name Type Min Possible Max Possible
HRV_average_deep_rmssd.fitbit numeric Anything >0 Infinity

HRV_days

Description :

Number of days with Fitbit HRV data

Variable Name Type Min Possible Max Possible
HRV_days.fitbit numeric 7 75

max_10min_avg_per_day_across_days_average

Description :

Average steps/min of the maximum number of steps obtained over 10 continuous minutes each day, then averaged across study days

Variable Name Type Min Possible Max Possible
max_10min_avg_per_day_across_days_average.fitbit numeric Anything >0 Infinity

max_20min_avg_per_day_across_days_average

Description :

Average steps/min of the maximum number of steps obtained over 20 continuous minutes each day, then averaged across study days

Variable Name Type Min Possible Max Possible
max_20min_avg_per_day_across_days_average.fitbit numeric Anything >0 Infinity

max_30min_avg_per_day_across_days_average

Description :

Average steps/min of the maximum number of steps obtained over 30 continuous minutes each day, then averaged across study days

Variable Name Type Min Possible Max Possible
max_30min_avg_per_day_across_days_average.fitbit numeric Anything >0 Infinity

max_5min_avg_per_day_across_days_average

Description :

Average steps/min of the maximum number of steps obtained over 5 continuous minutes each day, then averaged across study days

Variable Name Type Min Possible Max Possible
max_5min_avg_per_day_across_days_average.fitbit numeric Anything >0 Infinity

max_60min_avg_per_day_across_days_average

Description :

Average steps/min of the maximum number of steps obtained over 60 continuous minutes each day, then averaged across study days

Variable Name Type Min Possible Max Possible
max_60min_avg_per_day_across_days_average.fitbit numeric Anything >0 Infinity

min_days

Description :

Number of days with minute-level step count data

Variable Name Type Min Possible Max Possible
min_days.fitbit numeric 7 75

mins_per_day_high_across_days_average

Description :

Total minutes spent at >= 120 steps/min each day, then averaged across days

Variable Name Type Min Possible Max Possible
mins_per_day_high_across_days_average.fitbit numeric 0 Infinity

mins_per_day_incidental_across_days_average

Description :

Total minutes spent at 1-39 steps/min each day, then averaged across days

Variable Name Type Min Possible Max Possible
mins_per_day_incidental_across_days_average.fitbit numeric 0 Infinity

mins_per_day_moderate_across_days_average

Description :

Total minutes spent at 80-119 steps/min each day, then averaged across days

Variable Name Type Min Possible Max Possible
mins_per_day_moderate_across_days_average.fitbit numeric 0 Infinity

mins_per_day_purposeful_across_days_average

Description :

Total minutes spent at 40-79 steps/min each day, then averaged across days

Variable Name Type Min Possible Max Possible
mins_per_day_purposeful_across_days_average.fitbit numeric 0 Infinity

mins_per_day_sedentary_across_days_average

Description :

Total minutes spent at 0 steps/min each day (including likely periods of sleep), then averaged across days.

Variable Name Type Min Possible Max Possible
mins_per_day_sedentary_across_days_average.fitbit numeric 0 Infinity

peak_1min_steps_per_day_across_days_average

Description :

Steps/min recorded for the highest single minute in a day

Variable Name Type Min Possible Max Possible
peak_1min_steps_per_day_across_days_average.fitbit numeric 1 Infinity

peak30_steps_per_min_across_days_average

Description :

Average steps/min recorded for the 30 highest, but not necessarily consecutive, minutes in a day

Variable Name Type Min Possible Max Possible
peak30_steps_per_min_across_days_average.fitbit numeric Anything >0 Infinity

peak60_steps_per_min_across_days_average

Description :

Average steps/min recorded for the 60 highest, but not necessarily consecutive, minutes in a day

Variable Name Type Min Possible Max Possible
peak60_steps_per_min_across_days_average.fitbit numeric Anything >0 Infinity

project_type

Description :

Parent study from which participant was recruited

Variable Name Type
project_type.fitbit character

sleep_days

Description :

Number of days with Fitbit sleep data

Variable Name Type Min Possible Max Possible
sleep_days.fitbit numeric 7 75

start

Description :

Start date of Fitbit monitoring period

Variable Name Type Min Possible Max Possible
start.fitbit Date 2017-09-26 2023-08-03

steps_per_min_avg_across_days_average

Description :

Average steps/min across all minutes of each day, then averaged across study days

Variable Name Type Min Possible Max Possible
steps_per_min_avg_across_days_average.fitbit numeric Anything >0 Infinity

sum_steps_per_day_high_across_days_average

Description :

Total number of steps taken during minutes spent at >= 120 steps/min each day, then averaged across days

Variable Name Type Min Possible Max Possible
sum_steps_per_day_high_across_days_average.fitbit numeric 0 Infinity

sum_steps_per_day_incidental_across_days_average

Description :

Total number of steps taken during minutes spent at 1-39 steps/min each day, then averaged across days

Variable Name Type Min Possible Max Possible
sum_steps_per_day_incidental_across_days_average.fitbit numeric 0 Infinity

sum_steps_per_day_moderate_across_days_average

Description :

Total number of steps taken during minutes spent at 80-119 steps/min each day, then averaged across days

Variable Name Type Min Possible Max Possible
sum_steps_per_day_moderate_across_days_average.fitbit numeric 0 Infinity

sum_steps_per_day_purposeful_across_days_average

Description :

Total number of steps taken during minutes spent at 40-79 steps/min each day, then averaged across days

Variable Name Type Min Possible Max Possible
sum_steps_per_day_purposeful_across_days_average.fitbit numeric 0 Infinity

timepoint_average_heartrate

Description :

Average daily heartrate across study days

Variable Name Type Min Possible Max Possible
timepoint_average_heartrate.fitbit numeric Anything >0 Infinity

Timepoint

Description :

Fitbit visit number, e.g., if this is a participants’ second time completing a 30-day Fitbit monitoring period, their timepoint would be 2

Variable Name All Possible Values (Categorical) Type
Timepoint.fitbit 1, 2, 3, 4 numeric

gad

Description :

The Generalised Anxiety Disorder Assessment (GAD-7) is a seven-item instrument that is used to measure or assess the severity of generalised anxiety disorder (GAD).

References :

  • Spitzer, R. L., Kroenke, K., Williams, J. B., & Löwe, B. (2006). A brief measure for assessing generalized anxiety disorder: the GAD-7. Archives of internal medicine, 166(10), 1092-1097.

gad7_tot

Description :

Responses of how often bothered by a symptom in the last 2 weeks, rated as not at all,” “several days,” “more than half the days,” and “nearly every day,” and scored as 0, 1, 2, and 3, respectively. Total score is a sum across 7-items (range 0-21).

References :

  • Spitzer, R. L., Kroenke, K., Williams, J. B., & Löwe, B. (2006). A brief measure for assessing generalized anxiety disorder: the GAD-7. Archives of internal medicine, 166(10), 1092-1097.
Variable Name Type Min Possible Max Possible
gad7_tot.gad numeric 0 21

gait

Description :

A gait speed measure where participants are asked to walk a certain distance at their normal walking speed as well as a fast as they can walk without running.


gait_distance

Description :

The distance in meters the participant was asked to walk

Variable Name All Possible Values (Categorical) Type
gait_distance.gait 3, 6, 8 numeric

gait_leisure_avg

Description :

Calculated average in seconds, from three trials of a participant walking during the “leisure” conditions. Leisure conditions asks the participant to walk at their normal walking speed for a specified distance.

Variable Name Type Min Possible Max Possible
gait_leisure_avg.gait numeric 0 infinity

gait_speed_avg

Description :

Calculated average in seconds, from three trials of a participant walking during the “speed” condition. Speed condition asks the participant to walk as fast as they can without running

Variable Name Type Min Possible Max Possible
gait_speed_avg.gait numeric 0 infinity

gait_version

Description :

Updated versions of the gait task throughout the years. Differences between versions is distance the participant is asked to walk, which is specified in the gait_distance.gait variable

Variable Name All Possible Values (Categorical) Type
gait_version.gait 1, 2, 3 numeric

genetics


9p21_plasmatau_source

Variable Name All Possible Values (Categorical) Type
9p21_plasmatau_source.genetics sequenom character

9p21_plasmatau

Variable Name All Possible Values (Categorical) Type
9p21_plasmatau.genetics C/C, C/T, T/T character

ABCA7_source

Variable Name All Possible Values (Categorical) Type
ABCA7_source.genetics sequenom character

ABCA7

Variable Name All Possible Values (Categorical) Type
ABCA7.genetics G/G, G/T, T/T character

ACE_1_source

Variable Name All Possible Values (Categorical) Type
ACE_1_source.genetics sequenom character

ACE_1

Variable Name All Possible Values (Categorical) Type
ACE_1.genetics A/A, A/G, G/G character

ADRA2B_source

Variable Name All Possible Values (Categorical) Type
ADRA2B_source.genetics sequenom character

ADRA2B

Variable Name All Possible Values (Categorical) Type
ADRA2B.genetics D/D, D/I, I/I character

ApoE_source

Variable Name All Possible Values (Categorical) Type
ApoE_source.genetics omni, sequenom, sequenom + omni character

ApoE

Variable Name Type
ApoE.genetics character

APP_1_source

Variable Name All Possible Values (Categorical) Type
APP_1_source.genetics sequenom character

APP_1

Variable Name All Possible Values (Categorical) Type
APP_1.genetics A/A character

APP_source

Variable Name All Possible Values (Categorical) Type
APP_source.genetics sequenom character

APP

Variable Name All Possible Values (Categorical) Type
APP.genetics Negative character

ATP2C2_1_rs11860694_source

Variable Name All Possible Values (Categorical) Type
ATP2C2_1_rs11860694_source.genetics sequenom character

ATP2C2_1_rs11860694

Variable Name All Possible Values (Categorical) Type
ATP2C2_1_rs11860694.genetics C/C, C/G, G/G character

ATP2C2_2_rs8053211_source

Variable Name All Possible Values (Categorical) Type
ATP2C2_2_rs8053211_source.genetics omni, sequenom, sequenom + omni character

ATP2C2_2_rs8053211

Variable Name All Possible Values (Categorical) Type
ATP2C2_2_rs8053211.genetics A/A, A/G, G/G character

AVPR1A_RS1_source

Variable Name All Possible Values (Categorical) Type
AVPR1A_RS1_source.genetics sequenom character

AVPR1A_RS1

Variable Name Type
AVPR1A_RS1.genetics character

BDNF_rs6265_source

Variable Name All Possible Values (Categorical) Type
BDNF_rs6265_source.genetics omni, sequenom, sequenom + omni character

BDNF_rs6265

Variable Name All Possible Values (Categorical) Type
BDNF_rs6265.genetics C/C, C/T, T/T character

BIN1_source

Variable Name All Possible Values (Categorical) Type
BIN1_source.genetics sequenom character

BIN1

Variable Name All Possible Values (Categorical) Type
BIN1.genetics A/A, A/G, G/G character

BRAF_V600E_source

Variable Name All Possible Values (Categorical) Type
BRAF_V600E_source.genetics sequenom character

BRAF_V600E

Variable Name All Possible Values (Categorical) Type
BRAF_V600E.genetics A/A character

C2ORF3_rs917235_source

Variable Name All Possible Values (Categorical) Type
C2ORF3_rs917235_source.genetics omni, sequenom, sequenom + omni character

C2ORF3_rs917235

Variable Name All Possible Values (Categorical) Type
C2ORF3_rs917235.genetics A/A, A/G, G/A, G/G character

C9orf72_1_rs10757668_source

Variable Name All Possible Values (Categorical) Type
C9orf72_1_rs10757668_source.genetics omni, sequenom, sequenom + omni character

C9orf72_1_rs10757668

Variable Name All Possible Values (Categorical) Type
C9orf72_1_rs10757668.genetics C/C, C/T, T/T character

C9ORF72_source

Variable Name All Possible Values (Categorical) Type
C9ORF72_source.genetics sequenom character

C9ORF72

Variable Name All Possible Values (Categorical) Type
C9ORF72.genetics negative, Negative character

CAMK2B_1_source

Variable Name All Possible Values (Categorical) Type
CAMK2B_1_source.genetics sequenom character

CAMK2B_1

Variable Name All Possible Values (Categorical) Type
CAMK2B_1.genetics C/C, C/T character

CCL11_source

Variable Name All Possible Values (Categorical) Type
CCL11_source.genetics sequenom character

CCL11

Variable Name All Possible Values (Categorical) Type
CCL11.genetics A/G, G/G character

CCR5_source

Variable Name All Possible Values (Categorical) Type
CCR5_source.genetics sequenom character

CCR5

Variable Name All Possible Values (Categorical) Type
CCR5.genetics -/-, -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA, GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGG character

CD2AP_1_rs9349407_source

Variable Name All Possible Values (Categorical) Type
CD2AP_1_rs9349407_source.genetics sequenom character

CD2AP_1_rs9349407

Variable Name All Possible Values (Categorical) Type
CD2AP_1_rs9349407.genetics C/C, C/G, G/G character

CDC42BPA_rs1320490_source

Variable Name All Possible Values (Categorical) Type
CDC42BPA_rs1320490_source.genetics sequenom character

CDC42BPA_rs1320490

Variable Name All Possible Values (Categorical) Type
CDC42BPA_rs1320490.genetics C/C, C/G, G/G character

CETP_rs5882_source

Variable Name All Possible Values (Categorical) Type
CETP_rs5882_source.genetics omni, sequenom, sequenom + omni character

CETP_rs5882

Variable Name All Possible Values (Categorical) Type
CETP_rs5882.genetics A/A, A/G, G/A, G/G character

chr9_rs3849942_source

Variable Name All Possible Values (Categorical) Type
chr9_rs3849942_source.genetics omni, sequenom, sequenom + omni character

chr9_rs3849942

Variable Name All Possible Values (Categorical) Type
chr9_rs3849942.genetics C/C, C/T, T/C, T/T character

CLU_rs11136000_source

Variable Name All Possible Values (Categorical) Type
CLU_rs11136000_source.genetics omni, sequenom, sequenom + omni character

CLU_rs11136000

Variable Name All Possible Values (Categorical) Type
CLU_rs11136000.genetics C/C, C/T, T/C, T/T character

CMIP_1_rs6564903_source

Variable Name All Possible Values (Categorical) Type
CMIP_1_rs6564903_source.genetics sequenom character

CMIP_1_rs6564903

Variable Name All Possible Values (Categorical) Type
CMIP_1_rs6564903.genetics C/C, C/T, T/T character

CMIP_2_rs16955705_source

Variable Name All Possible Values (Categorical) Type
CMIP_2_rs16955705_source.genetics sequenom character

CMIP_2_rs16955705

Variable Name All Possible Values (Categorical) Type
CMIP_2_rs16955705.genetics A/A, A/C, C/C character

CNTNAP2_1_rs17236239_source

Variable Name All Possible Values (Categorical) Type
CNTNAP2_1_rs17236239_source.genetics sequenom character

CNTNAP2_1_rs17236239

Variable Name All Possible Values (Categorical) Type
CNTNAP2_1_rs17236239.genetics A/A, A/G, G/G character

CNTNAP2_2_rs4431523_source

Variable Name All Possible Values (Categorical) Type
CNTNAP2_2_rs4431523_source.genetics sequenom character

CNTNAP2_2_rs4431523

Variable Name All Possible Values (Categorical) Type
CNTNAP2_2_rs4431523.genetics C/C, C/T, T/T character

COMT_rs4680_source

Variable Name All Possible Values (Categorical) Type
COMT_rs4680_source.genetics omni, sequenom, sequenom + omni character

COMT_rs4680

Variable Name All Possible Values (Categorical) Type
COMT_rs4680.genetics A/A, A/G, G/A, G/G character

CPE_source

Variable Name All Possible Values (Categorical) Type
CPE_source.genetics sequenom character

CPE

Variable Name All Possible Values (Categorical) Type
CPE.genetics A/A, A/G, G/G character

CPEB3_rs11186856_source

Variable Name All Possible Values (Categorical) Type
CPEB3_rs11186856_source.genetics omni, sequenom + omni character

CPEB3_rs11186856

Variable Name All Possible Values (Categorical) Type
CPEB3_rs11186856.genetics A/A, A/G, G/G character

CR1_1_rs6701713_source

Variable Name All Possible Values (Categorical) Type
CR1_1_rs6701713_source.genetics omni, sequenom, sequenom + omni character

CR1_1_rs6701713

Variable Name All Possible Values (Categorical) Type
CR1_1_rs6701713.genetics A/A, A/G, G/G character

CR1_3_source

Variable Name All Possible Values (Categorical) Type
CR1_3_source.genetics sequenom character

CR1_3

Variable Name All Possible Values (Categorical) Type
CR1_3.genetics A/A, A/G, G/G character

CTNNA2_1_rs1446109_source

Variable Name All Possible Values (Categorical) Type
CTNNA2_1_rs1446109_source.genetics omni, sequenom, sequenom + omni character

CTNNA2_1_rs1446109

Variable Name All Possible Values (Categorical) Type
CTNNA2_1_rs1446109.genetics A/A, A/G, G/G character

CTNNA2_2_rs1007371_source

Variable Name All Possible Values (Categorical) Type
CTNNA2_2_rs1007371_source.genetics sequenom character

CTNNA2_2_rs1007371

Variable Name All Possible Values (Categorical) Type
CTNNA2_2_rs1007371.genetics A/A, A/T, T/T character

CTNNA2_3_rs723524_source

Variable Name All Possible Values (Categorical) Type
CTNNA2_3_rs723524_source.genetics omni, sequenom, sequenom + omni character

CTNNA2_3_rs723524

Variable Name All Possible Values (Categorical) Type
CTNNA2_3_rs723524.genetics G/G, G/T, T/T character

CUGBP2_1_rs201119_source

Variable Name All Possible Values (Categorical) Type
CUGBP2_1_rs201119_source.genetics omni, sequenom, sequenom + omni character

CUGBP2_1_rs201119

Variable Name All Possible Values (Categorical) Type
CUGBP2_1_rs201119.genetics C/C, C/T, T/C, T/T character

CYP46A1_1_rs754203_source

Variable Name All Possible Values (Categorical) Type
CYP46A1_1_rs754203_source.genetics sequenom character

CYP46A1_1_rs754203

Variable Name All Possible Values (Categorical) Type
CYP46A1_1_rs754203.genetics A/A, A/G, G/G character

DCDC2_1_rs1419228_source

Variable Name All Possible Values (Categorical) Type
DCDC2_1_rs1419228_source.genetics omni, sequenom, sequenom + omni character

DCDC2_1_rs1419228

Variable Name All Possible Values (Categorical) Type
DCDC2_1_rs1419228.genetics A/A, A/G, G/A, G/G character

DCDC2_2_rs793862_source

Variable Name All Possible Values (Categorical) Type
DCDC2_2_rs793862_source.genetics omni, sequenom, sequenom + omni character

DCDC2_2_rs793862

Variable Name All Possible Values (Categorical) Type
DCDC2_2_rs793862.genetics A/A, A/G, G/G character

DCDC2_3_rs1091047_source

Variable Name All Possible Values (Categorical) Type
DCDC2_3_rs1091047_source.genetics sequenom character

DCDC2_3_rs1091047

Variable Name All Possible Values (Categorical) Type
DCDC2_3_rs1091047.genetics C/C, C/G, G/G character

Do et al_1_rs356220_source

Variable Name All Possible Values (Categorical) Type
Do et al_1_rs356220_source.genetics omni, sequenom, sequenom + omni character

Do et al_1_rs356220

Variable Name All Possible Values (Categorical) Type
Do et al_1_rs356220.genetics C/C, C/T, T/C, T/T character

DPF3_rs2192595_source

Variable Name All Possible Values (Categorical) Type
DPF3_rs2192595_source.genetics sequenom character

DPF3_rs2192595

Variable Name All Possible Values (Categorical) Type
DPF3_rs2192595.genetics G/G, G/T, T/T character

DRD2_rs1800497_source

Variable Name All Possible Values (Categorical) Type
DRD2_rs1800497_source.genetics sequenom character

DRD2_rs1800497

Variable Name All Possible Values (Categorical) Type
DRD2_rs1800497.genetics A/A, A/G, G/G character

DRD4_source

Variable Name All Possible Values (Categorical) Type
DRD4_source.genetics sequenom character

DRD4

Variable Name Type
DRD4.genetics character

DYX1_1_rs17819126_source

Variable Name All Possible Values (Categorical) Type
DYX1_1_rs17819126_source.genetics omni, sequenom, sequenom + omni character

DYX1_1_rs17819126

Variable Name All Possible Values (Categorical) Type
DYX1_1_rs17819126.genetics C/C, C/T character

DYX1_2_rs57809907_source

Variable Name All Possible Values (Categorical) Type
DYX1_2_rs57809907_source.genetics omni, sequenom, sequenom + omni character

DYX1_2_rs57809907

Variable Name All Possible Values (Categorical) Type
DYX1_2_rs57809907.genetics A/A, A/C, C/A, C/C character

EIF2AK3_1_rs7571971_source

Variable Name All Possible Values (Categorical) Type
EIF2AK3_1_rs7571971_source.genetics omni, sequenom, sequenom + omni character

EIF2AK3_1_rs7571971

Variable Name All Possible Values (Categorical) Type
EIF2AK3_1_rs7571971.genetics C/C, C/T, T/C, T/T character

ERBB4_rs839523_source

Variable Name All Possible Values (Categorical) Type
ERBB4_rs839523_source.genetics omni, sequenom, sequenom + omni character

ERBB4_rs839523

Variable Name All Possible Values (Categorical) Type
ERBB4_rs839523.genetics C/C, C/T, T/T character

EXT2_1_source

Variable Name All Possible Values (Categorical) Type
EXT2_1_source.genetics sequenom character

EXT2_1

Variable Name All Possible Values (Categorical) Type
EXT2_1.genetics C/C, C/T character

EXT2_2_rs143595300_source

Variable Name All Possible Values (Categorical) Type
EXT2_2_rs143595300_source.genetics sequenom character

EXT2_2_rs143595300

Variable Name All Possible Values (Categorical) Type
EXT2_2_rs143595300.genetics G/G, G/T character

EXT2_source

Variable Name All Possible Values (Categorical) Type
EXT2_source.genetics sequenom character

EXT2

Variable Name All Possible Values (Categorical) Type
EXT2.genetics negative character

FAM47E_1_rs6812193_source

Variable Name All Possible Values (Categorical) Type
FAM47E_1_rs6812193_source.genetics omni, sequenom, sequenom + omni character

FAM47E_1_rs6812193

Variable Name All Possible Values (Categorical) Type
FAM47E_1_rs6812193.genetics C/C, C/T, T/T character

FIG4_1_rs121908287_source

Variable Name All Possible Values (Categorical) Type
FIG4_1_rs121908287_source.genetics sequenom character

FIG4_1_rs121908287

Variable Name All Possible Values (Categorical) Type
FIG4_1_rs121908287.genetics T/T character

FIG4_2_source

Variable Name All Possible Values (Categorical) Type
FIG4_2_source.genetics sequenom character

FIG4_2

Variable Name All Possible Values (Categorical) Type
FIG4_2.genetics G/G character

FOXP2_rs17137124_source

Variable Name All Possible Values (Categorical) Type
FOXP2_rs17137124_source.genetics sequenom character

FOXP2_rs17137124

Variable Name All Possible Values (Categorical) Type
FOXP2_rs17137124.genetics C/C, C/T, T/T character

FUS_source

Variable Name All Possible Values (Categorical) Type
FUS_source.genetics sequenom character

FUS

Variable Name All Possible Values (Categorical) Type
FUS.genetics Negative character

GRIN2A_1_rs4998386_source

Variable Name All Possible Values (Categorical) Type
GRIN2A_1_rs4998386_source.genetics omni, sequenom, sequenom + omni character

GRIN2A_1_rs4998386

Variable Name All Possible Values (Categorical) Type
GRIN2A_1_rs4998386.genetics C/C, C/T, T/T character

GRN_1_rs5848_source

Variable Name All Possible Values (Categorical) Type
GRN_1_rs5848_source.genetics omni, sequenom character

GRN_1_rs5848

Variable Name All Possible Values (Categorical) Type
GRN_1_rs5848.genetics C/C, C/T, G/G, G/T, T/T character

GRN_2_rs72824736_source

Variable Name All Possible Values (Categorical) Type
GRN_2_rs72824736_source.genetics omni, sequenom, sequenom + omni character

GRN_2_rs72824736

Variable Name All Possible Values (Categorical) Type
GRN_2_rs72824736.genetics A/A, A/G, G/A, G/G character

GRN_source

Variable Name All Possible Values (Categorical) Type
GRN_source.genetics sequenom character

GRN

Variable Name All Possible Values (Categorical) Type
GRN.genetics negative, Negative character

GSK3B_rs13312998_source

Variable Name All Possible Values (Categorical) Type
GSK3B_rs13312998_source.genetics sequenom character

GSK3B_rs13312998

Variable Name All Possible Values (Categorical) Type
GSK3B_rs13312998.genetics C/C, C/T, T/T character

HFE_rs1799945_source

Variable Name All Possible Values (Categorical) Type
HFE_rs1799945_source.genetics omni, sequenom, sequenom + omni character

HFE_rs1799945

Variable Name All Possible Values (Categorical) Type
HFE_rs1799945.genetics C/C, C/G, G/G character

HSPA4_1_source

Variable Name All Possible Values (Categorical) Type
HSPA4_1_source.genetics sequenom character

HSPA4_1

Variable Name All Possible Values (Categorical) Type
HSPA4_1.genetics C/C character

HSPA8_1_source

Variable Name All Possible Values (Categorical) Type
HSPA8_1_source.genetics sequenom character

HSPA8_1

Variable Name All Possible Values (Categorical) Type
HSPA8_1.genetics G/G character

IL2RA_source

Variable Name All Possible Values (Categorical) Type
IL2RA_source.genetics sequenom character

IL2RA

Variable Name All Possible Values (Categorical) Type
IL2RA.genetics C/C, C/T, T/T character

IL6_source

Variable Name All Possible Values (Categorical) Type
IL6_source.genetics sequenom character

IL6

Variable Name All Possible Values (Categorical) Type
IL6.genetics C/C, C/G, G/G character

KCNQ_3_source

Variable Name All Possible Values (Categorical) Type
KCNQ_3_source.genetics sequenom character

KCNQ_3

Variable Name All Possible Values (Categorical) Type
KCNQ_3.genetics G/G, G/T, T/T character

KIAA0319_rs4504469_source

Variable Name All Possible Values (Categorical) Type
KIAA0319_rs4504469_source.genetics sequenom character

KIAA0319_rs4504469

Variable Name All Possible Values (Categorical) Type
KIAA0319_rs4504469.genetics C/C, C/T, T/T character

KIAA0319L_rs7523017_source

Variable Name All Possible Values (Categorical) Type
KIAA0319L_rs7523017_source.genetics sequenom character

KIAA0319L_rs7523017

Variable Name All Possible Values (Categorical) Type
KIAA0319L_rs7523017.genetics A/A, A/G, G/G character

KLOTHO_1_rs9536312_source

Variable Name All Possible Values (Categorical) Type
KLOTHO_1_rs9536312_source.genetics sequenom character

KLOTHO_1_rs9536312

Variable Name All Possible Values (Categorical) Type
KLOTHO_1_rs9536312.genetics C/C, C/T, T/T character

KLOTHO_2_rs9536314_source

Variable Name All Possible Values (Categorical) Type
KLOTHO_2_rs9536314_source.genetics omni, sequenom, sequenom + omni character

KLOTHO_2_rs9536314

Variable Name All Possible Values (Categorical) Type
KLOTHO_2_rs9536314.genetics G/G, G/T, T/G, T/T character

KLOTHO_3_rs9527025_source

Variable Name All Possible Values (Categorical) Type
KLOTHO_3_rs9527025_source.genetics omni, sequenom, sequenom + omni character

KLOTHO_3_rs9527025

Variable Name All Possible Values (Categorical) Type
KLOTHO_3_rs9527025.genetics C/C, C/G, G/C, G/G character

KLOTHO_4_rs7997728_source

Variable Name All Possible Values (Categorical) Type
KLOTHO_4_rs7997728_source.genetics sequenom character

KLOTHO_4_rs7997728

Variable Name All Possible Values (Categorical) Type
KLOTHO_4_rs7997728.genetics G/G, G/T, T/T character

KRAS_G13D_source

Variable Name All Possible Values (Categorical) Type
KRAS_G13D_source.genetics sequenom character

KRAS_G13D

Variable Name All Possible Values (Categorical) Type
KRAS_G13D.genetics C/C character

LCMT1_1_source

Variable Name All Possible Values (Categorical) Type
LCMT1_1_source.genetics sequenom character

LCMT1_1

Variable Name All Possible Values (Categorical) Type
LCMT1_1.genetics A/A character

LPR_1_rs4251417_source

Variable Name All Possible Values (Categorical) Type
LPR_1_rs4251417_source.genetics omni, sequenom, sequenom + omni character

LPR_1_rs4251417

Variable Name All Possible Values (Categorical) Type
LPR_1_rs4251417.genetics C/C, C/T, T/T character

LPR_2_rs2020934_source

Variable Name All Possible Values (Categorical) Type
LPR_2_rs2020934_source.genetics sequenom character

LPR_2_rs2020934

Variable Name All Possible Values (Categorical) Type
LPR_2_rs2020934.genetics A/A, A/G, G/G character

LRRK2_1_source

Variable Name All Possible Values (Categorical) Type
LRRK2_1_source.genetics sequenom character

LRRK2_1

Variable Name All Possible Values (Categorical) Type
LRRK2_1.genetics A/A character

LRRK2_15_rs34637584_source

Variable Name All Possible Values (Categorical) Type
LRRK2_15_rs34637584_source.genetics omni, sequenom, sequenom + omni character

LRRK2_15_rs34637584

Variable Name All Possible Values (Categorical) Type
LRRK2_15_rs34637584.genetics A/G, G/G character

LRRK2_2_rs41286476_source

Variable Name All Possible Values (Categorical) Type
LRRK2_2_rs41286476_source.genetics sequenom character

LRRK2_2_rs41286476

Variable Name All Possible Values (Categorical) Type
LRRK2_2_rs41286476.genetics A/A character

LRRK2_3_source

Variable Name All Possible Values (Categorical) Type
LRRK2_3_source.genetics sequenom character

LRRK2_3

Variable Name All Possible Values (Categorical) Type
LRRK2_3.genetics C/C character

MAP1B_1_source

Variable Name All Possible Values (Categorical) Type
MAP1B_1_source.genetics sequenom character

MAP1B_1

Variable Name All Possible Values (Categorical) Type
MAP1B_1.genetics A/A, C/C character

MAP1B_2_source

Variable Name All Possible Values (Categorical) Type
MAP1B_2_source.genetics sequenom character

MAP1B_2

Variable Name All Possible Values (Categorical) Type
MAP1B_2.genetics G/G character

MAP1B_3_source

Variable Name All Possible Values (Categorical) Type
MAP1B_3_source.genetics sequenom character

MAP1B_3

Variable Name All Possible Values (Categorical) Type
MAP1B_3.genetics C/C character

MAPT_2_rs116733906_source

Variable Name All Possible Values (Categorical) Type
MAPT_2_rs116733906_source.genetics omni, sequenom, sequenom + omni character

MAPT_2_rs116733906

Variable Name All Possible Values (Categorical) Type
MAPT_2_rs116733906.genetics G/G character

MAPT_A152T_rs143624519_source

Variable Name All Possible Values (Categorical) Type
MAPT_A152T_rs143624519_source.genetics omni, sequenom, sequenom + omni character

MAPT_A152T_rs143624519

Variable Name All Possible Values (Categorical) Type
MAPT_A152T_rs143624519.genetics A/G, G/G character

MAPT_source

Variable Name All Possible Values (Categorical) Type
MAPT_source.genetics sequenom character

MAPT

Variable Name All Possible Values (Categorical) Type
MAPT.genetics A/A, A/G, G/G character

MAPT3_UTR_1_rs1052590_source

Variable Name All Possible Values (Categorical) Type
MAPT3_UTR_1_rs1052590_source.genetics omni, sequenom, sequenom + omni character

MAPT3_UTR_1_rs1052590

Variable Name All Possible Values (Categorical) Type
MAPT3_UTR_1_rs1052590.genetics A/A, A/G, G/G character

MAPT3_UTR_2_rs8712_source

Variable Name All Possible Values (Categorical) Type
MAPT3_UTR_2_rs8712_source.genetics omni, sequenom, sequenom + omni character

MAPT3_UTR_2_rs8712

Variable Name All Possible Values (Categorical) Type
MAPT3_UTR_2_rs8712.genetics A/A, A/G, G/G character

MAPT3_UTR_3_rs17574040_source

Variable Name All Possible Values (Categorical) Type
MAPT3_UTR_3_rs17574040_source.genetics omni, sequenom, sequenom + omni character

MAPT3_UTR_3_rs17574040

Variable Name All Possible Values (Categorical) Type
MAPT3_UTR_3_rs17574040.genetics A/A, A/C, C/C character

MCCC1_1_rs10513789_source

Variable Name All Possible Values (Categorical) Type
MCCC1_1_rs10513789_source.genetics omni, sequenom, sequenom + omni character

MCCC1_1_rs10513789

Variable Name All Possible Values (Categorical) Type
MCCC1_1_rs10513789.genetics G/G, G/T, T/G, T/T character

MOBP_1_rs1768208_source

Variable Name All Possible Values (Categorical) Type
MOBP_1_rs1768208_source.genetics omni, sequenom, sequenom + omni character

MOBP_1_rs1768208

Variable Name All Possible Values (Categorical) Type
MOBP_1_rs1768208.genetics C/C, C/T, T/C, T/T character

MS4A6A_source

Variable Name All Possible Values (Categorical) Type
MS4A6A_source.genetics sequenom character

MS4A6A

Variable Name All Possible Values (Categorical) Type
MS4A6A.genetics G/G, G/T, T/T character

Naj et al_1_rs4938933_source

Variable Name All Possible Values (Categorical) Type
Naj et al_1_rs4938933_source.genetics omni, sequenom, sequenom + omni character

Naj et al_1_rs4938933

Variable Name All Possible Values (Categorical) Type
Naj et al_1_rs4938933.genetics C/C, C/T, T/T character

Naj et al_2_rs3865444_source

Variable Name All Possible Values (Categorical) Type
Naj et al_2_rs3865444_source.genetics omni, sequenom, sequenom + omni character

Naj et al_2_rs3865444

Variable Name All Possible Values (Categorical) Type
Naj et al_2_rs3865444.genetics A/A, A/C, C/A, C/C character

Naj et al_3_rs7561528_source

Variable Name All Possible Values (Categorical) Type
Naj et al_3_rs7561528_source.genetics omni, sequenom, sequenom + omni character

Naj et al_3_rs7561528

Variable Name All Possible Values (Categorical) Type
Naj et al_3_rs7561528.genetics A/A, A/G, G/A, G/G character

Naj et al_4_rs2588969_source

Variable Name All Possible Values (Categorical) Type
Naj et al_4_rs2588969_source.genetics sequenom character

Naj et al_4_rs2588969

Variable Name All Possible Values (Categorical) Type
Naj et al_4_rs2588969.genetics A/A, A/C, C/C character

NRG_2_rs35753505_source

Variable Name All Possible Values (Categorical) Type
NRG_2_rs35753505_source.genetics omni, sequenom, sequenom + omni character

NRG_2_rs35753505

Variable Name All Possible Values (Categorical) Type
NRG_2_rs35753505.genetics C/C, C/T, T/C, T/T character

OGT_1_source

Variable Name All Possible Values (Categorical) Type
OGT_1_source.genetics sequenom character

OGT_1

Variable Name All Possible Values (Categorical) Type
OGT_1.genetics T/T character

OXTR_rs53576_source

Variable Name All Possible Values (Categorical) Type
OXTR_rs53576_source.genetics omni, sequenom, sequenom + omni character

OXTR_rs53576

Variable Name All Possible Values (Categorical) Type
OXTR_rs53576.genetics A/A, A/G, G/G character

PARK2_source

Variable Name All Possible Values (Categorical) Type
PARK2_source.genetics sequenom character

PARK2

Variable Name All Possible Values (Categorical) Type
PARK2.genetics A/A, A/G, G/G character

PARK7_1_rs71653619_source

Variable Name All Possible Values (Categorical) Type
PARK7_1_rs71653619_source.genetics omni, sequenom, sequenom + omni character

PARK7_1_rs71653619

Variable Name All Possible Values (Categorical) Type
PARK7_1_rs71653619.genetics A/G, G/A, G/G character

PCDH11X_rs5984894_source

Variable Name All Possible Values (Categorical) Type
PCDH11X_rs5984894_source.genetics sequenom character

PCDH11X_rs5984894

Variable Name All Possible Values (Categorical) Type
PCDH11X_rs5984894.genetics A/A, A/G, G/G character

PICALM_rs3851179_source

Variable Name All Possible Values (Categorical) Type
PICALM_rs3851179_source.genetics omni, sequenom, sequenom + omni character

PICALM_rs3851179

Variable Name All Possible Values (Categorical) Type
PICALM_rs3851179.genetics C/C, C/T, T/C, T/T character

PIDN_source

Variable Name All Possible Values (Categorical) Type
PIDN_source.genetics sequenom character

PLCG1_1_source

Variable Name All Possible Values (Categorical) Type
PLCG1_1_source.genetics sequenom character

PLCG1_1

Variable Name All Possible Values (Categorical) Type
PLCG1_1.genetics C/C, C/T character

PLCG1_source

Variable Name All Possible Values (Categorical) Type
PLCG1_source.genetics sequenom character

PLCG1

Variable Name All Possible Values (Categorical) Type
PLCG1.genetics negative character

PPP3CA_1_source

Variable Name All Possible Values (Categorical) Type
PPP3CA_1_source.genetics sequenom character

PPP3CA_1

Variable Name All Possible Values (Categorical) Type
PPP3CA_1.genetics T/T character

PSEN1_1_source

Variable Name All Possible Values (Categorical) Type
PSEN1_1_source.genetics sequenom character

PSEN1_1

Variable Name All Possible Values (Categorical) Type
PSEN1_1.genetics T/T character

PSEN1_source

Variable Name All Possible Values (Categorical) Type
PSEN1_source.genetics sequenom character

PSEN1

Variable Name All Possible Values (Categorical) Type
PSEN1.genetics Negative character

PSEN2_1_rs58973334_source

Variable Name All Possible Values (Categorical) Type
PSEN2_1_rs58973334_source.genetics omni, sequenom, sequenom + omni character

PSEN2_1_rs58973334

Variable Name All Possible Values (Categorical) Type
PSEN2_1_rs58973334.genetics A/G, G/A, G/G character

PSEN2_source

Variable Name All Possible Values (Categorical) Type
PSEN2_source.genetics sequenom character

PSEN2

Variable Name All Possible Values (Categorical) Type
PSEN2.genetics Negative character

RAI1_1_rs11649804_source

Variable Name All Possible Values (Categorical) Type
RAI1_1_rs11649804_source.genetics omni, sequenom, sequenom + omni character

RAI1_1_rs11649804

Variable Name All Possible Values (Categorical) Type
RAI1_1_rs11649804.genetics A/A, A/C, C/A, C/C character

RIT2_1_rs4130047_source

Variable Name All Possible Values (Categorical) Type
RIT2_1_rs4130047_source.genetics omni, sequenom, sequenom + omni character

RIT2_1_rs4130047

Variable Name All Possible Values (Categorical) Type
RIT2_1_rs4130047.genetics C/C, C/T, T/C, T/T character

rs5848_source

Variable Name All Possible Values (Categorical) Type
rs5848_source.genetics sequenom character

rs5848

Variable Name All Possible Values (Categorical) Type
rs5848.genetics C/C, C/T, T/T character

rs9909184_source

Variable Name All Possible Values (Categorical) Type
rs9909184_source.genetics sequenom character

rs9909184

Variable Name All Possible Values (Categorical) Type
rs9909184.genetics A/A, A/T character

SERT_LPR_source

Variable Name All Possible Values (Categorical) Type
SERT_LPR_source.genetics sequenom character

SERT_LPR

Variable Name All Possible Values (Categorical) Type
SERT_LPR.genetics 14/14, 14/16, 16/16 character

SERT_VNTR_source

Variable Name All Possible Values (Categorical) Type
SERT_VNTR_source.genetics sequenom character

SERT_VNTR

Variable Name All Possible Values (Categorical) Type
SERT_VNTR.genetics 10/10, 10/12, 12/12, 12/9 character

SLC41A1_1_rs823156_source

Variable Name All Possible Values (Categorical) Type
SLC41A1_1_rs823156_source.genetics omni, sequenom character

SLC41A1_1_rs823156

Variable Name All Possible Values (Categorical) Type
SLC41A1_1_rs823156.genetics A/A, A/G, G/A, G/G character

SLC6A4_LPR_source

Variable Name All Possible Values (Categorical) Type
SLC6A4_LPR_source.genetics sequenom character

SLC6A4_LPR

Variable Name All Possible Values (Categorical) Type
SLC6A4_LPR.genetics 14/14, 14/16, 16/16 character

SNAP25_rs1051312_source

Variable Name All Possible Values (Categorical) Type
SNAP25_rs1051312_source.genetics omni, sequenom, sequenom + omni character

SNAP25_rs1051312

Variable Name All Possible Values (Categorical) Type
SNAP25_rs1051312.genetics C/C, C/T, T/C, T/T character

SNCA_1_source

Variable Name All Possible Values (Categorical) Type
SNCA_1_source.genetics sequenom character

SNCA_1

Variable Name All Possible Values (Categorical) Type
SNCA_1.genetics C/C character

SNCAIP_1_rs144384727_source

Variable Name All Possible Values (Categorical) Type
SNCAIP_1_rs144384727_source.genetics omni, sequenom, sequenom + omni character

SNCAIP_1_rs144384727

Variable Name All Possible Values (Categorical) Type
SNCAIP_1_rs144384727.genetics A/A character

SNCAIP_2_rs145038921_source

Variable Name All Possible Values (Categorical) Type
SNCAIP_2_rs145038921_source.genetics sequenom character

SNCAIP_2_rs145038921

Variable Name All Possible Values (Categorical) Type
SNCAIP_2_rs145038921.genetics G/G character

SNCAIP_3_rs140850272_source

Variable Name All Possible Values (Categorical) Type
SNCAIP_3_rs140850272_source.genetics omni, sequenom, sequenom + omni character

SNCAIP_3_rs140850272

Variable Name All Possible Values (Categorical) Type
SNCAIP_3_rs140850272.genetics A/G, G/A, G/G character

SOD1_1_source

Variable Name All Possible Values (Categorical) Type
SOD1_1_source.genetics sequenom character

SOD1_1

Variable Name All Possible Values (Categorical) Type
SOD1_1.genetics A/A character

SORL1_1_rs62617129_source

Variable Name All Possible Values (Categorical) Type
SORL1_1_rs62617129_source.genetics omni, sequenom, sequenom + omni character

SORL1_1_rs62617129

Variable Name All Possible Values (Categorical) Type
SORL1_1_rs62617129.genetics A/A, A/G character

SORL1_10_rs2070045_source

Variable Name All Possible Values (Categorical) Type
SORL1_10_rs2070045_source.genetics omni, sequenom, sequenom + omni character

SORL1_10_rs2070045

Variable Name All Possible Values (Categorical) Type
SORL1_10_rs2070045.genetics G/G, G/T, T/G, T/T character

SORL1_11_rs3824968_source

Variable Name All Possible Values (Categorical) Type
SORL1_11_rs3824968_source.genetics omni, sequenom, sequenom + omni character

SORL1_11_rs3824968

Variable Name All Possible Values (Categorical) Type
SORL1_11_rs3824968.genetics A/A, A/T, T/A, T/T character

SORL1_2_source

Variable Name All Possible Values (Categorical) Type
SORL1_2_source.genetics sequenom character

SORL1_2

Variable Name All Possible Values (Categorical) Type
SORL1_2.genetics G/G character

SORL1_3_source

Variable Name All Possible Values (Categorical) Type
SORL1_3_source.genetics sequenom character

SORL1_3

Variable Name All Possible Values (Categorical) Type
SORL1_3.genetics A/G character

SORL1_8_rs661057_source

Variable Name All Possible Values (Categorical) Type
SORL1_8_rs661057_source.genetics sequenom character

SORL1_8_rs661057

Variable Name All Possible Values (Categorical) Type
SORL1_8_rs661057.genetics C/C, C/T, T/T character

SORL1_9_rs12285364_source

Variable Name All Possible Values (Categorical) Type
SORL1_9_rs12285364_source.genetics sequenom character

SORL1_9_rs12285364

Variable Name All Possible Values (Categorical) Type
SORL1_9_rs12285364.genetics C/C, C/T character

SREBP1_1_rs11868035_source

Variable Name All Possible Values (Categorical) Type
SREBP1_1_rs11868035_source.genetics omni, sequenom, sequenom + omni character

SREBP1_1_rs11868035

Variable Name All Possible Values (Categorical) Type
SREBP1_1_rs11868035.genetics A/A, A/G, G/A, G/G character

STX6_1_rs1411478_source

Variable Name All Possible Values (Categorical) Type
STX6_1_rs1411478_source.genetics omni, sequenom, sequenom + omni character

STX6_1_rs1411478

Variable Name All Possible Values (Categorical) Type
STX6_1_rs1411478.genetics A/A, A/G, G/G character

TARDBP_source

Variable Name All Possible Values (Categorical) Type
TARDBP_source.genetics sequenom character

TARDBP

Variable Name All Possible Values (Categorical) Type
TARDBP.genetics G/G character

TAU Haplotype_source

Variable Name All Possible Values (Categorical) Type
TAU Haplotype_source.genetics sequenom character

TAU Haplotype

Variable Name All Possible Values (Categorical) Type
TAU Haplotype.genetics H1/H1, H1/H2, H2/H2 character

TMEM106B_2_rs1020004_source

Variable Name All Possible Values (Categorical) Type
TMEM106B_2_rs1020004_source.genetics sequenom character

TMEM106B_2_rs1020004

Variable Name All Possible Values (Categorical) Type
TMEM106B_2_rs1020004.genetics C/T, T/T character

TMEM106B_rs1990622_source

Variable Name All Possible Values (Categorical) Type
TMEM106B_rs1990622_source.genetics sequenom character

TMEM106B_rs1990622

Variable Name All Possible Values (Categorical) Type
TMEM106B_rs1990622.genetics A/A, A/G, G/G character

TMEM175_1_rs6599389_source

Variable Name All Possible Values (Categorical) Type
TMEM175_1_rs6599389_source.genetics omni, sequenom, sequenom + omni character

TMEM175_1_rs6599389

Variable Name All Possible Values (Categorical) Type
TMEM175_1_rs6599389.genetics A/A, A/G, G/A, G/G character

TOMM40_rs10524523_source

Variable Name All Possible Values (Categorical) Type
TOMM40_rs10524523_source.genetics sequenom character

TOMM40_rs10524523

Variable Name Type
TOMM40_rs10524523.genetics character

TPH1-S_source

Variable Name All Possible Values (Categorical) Type
TPH1-S_source.genetics sequenom character

TPH1-S

Variable Name All Possible Values (Categorical) Type
TPH1-S.genetics G/G, G/T, T/T character

TREM2_rs75932628_source

Variable Name All Possible Values (Categorical) Type
TREM2_rs75932628_source.genetics omni, sequenom, sequenom + omni character

TREM2_rs75932628

Variable Name All Possible Values (Categorical) Type
TREM2_rs75932628.genetics C/C, C/T character

TTRAP_rs2143340_source

Variable Name All Possible Values (Categorical) Type
TTRAP_rs2143340_source.genetics omni, sequenom, sequenom + omni character

TTRAP_rs2143340

Variable Name All Possible Values (Categorical) Type
TTRAP_rs2143340.genetics A/A, A/G, G/G character

USP14_1_rs146959256_source

Variable Name All Possible Values (Categorical) Type
USP14_1_rs146959256_source.genetics omni, sequenom, sequenom + omni character

USP14_1_rs146959256

Variable Name All Possible Values (Categorical) Type
USP14_1_rs146959256.genetics C/C, C/T character

VNTR_1_rs2020942_source

Variable Name All Possible Values (Categorical) Type
VNTR_1_rs2020942_source.genetics sequenom character

VNTR_1_rs2020942

Variable Name All Possible Values (Categorical) Type
VNTR_1_rs2020942.genetics C/C, C/T, T/T character

VNTR_2_rs2066713_source

Variable Name All Possible Values (Categorical) Type
VNTR_2_rs2066713_source.genetics omni, sequenom, sequenom + omni character

VNTR_2_rs2066713

Variable Name All Possible Values (Categorical) Type
VNTR_2_rs2066713.genetics A/A, A/G, G/A, G/G character

Wijsman_1_rs7814569_source

Variable Name All Possible Values (Categorical) Type
Wijsman_1_rs7814569_source.genetics omni, sequenom, sequenom + omni character

Wijsman_1_rs7814569

Variable Name All Possible Values (Categorical) Type
Wijsman_1_rs7814569.genetics A/A, A/G, G/G character

Wijsman_2_rs4145454_source

Variable Name All Possible Values (Categorical) Type
Wijsman_2_rs4145454_source.genetics omni, sequenom, sequenom + omni character

Wijsman_2_rs4145454

Variable Name All Possible Values (Categorical) Type
Wijsman_2_rs4145454.genetics C/C, C/T, T/T character

WWC1_rs17070145_source

Variable Name All Possible Values (Categorical) Type
WWC1_rs17070145_source.genetics omni, sequenom, sequenom + omni character

WWC1_rs17070145

Variable Name All Possible Values (Categorical) Type
WWC1_rs17070145.genetics C/C, C/T, T/T character

grit

Description :

The Short (8-item) Grit Scale (Grit-S; Duckworth & Quinn, 2009) is a self-report measure of trait-level perseverance and passion for long-term goals.

References :

  • Duckworth, A. L., & Quinn, P. D. (2009). Development and validation of the Short Grit Scale (GRIT–S). Journal of personality assessment, 91(2), 166-174.

  • Duckworth, A.L., Peterson, C., Matthews, M.D., & Kelly, D.R. (2007). Grit: Perseverance and passion for long-term goals. Journal of Personality and Social Psychology, 9, 1087-1101. http://www.sas.upenn.edu/~duckwort/images/Grit%20JPSP.pdf


grit_consistence_score

Description :

Consistency of Interest Subscale

References :

  • Duckworth, A. L., & Quinn, P. D. (2009). Development and validation of the Short Grit Scale (GRIT–S). Journal of personality assessment, 91(2), 166-174.
Variable Name Type Min Possible Max Possible
grit_consistence_score.grit numeric 1.00 5.00

grit_persev_eff_score

Description :

Perseverance of Effort Subscale

Variable Name Type Min Possible Max Possible
grit_persev_eff_score.grit numeric 1 5.00

grit_score

Description :

Total Grit Score - the maximum score on this scale is 5 (extremely gritty), and minimum score is 1 (not at all gritty)

Variable Name Type Min Possible Max Possible
grit_score.grit numeric 1 5.000

health_history


abusothr

Variable Name All Possible Values (Categorical) Type
abusothr.health_history 0, 1, 2 numeric

abusx

Variable Name Type
abusx.health_history character

alcfreq

Variable Name All Possible Values (Categorical) Type
alcfreq.health_history 0, 1, 2, 3, 4 numeric

alcoccas

Variable Name All Possible Values (Categorical) Type
alcoccas.health_history 0, 1 numeric

alcohol

Variable Name All Possible Values (Categorical) Type
alcohol.health_history 0, 1, 2 numeric

anxiety

Variable Name All Possible Values (Categorical) Type
anxiety.health_history 0, 1, 2 numeric

apnea

Variable Name All Possible Values (Categorical) Type
apnea.health_history 0, 1, 2 numeric

arthloex

Variable Name All Possible Values (Categorical) Type
arthloex.health_history 0, 1 numeric

arthrit

Variable Name All Possible Values (Categorical) Type
arthrit.health_history 0, 1, 2 numeric

arthspin

Variable Name All Possible Values (Categorical) Type
arthspin.health_history 0, 1 numeric

arthtype

Variable Name All Possible Values (Categorical) Type
arthtype.health_history 1, 2, 3 numeric

arthtypx

Variable Name Type
arthtypx.health_history character

arthunk

Variable Name All Possible Values (Categorical) Type
arthunk.health_history 0, 1 numeric

arthupex

Variable Name All Possible Values (Categorical) Type
arthupex.health_history 0, 1 numeric

b12def

Variable Name All Possible Values (Categorical) Type
b12def.health_history 0, 1, 2 numeric

bipolar

Variable Name All Possible Values (Categorical) Type
bipolar.health_history 0, 1, 2 numeric

cbothr

Variable Name All Possible Values (Categorical) Type
cbothr.health_history 0, 1, 2 numeric

cbothrx

Variable Name Type
cbothrx.health_history character

cbstroke

Variable Name All Possible Values (Categorical) Type
cbstroke.health_history 0, 1, 2 numeric

cbtia

Variable Name All Possible Values (Categorical) Type
cbtia.health_history 0, 1, 2 numeric

cvafib

Variable Name All Possible Values (Categorical) Type
cvafib.health_history 0, 1, 2 numeric

cvangina

Variable Name All Possible Values (Categorical) Type
cvangina.health_history 0, 1, 2 numeric

cvangio

Variable Name All Possible Values (Categorical) Type
cvangio.health_history 0, 1, 2 numeric

cvbypass

Variable Name All Possible Values (Categorical) Type
cvbypass.health_history 0, 1, 2 numeric

cvchf

Variable Name All Possible Values (Categorical) Type
cvchf.health_history 0, 1, 2 numeric

cvhatt

Variable Name All Possible Values (Categorical) Type
cvhatt.health_history 0, 1, 2 numeric

cvhvalve

Variable Name All Possible Values (Categorical) Type
cvhvalve.health_history 0, 1, 2 numeric

cvothr

Variable Name All Possible Values (Categorical) Type
cvothr.health_history 0, 1, 2 numeric

cvothrx

Variable Name Type
cvothrx.health_history character

cvpacdef

Variable Name All Possible Values (Categorical) Type
cvpacdef.health_history 0, 1, 2 numeric

cvpace

Variable Name All Possible Values (Categorical) Type
cvpace.health_history 0, 1, 2 numeric

dep2yrs

Variable Name All Possible Values (Categorical) Type
dep2yrs.health_history 0, 1 numeric

depothr

Variable Name All Possible Values (Categorical) Type
depothr.health_history 0, 1 numeric

diabetes

Variable Name All Possible Values (Categorical) Type
diabetes.health_history 0, 1, 2 numeric

diabtype

Variable Name All Possible Values (Categorical) Type
diabtype.health_history 1, 2, 3 numeric

hattmult

Variable Name All Possible Values (Categorical) Type
hattmult.health_history 0, 1 numeric

hattyear

Variable Name Type Min Possible Max Possible
hattyear.health_history numeric 1988 2018

hypercho

Variable Name All Possible Values (Categorical) Type
hypercho.health_history 0, 1, 2 numeric

hyperten

Variable Name All Possible Values (Categorical) Type
hyperten.health_history 0, 1, 2 numeric

incontf

Variable Name All Possible Values (Categorical) Type
incontf.health_history 0, 1, 2 numeric

incontu

Variable Name All Possible Values (Categorical) Type
incontu.health_history 0, 1, 2 numeric

insomn

Variable Name All Possible Values (Categorical) Type
insomn.health_history 0, 1, 2 numeric

ncothr

Variable Name All Possible Values (Categorical) Type
ncothr.health_history 0, 1, 2 numeric

ncothrx

Variable Name Type
ncothrx.health_history character

npsydev

Variable Name All Possible Values (Categorical) Type
npsydev.health_history 0, 1, 2 numeric

ocd

Variable Name All Possible Values (Categorical) Type
ocd.health_history 0, 1, 2 numeric

othsleep

Variable Name All Possible Values (Categorical) Type
othsleep.health_history 0, 1, 2 numeric

othsleex

Variable Name Type
othsleex.health_history character

packsper

Variable Name Type
packsper.health_history numeric

pd

Variable Name All Possible Values (Categorical) Type
pd.health_history 0, 1 numeric

pdothr

Variable Name All Possible Values (Categorical) Type
pdothr.health_history 0, 1 numeric

pdothryr

Variable Name Type Min Possible Max Possible
pdothryr.health_history numeric 1959 2022

pdyr

Variable Name Type Min Possible Max Possible
pdyr.health_history numeric 2003 2020

psycdis

Variable Name All Possible Values (Categorical) Type
psycdis.health_history 0, 1, 2 numeric

psycdisx

Variable Name Type
psycdisx.health_history character

ptsd

Variable Name All Possible Values (Categorical) Type
ptsd.health_history 0, 1, 2 numeric

quitsmok

Variable Name Type Min Possible Max Possible
quitsmok.health_history numeric 0 1983

rbd

Variable Name All Possible Values (Categorical) Type
rbd.health_history 0, 1, 2 numeric

schiz

Variable Name All Possible Values (Categorical) Type
schiz.health_history 0, 1, 2 numeric

seizures

Variable Name All Possible Values (Categorical) Type
seizures.health_history 0, 1, 2 numeric

smokyrs

Variable Name Type Min Possible Max Possible
smokyrs.health_history numeric 0 80

strok1yr

Variable Name Type
strok1yr.health_history numeric

strok2yr

Variable Name All Possible Values (Categorical) Type
strok2yr.health_history 2007 numeric

strokmul

Variable Name All Possible Values (Categorical) Type
strokmul.health_history 0, 1 numeric

strokyr

Variable Name Type
strokyr.health_history numeric

tbi

Variable Name All Possible Values (Categorical) Type
tbi.health_history 0, 1, 2 numeric

tbibrief

Variable Name All Possible Values (Categorical) Type
tbibrief.health_history 0, 1, 2 numeric

tbiexten

Variable Name All Possible Values (Categorical) Type
tbiexten.health_history 0, 1, 2 numeric

tbiwolos

Variable Name All Possible Values (Categorical) Type
tbiwolos.health_history 0, 1, 2 numeric

tbiyear

Variable Name Type Min Possible Max Possible
tbiyear.health_history numeric 1938 2022

thyroid

Variable Name All Possible Values (Categorical) Type
thyroid.health_history 0, 1, 2 numeric

tia1yr

Variable Name Type Min Possible Max Possible
tia1yr.health_history numeric 1990 2014

tia2yr

Variable Name All Possible Values (Categorical) Type
tia2yr.health_history 2003, 2004, 2013 numeric

tia3yr

Variable Name All Possible Values (Categorical) Type
tia3yr.health_history 0, 2004, 2011 numeric

tia4yr

Variable Name All Possible Values (Categorical) Type
tia4yr.health_history 0 numeric

tia5yr

Variable Name All Possible Values (Categorical) Type
tia5yr.health_history 0 numeric

tia6yr

Variable Name All Possible Values (Categorical) Type
tia6yr.health_history 0 numeric

tiamult

Variable Name All Possible Values (Categorical) Type
tiamult.health_history 0, 1 numeric

tiayear

Variable Name Type Min Possible Max Possible
tiayear.health_history numeric 1983 2020

tobac100

Variable Name All Possible Values (Categorical) Type
tobac100.health_history 0, 1 numeric

tobac30

Variable Name All Possible Values (Categorical) Type
tobac30.health_history 0, 1 numeric

traumbrf

Variable Name All Possible Values (Categorical) Type
traumbrf.health_history 0, 1, 2 numeric

traumchr

Variable Name All Possible Values (Categorical) Type
traumchr.health_history 0, 1, 2 numeric

traumext

Variable Name All Possible Values (Categorical) Type
traumext.health_history 0, 1, 2 numeric

imaging_dti_prisma_fa

Description :

Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Fractional anisotropy (FA) specifically assesses the directionality of the water diffusion. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Prisma scanner uses a multi-shell scheme where multiple b-values are used.

References :

  • Basser, P. J., Mattiello, J., & LeBihan, D. (1994). Mr diffusion tensor spectroscopy and imaging. Biophysical Journal, 66(1), 259–267. https://doi.org/10.1016/s0006-3495(94)80775-1

anterior_corona_radiata_l

Description :

left anterior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_corona_radiata_l.imaging_dti_prisma_fa numeric 0 1

anterior_corona_radiata_r

Description :

right anterior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_corona_radiata_r.imaging_dti_prisma_fa numeric 0 1

anterior_limb_of_internal_capsule_r

Description :

right anterior limb of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_limb_of_internal_capsule_r.imaging_dti_prisma_fa numeric 0 1

body_of_corpus_callosum

Description :

body of corpus callosum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
body_of_corpus_callosum.imaging_dti_prisma_fa numeric 0 1

cerebral_peduncle_l

Description :

left cerebral peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cerebral_peduncle_l.imaging_dti_prisma_fa numeric 0 1

cerebral_peduncle_r

Description :

right cerebral peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cerebral_peduncle_r.imaging_dti_prisma_fa numeric 0 1

cingulum_cingulate_gyrus_l

Description :

left cingulum cingulate gyrus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_cingulate_gyrus_l.imaging_dti_prisma_fa numeric 0 1

cingulum_cingulate_gyrus_r

Description :

right cingulum cingulate gyrus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_cingulate_gyrus_r.imaging_dti_prisma_fa numeric 0 1

corticospinal_tract_l

Description :

left corticospinal tract FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
corticospinal_tract_l.imaging_dti_prisma_fa numeric 0 1

corticospinal_tract_r

Description :

right corticospinal tract FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
corticospinal_tract_r.imaging_dti_prisma_fa numeric 0 1

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_dti_prisma_fa numeric 0 infinity

external_capsule_l

Description :

left external capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
external_capsule_l.imaging_dti_prisma_fa numeric 0 1

external_capsule_r

Description :

right external capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
external_capsule_r.imaging_dti_prisma_fa numeric 0 1

fornix_l

Description :

left fornix FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
fornix_l.imaging_dti_prisma_fa numeric 0 1

fornix_r

Description :

right fornix FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
fornix_r.imaging_dti_prisma_fa numeric 0 1

genu_of_corpus_callosum

Description :

genu of corpus callosum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
genu_of_corpus_callosum.imaging_dti_prisma_fa numeric 0 1

inferior_cerebellar_peduncle_l

Description :

left inferior cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
inferior_cerebellar_peduncle_l.imaging_dti_prisma_fa numeric 0 1

inferior_cerebellar_peduncle_r

Description :

right inferior cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
inferior_cerebellar_peduncle_r.imaging_dti_prisma_fa numeric 0 1

label

Description :

Calculation of FA in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_dti_prisma_fa Mean character

medial_lemniscus_l

Description :

left medial lemniscus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
medial_lemniscus_l.imaging_dti_prisma_fa numeric 0 1

medial_lemniscus_r

Description :

right medial lemniscus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
medial_lemniscus_r.imaging_dti_prisma_fa numeric 0 1

middle_cerebellar_peduncle

Description :

middle cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
middle_cerebellar_peduncle.imaging_dti_prisma_fa numeric 0 1

pontine_crossing_tract_a_part_of_mcp

Description :

pontine crossing tract a part of mcp FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
pontine_crossing_tract_a_part_of_mcp.imaging_dti_prisma_fa numeric 0 1

posterior_corona_radiata_l

Description :

left posterior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_corona_radiata_l.imaging_dti_prisma_fa numeric 0 1

posterior_corona_radiata_r

Description :

right posterior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_corona_radiata_r.imaging_dti_prisma_fa numeric 0 1

posterior_limb_of_internal_capsule_l

Description :

left posterior limb of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_limb_of_internal_capsule_l.imaging_dti_prisma_fa numeric 0 1

posterior_limb_of_internal_capsule_r

Description :

right posterior limb of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_limb_of_internal_capsule_r.imaging_dti_prisma_fa numeric 0 1

posterior_thalamic_radiation_l

Description :

left posterior thalamic radiation FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_thalamic_radiation_l.imaging_dti_prisma_fa numeric 0 1

posterior_thalamic_radiation_r

Description :

right posterior thalamic radiation FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_thalamic_radiation_r.imaging_dti_prisma_fa numeric 0 1

retrolenticular_part_of_internal_capsule_l

Description :

left retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
retrolenticular_part_of_internal_capsule_l.imaging_dti_prisma_fa numeric 0 1

retrolenticular_part_of_internal_capsule_r

Description :

right retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
retrolenticular_part_of_internal_capsule_r.imaging_dti_prisma_fa numeric 0 1

sagittal_stratum_l

Description :

left sagittal stratum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
sagittal_stratum_l.imaging_dti_prisma_fa numeric 0 1

sagittal_stratum_r

Description :

right sagittal stratum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
sagittal_stratum_r.imaging_dti_prisma_fa numeric 0 1

splenium_of_corpus_callosum

Description :

splenium of corpus callosum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
splenium_of_corpus_callosum.imaging_dti_prisma_fa numeric 0 1

superior_cerebellar_peduncle_l

Description :

left superior cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_cerebellar_peduncle_l.imaging_dti_prisma_fa numeric 0 1

superior_cerebellar_peduncle_r

Description :

right superior cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_cerebellar_peduncle_r.imaging_dti_prisma_fa numeric 0 1

superior_corona_radiata_l

Description :

left superior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_corona_radiata_l.imaging_dti_prisma_fa numeric 0 1

superior_corona_radiata_r

Description :

right superior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_corona_radiata_r.imaging_dti_prisma_fa numeric 0 1

superior_fronto_occipital_fasciculus_r

Description :

right superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_fronto_occipital_fasciculus_r.imaging_dti_prisma_fa numeric 0 1

superior_longitudinal_fasciculus_l

Description :

left superior longitudinal fasciculus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_longitudinal_fasciculus_l.imaging_dti_prisma_fa numeric 0 1

superior_longitudinal_fasciculus_r

Description :

right superior longitudinal fasciculus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_longitudinal_fasciculus_r.imaging_dti_prisma_fa numeric 0 1

tapetum_l

Description :

left tapetum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
tapetum_l.imaging_dti_prisma_fa numeric 0 1

imaging_dti_prisma_md

Description :

Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Mean Diffusivity (MD) specifically assesses the number, size, or mylination of the tissue fibers in units of 10^-3 mm^2/s. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Prisma scanner uses a multi-shell scheme where multiple b-values are used.

References :

  • Basser, P. J., Mattiello, J., & LeBihan, D. (1994). Mr diffusion tensor spectroscopy and imaging. Biophysical Journal, 66(1), 259–267. https://doi.org/10.1016/s0006-3495(94)80775-1

anterior_corona_radiata_l

Description :

left anterior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_corona_radiata_l.imaging_dti_prisma_md numeric 0 3

anterior_corona_radiata_r

Description :

right anterior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_corona_radiata_r.imaging_dti_prisma_md numeric 0 3

anterior_limb_of_internal_capsule_r

Description :

right anterior limb of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_limb_of_internal_capsule_r.imaging_dti_prisma_md numeric 0 3

body_of_corpus_callosum

Description :

body of corpus callosum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
body_of_corpus_callosum.imaging_dti_prisma_md numeric 0 3

cerebral_peduncle_l

Description :

left cerebral peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cerebral_peduncle_l.imaging_dti_prisma_md numeric 0 3

cerebral_peduncle_r

Description :

right cerebral peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cerebral_peduncle_r.imaging_dti_prisma_md numeric 0 3

cingulum_cingulate_gyrus_l

Description :

left cingulum cingulate gyrus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_cingulate_gyrus_l.imaging_dti_prisma_md numeric 0 3

cingulum_cingulate_gyrus_r

Description :

right cingulum cingulate gyrus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_cingulate_gyrus_r.imaging_dti_prisma_md numeric 0 3

corticospinal_tract_l

Description :

left corticospinal tract MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
corticospinal_tract_l.imaging_dti_prisma_md numeric 0 3

corticospinal_tract_r

Description :

right corticospinal tract MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
corticospinal_tract_r.imaging_dti_prisma_md numeric 0 3

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_dti_prisma_md numeric 0 infinity

external_capsule_l

Description :

left external capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
external_capsule_l.imaging_dti_prisma_md numeric 0 3

external_capsule_r

Description :

right external capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
external_capsule_r.imaging_dti_prisma_md numeric 0 3

fornix_l

Description :

left fornix MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
fornix_l.imaging_dti_prisma_md numeric 0 3

fornix_r

Description :

right fornix MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
fornix_r.imaging_dti_prisma_md numeric 0 3

genu_of_corpus_callosum

Description :

genu of corpus callosum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
genu_of_corpus_callosum.imaging_dti_prisma_md numeric 0 3

inferior_cerebellar_peduncle_l

Description :

left inferior cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
inferior_cerebellar_peduncle_l.imaging_dti_prisma_md numeric 0 3

inferior_cerebellar_peduncle_r

Description :

right inferior cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
inferior_cerebellar_peduncle_r.imaging_dti_prisma_md numeric 0 3

label

Description :

Calculation of MD in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_dti_prisma_md Mean character

medial_lemniscus_l

Description :

left medial lemniscus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
medial_lemniscus_l.imaging_dti_prisma_md numeric 0 3

medial_lemniscus_r

Description :

right medial lemniscus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
medial_lemniscus_r.imaging_dti_prisma_md numeric 0 3

middle_cerebellar_peduncle

Description :

middle cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
middle_cerebellar_peduncle.imaging_dti_prisma_md numeric 0 3

pontine_crossing_tract_a_part_of_mcp

Description :

pontine crossing tract a part of mcp MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
pontine_crossing_tract_a_part_of_mcp.imaging_dti_prisma_md numeric 0 3

posterior_corona_radiata_l

Description :

left posterior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_corona_radiata_l.imaging_dti_prisma_md numeric 0 3

posterior_corona_radiata_r

Description :

right posterior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_corona_radiata_r.imaging_dti_prisma_md numeric 0 3

posterior_limb_of_internal_capsule_l

Description :

left posterior limb of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_limb_of_internal_capsule_l.imaging_dti_prisma_md numeric 0 3

posterior_limb_of_internal_capsule_r

Description :

right posterior limb of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_limb_of_internal_capsule_r.imaging_dti_prisma_md numeric 0 3

posterior_thalamic_radiation_l

Description :

left posterior thalamic radiation MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_thalamic_radiation_l.imaging_dti_prisma_md numeric 0 3

posterior_thalamic_radiation_r

Description :

right posterior thalamic radiation MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_thalamic_radiation_r.imaging_dti_prisma_md numeric 0 3

retrolenticular_part_of_internal_capsule_l

Description :

left retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
retrolenticular_part_of_internal_capsule_l.imaging_dti_prisma_md numeric 0 3

retrolenticular_part_of_internal_capsule_r

Description :

right retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
retrolenticular_part_of_internal_capsule_r.imaging_dti_prisma_md numeric 0 3

sagittal_stratum_l

Description :

left sagittal stratum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
sagittal_stratum_l.imaging_dti_prisma_md numeric 0 3

sagittal_stratum_r

Description :

right sagittal stratum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
sagittal_stratum_r.imaging_dti_prisma_md numeric 0 3

splenium_of_corpus_callosum

Description :

splenium of corpus callosum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
splenium_of_corpus_callosum.imaging_dti_prisma_md numeric 0 3

superior_cerebellar_peduncle_l

Description :

left superior cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_cerebellar_peduncle_l.imaging_dti_prisma_md numeric 0 3

superior_cerebellar_peduncle_r

Description :

right superior cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_cerebellar_peduncle_r.imaging_dti_prisma_md numeric 0 3

superior_corona_radiata_l

Description :

left superior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_corona_radiata_l.imaging_dti_prisma_md numeric 0 3

superior_corona_radiata_r

Description :

right superior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_corona_radiata_r.imaging_dti_prisma_md numeric 0 3

superior_fronto_occipital_fasciculus_r

Description :

right superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_fronto_occipital_fasciculus_r.imaging_dti_prisma_md numeric 0 3

superior_longitudinal_fasciculus_l

Description :

left superior longitudinal fasciculus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_longitudinal_fasciculus_l.imaging_dti_prisma_md numeric 0 3

superior_longitudinal_fasciculus_r

Description :

right superior longitudinal fasciculus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_longitudinal_fasciculus_r.imaging_dti_prisma_md numeric 0 3

tapetum_l

Description :

left tapetum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
tapetum_l.imaging_dti_prisma_md numeric 0 3

imaging_dti_trio_fa

Description :

Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Fractional anisotropy (FA) specifically assesses the directionality of the water diffusion. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Trio scanner uses a single-shell scheme where one b-value is used.

References :

  • Basser, P. J., Mattiello, J., & LeBihan, D. (1994). Mr diffusion tensor spectroscopy and imaging. Biophysical Journal, 66(1), 259–267. https://doi.org/10.1016/s0006-3495(94)80775-1

anterior_corona_radiata_l

Description :

left anterior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_corona_radiata_l.imaging_dti_trio_fa numeric 0 1

anterior_corona_radiata_r

Description :

right anterior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_corona_radiata_r.imaging_dti_trio_fa numeric 0 1

anterior_limb_of_internal_capsule_l

Description :

left anterior limb of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_limb_of_internal_capsule_l.imaging_dti_trio_fa numeric 0 1

anterior_limb_of_internal_capsule_r

Description :

right anterior limb of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_limb_of_internal_capsule_r.imaging_dti_trio_fa numeric 0 1

body_of_corpus_callosum

Description :

body of corpus callosum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
body_of_corpus_callosum.imaging_dti_trio_fa numeric 0 1

cerebral_peduncle_l

Description :

left cerebral peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cerebral_peduncle_l.imaging_dti_trio_fa numeric 0 1

cerebral_peduncle_r

Description :

right cerebral peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cerebral_peduncle_r.imaging_dti_trio_fa numeric 0 1

cingulum_cingulate_gyrus_l

Description :

left cingulum cingulate gyrus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_cingulate_gyrus_l.imaging_dti_trio_fa numeric 0 1

cingulum_cingulate_gyrus_r

Description :

right cingulum cingulate gyrus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_cingulate_gyrus_r.imaging_dti_trio_fa numeric 0 1

cingulum_hippocampus_l

Description :

left cingulum hippocampus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_hippocampus_l.imaging_dti_trio_fa numeric 0 1

cingulum_hippocampus_r

Description :

right cingulum hippocampus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_hippocampus_r.imaging_dti_trio_fa numeric 0 1

corticospinal_tract_l

Description :

left corticospinal tract FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
corticospinal_tract_l.imaging_dti_trio_fa numeric 0 1

corticospinal_tract_r

Description :

right corticospinal tract FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
corticospinal_tract_r.imaging_dti_trio_fa numeric 0 1

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_dti_trio_fa numeric 0 infinity

external_capsule_l

Description :

left external capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
external_capsule_l.imaging_dti_trio_fa numeric 0 1

external_capsule_r

Description :

right external capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
external_capsule_r.imaging_dti_trio_fa numeric 0 1

fornix_l

Description :

left fornix FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
fornix_l.imaging_dti_trio_fa numeric 0 1

fornix_r

Description :

right fornix FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
fornix_r.imaging_dti_trio_fa numeric 0 1

genu_of_corpus_callosum

Description :

genu of corpus callosum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
genu_of_corpus_callosum.imaging_dti_trio_fa numeric 0 1

inferior_cerebellar_peduncle_l

Description :

left inferior cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
inferior_cerebellar_peduncle_l.imaging_dti_trio_fa numeric 0 1

inferior_cerebellar_peduncle_r

Description :

right inferior cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
inferior_cerebellar_peduncle_r.imaging_dti_trio_fa numeric 0 1

label

Description :

Calculation of FA in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_dti_trio_fa Mean character

medial_lemniscus_l

Description :

left medial lemniscus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
medial_lemniscus_l.imaging_dti_trio_fa numeric 0 1

medial_lemniscus_r

Description :

right medial lemniscus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
medial_lemniscus_r.imaging_dti_trio_fa numeric 0 1

middle_cerebellar_peduncle

Description :

middle cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
middle_cerebellar_peduncle.imaging_dti_trio_fa numeric 0 1

pontine_crossing_tract_a_part_of_mcp

Description :

pontine crossing tract a part of mcp FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
pontine_crossing_tract_a_part_of_mcp.imaging_dti_trio_fa numeric 0 1

posterior_corona_radiata_l

Description :

left posterior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_corona_radiata_l.imaging_dti_trio_fa numeric 0 1

posterior_corona_radiata_r

Description :

right posterior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_corona_radiata_r.imaging_dti_trio_fa numeric 0 1

posterior_limb_of_internal_capsule_l

Description :

left posterior limb of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_limb_of_internal_capsule_l.imaging_dti_trio_fa numeric 0 1

posterior_limb_of_internal_capsule_r

Description :

right posterior limb of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_limb_of_internal_capsule_r.imaging_dti_trio_fa numeric 0 1

posterior_thalamic_radiation_l

Description :

left posterior thalamic radiation FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_thalamic_radiation_l.imaging_dti_trio_fa numeric 0 1

posterior_thalamic_radiation_r

Description :

right posterior thalamic radiation FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_thalamic_radiation_r.imaging_dti_trio_fa numeric 0 1

retrolenticular_part_of_internal_capsule_l

Description :

left retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
retrolenticular_part_of_internal_capsule_l.imaging_dti_trio_fa numeric 0 1

retrolenticular_part_of_internal_capsule_r

Description :

right retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
retrolenticular_part_of_internal_capsule_r.imaging_dti_trio_fa numeric 0 1

sagittal_stratum_l

Description :

left sagittal stratum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
sagittal_stratum_l.imaging_dti_trio_fa numeric 0 1

sagittal_stratum_r

Description :

right sagittal stratum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
sagittal_stratum_r.imaging_dti_trio_fa numeric 0 1

splenium_of_corpus_callosum

Description :

splenium of corpus callosum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
splenium_of_corpus_callosum.imaging_dti_trio_fa numeric 0 1

superior_cerebellar_peduncle_l

Description :

left superior cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_cerebellar_peduncle_l.imaging_dti_trio_fa numeric 0 1

superior_cerebellar_peduncle_r

Description :

right superior cerebellar peduncle FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_cerebellar_peduncle_r.imaging_dti_trio_fa numeric 0 1

superior_corona_radiata_l

Description :

left superior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_corona_radiata_l.imaging_dti_trio_fa numeric 0 1

superior_corona_radiata_r

Description :

right superior corona radiata FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_corona_radiata_r.imaging_dti_trio_fa numeric 0 1

superior_fronto_occipital_fasciculus_l

Description :

left superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_fronto_occipital_fasciculus_l.imaging_dti_trio_fa numeric 0 1

superior_fronto_occipital_fasciculus_r

Description :

right superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_fronto_occipital_fasciculus_r.imaging_dti_trio_fa numeric 0 1

superior_longitudinal_fasciculus_l

Description :

left superior longitudinal fasciculus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_longitudinal_fasciculus_l.imaging_dti_trio_fa numeric 0 1

superior_longitudinal_fasciculus_r

Description :

right superior longitudinal fasciculus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_longitudinal_fasciculus_r.imaging_dti_trio_fa numeric 0 1

tapetum_l

Description :

left tapetum FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
tapetum_l.imaging_dti_trio_fa numeric 0 1

uncinate_fasciculus_r

Description :

right uncinate fasciculus FA value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
uncinate_fasciculus_r.imaging_dti_trio_fa numeric 0 1

imaging_dti_trio_md

Description :

Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Mean Diffusivity (MD) specifically assesses the number, size, or mylination of the tissue fibers in units of 10^-3 mm^2/s. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Trio scanner uses a single-shell scheme where one b-value is used.

References :

  • Basser, P. J., Mattiello, J., & LeBihan, D. (1994). Mr diffusion tensor spectroscopy and imaging. Biophysical Journal, 66(1), 259–267. https://doi.org/10.1016/s0006-3495(94)80775-1

anterior_corona_radiata_l

Description :

left anterior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_corona_radiata_l.imaging_dti_trio_md numeric 0 3

anterior_corona_radiata_r

Description :

right anterior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_corona_radiata_r.imaging_dti_trio_md numeric 0 3

anterior_limb_of_internal_capsule_l

Description :

left anterior limb of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_limb_of_internal_capsule_l.imaging_dti_trio_md numeric 0 3

anterior_limb_of_internal_capsule_r

Description :

right anterior limb of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
anterior_limb_of_internal_capsule_r.imaging_dti_trio_md numeric 0 3

body_of_corpus_callosum

Description :

body of corpus callosum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
body_of_corpus_callosum.imaging_dti_trio_md numeric 0 3

cerebral_peduncle_l

Description :

left cerebral peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cerebral_peduncle_l.imaging_dti_trio_md numeric 0 3

cerebral_peduncle_r

Description :

right cerebral peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cerebral_peduncle_r.imaging_dti_trio_md numeric 0 3

cingulum_cingulate_gyrus_l

Description :

left cingulum cingulate gyrus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_cingulate_gyrus_l.imaging_dti_trio_md numeric 0 3

cingulum_cingulate_gyrus_r

Description :

right cingulum cingulate gyrus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_cingulate_gyrus_r.imaging_dti_trio_md numeric 0 3

cingulum_hippocampus_l

Description :

left cingulum hippocampus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_hippocampus_l.imaging_dti_trio_md numeric 0 3

cingulum_hippocampus_r

Description :

right cingulum hippocampus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
cingulum_hippocampus_r.imaging_dti_trio_md numeric 0 3

corticospinal_tract_l

Description :

left corticospinal tract MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
corticospinal_tract_l.imaging_dti_trio_md numeric 0 3

corticospinal_tract_r

Description :

right corticospinal tract MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
corticospinal_tract_r.imaging_dti_trio_md numeric 0 3

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_dti_trio_md numeric 0 infinity

external_capsule_l

Description :

left external capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
external_capsule_l.imaging_dti_trio_md numeric 0 3

external_capsule_r

Description :

right external capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
external_capsule_r.imaging_dti_trio_md numeric 0 3

fornix_l

Description :

left fornix MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
fornix_l.imaging_dti_trio_md numeric 0 3

fornix_r

Description :

right fornix MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
fornix_r.imaging_dti_trio_md numeric 0 3

genu_of_corpus_callosum

Description :

genu of corpus callosum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
genu_of_corpus_callosum.imaging_dti_trio_md numeric 0 3

inferior_cerebellar_peduncle_l

Description :

left inferior cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
inferior_cerebellar_peduncle_l.imaging_dti_trio_md numeric 0 3

inferior_cerebellar_peduncle_r

Description :

right inferior cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
inferior_cerebellar_peduncle_r.imaging_dti_trio_md numeric 0 3

label

Description :

Calculation of MD in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_dti_trio_md Mean character

medial_lemniscus_l

Description :

left medial lemniscus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
medial_lemniscus_l.imaging_dti_trio_md numeric 0 3

medial_lemniscus_r

Description :

right medial lemniscus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
medial_lemniscus_r.imaging_dti_trio_md numeric 0 3

middle_cerebellar_peduncle

Description :

middle cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
middle_cerebellar_peduncle.imaging_dti_trio_md numeric 0 3

pontine_crossing_tract_a_part_of_mcp

Description :

pontine crossing tract a part of mcp MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
pontine_crossing_tract_a_part_of_mcp.imaging_dti_trio_md numeric 0 3

posterior_corona_radiata_l

Description :

left posterior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_corona_radiata_l.imaging_dti_trio_md numeric 0 3

posterior_corona_radiata_r

Description :

right posterior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_corona_radiata_r.imaging_dti_trio_md numeric 0 3

posterior_limb_of_internal_capsule_l

Description :

left posterior limb of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_limb_of_internal_capsule_l.imaging_dti_trio_md numeric 0 3

posterior_limb_of_internal_capsule_r

Description :

right posterior limb of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_limb_of_internal_capsule_r.imaging_dti_trio_md numeric 0 3

posterior_thalamic_radiation_l

Description :

left posterior thalamic radiation MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_thalamic_radiation_l.imaging_dti_trio_md numeric 0 3

posterior_thalamic_radiation_r

Description :

right posterior thalamic radiation MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
posterior_thalamic_radiation_r.imaging_dti_trio_md numeric 0 3

retrolenticular_part_of_internal_capsule_l

Description :

left retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
retrolenticular_part_of_internal_capsule_l.imaging_dti_trio_md numeric 0 3

retrolenticular_part_of_internal_capsule_r

Description :

right retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
retrolenticular_part_of_internal_capsule_r.imaging_dti_trio_md numeric 0 3

sagittal_stratum_l

Description :

left sagittal stratum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
sagittal_stratum_l.imaging_dti_trio_md numeric 0 3

sagittal_stratum_r

Description :

right sagittal stratum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
sagittal_stratum_r.imaging_dti_trio_md numeric 0 3

splenium_of_corpus_callosum

Description :

splenium of corpus callosum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
splenium_of_corpus_callosum.imaging_dti_trio_md numeric 0 3

superior_cerebellar_peduncle_l

Description :

left superior cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_cerebellar_peduncle_l.imaging_dti_trio_md numeric 0 3

superior_cerebellar_peduncle_r

Description :

right superior cerebellar peduncle MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_cerebellar_peduncle_r.imaging_dti_trio_md numeric 0 3

superior_corona_radiata_l

Description :

left superior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_corona_radiata_l.imaging_dti_trio_md numeric 0 3

superior_corona_radiata_r

Description :

right superior corona radiata MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_corona_radiata_r.imaging_dti_trio_md numeric 0 3

superior_fronto_occipital_fasciculus_l

Description :

left superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_fronto_occipital_fasciculus_l.imaging_dti_trio_md numeric 0 3

superior_fronto_occipital_fasciculus_r

Description :

right superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_fronto_occipital_fasciculus_r.imaging_dti_trio_md numeric 0 3

superior_longitudinal_fasciculus_l

Description :

left superior longitudinal fasciculus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_longitudinal_fasciculus_l.imaging_dti_trio_md numeric 0 3

superior_longitudinal_fasciculus_r

Description :

right superior longitudinal fasciculus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
superior_longitudinal_fasciculus_r.imaging_dti_trio_md numeric 0 3

tapetum_l

Description :

left tapetum MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
tapetum_l.imaging_dti_trio_md numeric 0 3

uncinate_fasciculus_r

Description :

right uncinate fasciculus MD value (JHU ICBM WM atlas)

Variable Name Type Min Possible Max Possible
uncinate_fasciculus_r.imaging_dti_trio_md numeric 0 3

imaging_noddi_ficv

Description :

Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: neurite density index (NDI) specifically quantifies the packing density of axons or dendrites and is typically known to decrease from middle to old age.

References :

  • Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908

  • Cox, S. R., Ritchie, S. J., Tucker-Drob, E. M., Liewald, D. C., Hagenaars, S. P., Davies, G., Wardlaw, J. M., Gale, C. R., Bastin, M. E., & Deary, I. J. (2016). Ageing and brain white matter structure in 3,513 UK Biobank participants. Nature Communications, 7(1). https://doi.org/10.1038/ncomms13629

dont_worry_abt_col_names:

  • Kraguljac, N. V., Guerreri, M., Strickland, M. J., & Zhang, H. (2023). Neurite orientation dispersion and density imaging in psychiatric disorders: A systematic literature review and a technical note. Biological Psychiatry Global Open Science, 3(1), 10–21. https://doi.org/10.1016/j.bpsgos.2021.12.012

ad_meta_six_composite

Description :

ad meta six composite

Variable Name Type Min Possible Max Possible
ad_meta_six_composite.imaging_noddi_ficv numeric 0 1

ad_meta_ten_composite

Description :

ad meta ten composite

Variable Name Type Min Possible Max Possible
ad_meta_ten_composite.imaging_noddi_ficv numeric 0 1

brain_stem

Description :

brain stem NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
brain_stem.imaging_noddi_ficv numeric 0 1

cc_anterior

Description :

anterior corpus callosum NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_anterior.imaging_noddi_ficv numeric 0 1

cc_central

Description :

central corpus callosum NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_central.imaging_noddi_ficv numeric 0 1

cc_mid_anterior

Description :

mid anterior corpus callosum NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_mid_anterior.imaging_noddi_ficv numeric 0 1

cc_mid_posterior

Description :

mid posterior corpus callosum NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_mid_posterior.imaging_noddi_ficv numeric 0 1

cc_posterior

Description :

posterior corpus callosum NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_posterior.imaging_noddi_ficv numeric 0 1

csf

Description :

csf NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
csf.imaging_noddi_ficv numeric 0 1

ctx_lh_bankssts

Description :

left bankssts NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_bankssts.imaging_noddi_ficv numeric 0 1

ctx_lh_caudalanteriorcingulate

Description :

left caudalanteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalanteriorcingulate.imaging_noddi_ficv numeric 0 1

ctx_lh_caudalmiddlefrontal

Description :

left caudalmiddlefrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalmiddlefrontal.imaging_noddi_ficv numeric 0 1

ctx_lh_cuneus

Description :

left cuneus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_cuneus.imaging_noddi_ficv numeric 0 1

ctx_lh_entorhinal

Description :

left entorhinal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_entorhinal.imaging_noddi_ficv numeric 0 1

ctx_lh_frontalpole

Description :

left frontalpole NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_frontalpole.imaging_noddi_ficv numeric 0 1

ctx_lh_fusiform

Description :

left fusiform NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_fusiform.imaging_noddi_ficv numeric 0 1

ctx_lh_inferiorparietal

Description :

left inferiorparietal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiorparietal.imaging_noddi_ficv numeric 0 1

ctx_lh_inferiortemporal

Description :

left inferiortemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiortemporal.imaging_noddi_ficv numeric 0 1

ctx_lh_insula

Description :

left insula NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_insula.imaging_noddi_ficv numeric 0 1

ctx_lh_isthmuscingulate

Description :

left isthmuscingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_isthmuscingulate.imaging_noddi_ficv numeric 0 1

ctx_lh_lateraloccipital

Description :

left lateraloccipital NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateraloccipital.imaging_noddi_ficv numeric 0 1

ctx_lh_lateralorbitofrontal

Description :

left lateralorbitofrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateralorbitofrontal.imaging_noddi_ficv numeric 0 1

ctx_lh_lingual

Description :

left lingual NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lingual.imaging_noddi_ficv numeric 0 1

ctx_lh_medialorbitofrontal

Description :

left medialorbitofrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_medialorbitofrontal.imaging_noddi_ficv numeric 0 1

ctx_lh_middletemporal

Description :

left middletemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_middletemporal.imaging_noddi_ficv numeric 0 1

ctx_lh_paracentral

Description :

left paracentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_paracentral.imaging_noddi_ficv numeric 0 1

ctx_lh_parahippocampal

Description :

left parahippocampal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parahippocampal.imaging_noddi_ficv numeric 0 1

ctx_lh_parsopercularis

Description :

left parsopercularis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsopercularis.imaging_noddi_ficv numeric 0 1

ctx_lh_parsorbitalis

Description :

left parsorbitalis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsorbitalis.imaging_noddi_ficv numeric 0 1

ctx_lh_parstriangularis

Description :

left parstriangularis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parstriangularis.imaging_noddi_ficv numeric 0 1

ctx_lh_pericalcarine

Description :

left pericalcarine NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_pericalcarine.imaging_noddi_ficv numeric 0 1

ctx_lh_postcentral

Description :

left postcentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_postcentral.imaging_noddi_ficv numeric 0 1

ctx_lh_posteriorcingulate

Description :

left posteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_posteriorcingulate.imaging_noddi_ficv numeric 0 1

ctx_lh_precentral

Description :

left precentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precentral.imaging_noddi_ficv numeric 0 1

ctx_lh_precuneus

Description :

left precuneus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precuneus.imaging_noddi_ficv numeric 0 1

ctx_lh_rostralanteriorcingulate

Description :

left rostralanteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralanteriorcingulate.imaging_noddi_ficv numeric 0 1

ctx_lh_rostralmiddlefrontal

Description :

left rostralmiddlefrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralmiddlefrontal.imaging_noddi_ficv numeric 0 1

ctx_lh_superiorfrontal

Description :

left superiorfrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorfrontal.imaging_noddi_ficv numeric 0 1

ctx_lh_superiorparietal

Description :

left superiorparietal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorparietal.imaging_noddi_ficv numeric 0 1

ctx_lh_superiortemporal

Description :

left superiortemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiortemporal.imaging_noddi_ficv numeric 0 1

ctx_lh_supramarginal

Description :

left supramarginal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_supramarginal.imaging_noddi_ficv numeric 0 1

ctx_lh_temporalpole

Description :

left temporalpole NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_temporalpole.imaging_noddi_ficv numeric 0 1

ctx_lh_transversetemporal

Description :

left transversetemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_transversetemporal.imaging_noddi_ficv numeric 0 1

ctx_lh_unknown

Description :

left unknown NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_unknown.imaging_noddi_ficv numeric 0 1

ctx_rh_bankssts

Description :

right bankssts NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_bankssts.imaging_noddi_ficv numeric 0 1

ctx_rh_caudalanteriorcingulate

Description :

right caudalanteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalanteriorcingulate.imaging_noddi_ficv numeric 0 1

ctx_rh_caudalmiddlefrontal

Description :

right caudalmiddlefrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalmiddlefrontal.imaging_noddi_ficv numeric 0 1

ctx_rh_cuneus

Description :

right cuneus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_cuneus.imaging_noddi_ficv numeric 0 1

ctx_rh_entorhinal

Description :

right entorhinal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_entorhinal.imaging_noddi_ficv numeric 0 1

ctx_rh_frontalpole

Description :

right frontalpole NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_frontalpole.imaging_noddi_ficv numeric 0 1

ctx_rh_fusiform

Description :

right fusiform NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_fusiform.imaging_noddi_ficv numeric 0 1

ctx_rh_inferiorparietal

Description :

right inferiorparietal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiorparietal.imaging_noddi_ficv numeric 0 1

ctx_rh_inferiortemporal

Description :

right inferiortemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiortemporal.imaging_noddi_ficv numeric 0 1

ctx_rh_insula

Description :

right insula NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_insula.imaging_noddi_ficv numeric 0 1

ctx_rh_isthmuscingulate

Description :

right isthmuscingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_isthmuscingulate.imaging_noddi_ficv numeric 0 1

ctx_rh_lateraloccipital

Description :

right lateraloccipital NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateraloccipital.imaging_noddi_ficv numeric 0 1

ctx_rh_lateralorbitofrontal

Description :

right lateralorbitofrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateralorbitofrontal.imaging_noddi_ficv numeric 0 1

ctx_rh_lingual

Description :

right lingual NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lingual.imaging_noddi_ficv numeric 0 1

ctx_rh_medialorbitofrontal

Description :

right medialorbitofrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_medialorbitofrontal.imaging_noddi_ficv numeric 0 1

ctx_rh_middletemporal

Description :

right middletemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_middletemporal.imaging_noddi_ficv numeric 0 1

ctx_rh_paracentral

Description :

right paracentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_paracentral.imaging_noddi_ficv numeric 0 1

ctx_rh_parahippocampal

Description :

right parahippocampal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parahippocampal.imaging_noddi_ficv numeric 0 1

ctx_rh_parsopercularis

Description :

right parsopercularis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsopercularis.imaging_noddi_ficv numeric 0 1

ctx_rh_parsorbitalis

Description :

right parsorbitalis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsorbitalis.imaging_noddi_ficv numeric 0 1

ctx_rh_parstriangularis

Description :

right parstriangularis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parstriangularis.imaging_noddi_ficv numeric 0 1

ctx_rh_pericalcarine

Description :

right pericalcarine NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_pericalcarine.imaging_noddi_ficv numeric 0 1

ctx_rh_postcentral

Description :

right postcentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_postcentral.imaging_noddi_ficv numeric 0 1

ctx_rh_posteriorcingulate

Description :

right posteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_posteriorcingulate.imaging_noddi_ficv numeric 0 1

ctx_rh_precentral

Description :

right precentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precentral.imaging_noddi_ficv numeric 0 1

ctx_rh_precuneus

Description :

right precuneus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precuneus.imaging_noddi_ficv numeric 0 1

ctx_rh_rostralanteriorcingulate

Description :

right rostralanteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralanteriorcingulate.imaging_noddi_ficv numeric 0 1

ctx_rh_rostralmiddlefrontal

Description :

right rostralmiddlefrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralmiddlefrontal.imaging_noddi_ficv numeric 0 1

ctx_rh_superiorfrontal

Description :

right superiorfrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorfrontal.imaging_noddi_ficv numeric 0 1

ctx_rh_superiorparietal

Description :

right superiorparietal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorparietal.imaging_noddi_ficv numeric 0 1

ctx_rh_superiortemporal

Description :

right superiortemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiortemporal.imaging_noddi_ficv numeric 0 1

ctx_rh_supramarginal

Description :

right supramarginal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_supramarginal.imaging_noddi_ficv numeric 0 1

ctx_rh_temporalpole

Description :

right temporalpole NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_temporalpole.imaging_noddi_ficv numeric 0 1

ctx_rh_transversetemporal

Description :

right transversetemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_transversetemporal.imaging_noddi_ficv numeric 0 1

ctx_rh_unknown

Description :

right unknown NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_unknown.imaging_noddi_ficv numeric 0 1

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_noddi_ficv numeric 0 infinity

frontal_composite

Description :

frontal composite

Variable Name Type Min Possible Max Possible
frontal_composite.imaging_noddi_ficv numeric 0 1

gm

Description :

global grey matter volume (mm^3)

Variable Name Type Min Possible Max Possible
gm.imaging_noddi_ficv numeric 0 infinity

label

Description :

Calculation of NDI in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_noddi_ficv Mean character

left_accumbens_area

Description :

left accumbens area NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_accumbens_area.imaging_noddi_ficv numeric 0 1

left_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_six_composite.imaging_noddi_ficv numeric 0.4698577 0.8280393

left_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_ten_composite.imaging_noddi_ficv numeric 0.4846368 0.8365276

left_amygdala

Description :

left amygdala NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_amygdala.imaging_noddi_ficv numeric 0 1

left_caudate

Description :

left caudate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_caudate.imaging_noddi_ficv numeric 0 1

left_cerebellum_cortex

Description :

left cerebellum cortex NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_cortex.imaging_noddi_ficv numeric 0 1

left_cerebellum_white_matter

Description :

left cerebellum white matter NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_white_matter.imaging_noddi_ficv numeric 0 1

left_choroid_plexus

Description :

left choroid plexus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_choroid_plexus.imaging_noddi_ficv numeric 0 1

left_frontal_composite

Variable Name Type Min Possible Max Possible
left_frontal_composite.imaging_noddi_ficv numeric 0.4472082 0.9415706

left_hippocampus

Description :

left hippocampus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_hippocampus.imaging_noddi_ficv numeric 0 1

left_inf_lat_vent

Description :

left inf lat vent NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_inf_lat_vent.imaging_noddi_ficv numeric 0 1

left_lateral_ventricle

Description :

left lateral ventricle NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_lateral_ventricle.imaging_noddi_ficv numeric 0 1

left_medial_temporal_composite

Variable Name Type Min Possible Max Possible
left_medial_temporal_composite.imaging_noddi_ficv numeric 0.5325407 0.9499977

left_occipital_composite

Variable Name Type Min Possible Max Possible
left_occipital_composite.imaging_noddi_ficv numeric 0.4375480 0.9048434

left_pallidum

Description :

left pallidum NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_pallidum.imaging_noddi_ficv numeric 0 1

left_parietal_composite

Variable Name Type Min Possible Max Possible
left_parietal_composite.imaging_noddi_ficv numeric 0.4365152 0.8114024

left_putamen

Description :

left putamen NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_putamen.imaging_noddi_ficv numeric 0 1

left_temporal_composite

Variable Name Type Min Possible Max Possible
left_temporal_composite.imaging_noddi_ficv numeric 0.4934487 0.8373833

left_thalamus_proper

Description :

left thalamus proper NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_thalamus_proper.imaging_noddi_ficv numeric 0 1

left_unsegmented_white_matter

Description :

left unsegmented white matter NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_unsegmented_white_matter.imaging_noddi_ficv numeric 0 1

left_ventral_dc

Description :

left ventral dc NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_ventral_dc.imaging_noddi_ficv numeric 0 1

left_vessel

Description :

left vessel NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_vessel.imaging_noddi_ficv numeric 0 1

medial_temporal_composite

Description :

medial temporal composite

Variable Name Type Min Possible Max Possible
medial_temporal_composite.imaging_noddi_ficv numeric 0 1

occipital_composite

Description :

occipital composite

Variable Name Type Min Possible Max Possible
occipital_composite.imaging_noddi_ficv numeric 0 1

optic_chiasm

Description :

optic chiasm NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
optic_chiasm.imaging_noddi_ficv numeric 0 1

parietal_composite

Description :

parietal composite

Variable Name Type Min Possible Max Possible
parietal_composite.imaging_noddi_ficv numeric 0 1

right_accumbens_area

Description :

right accumbens area NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_accumbens_area.imaging_noddi_ficv numeric 0 1

right_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_six_composite.imaging_noddi_ficv numeric 0.4771932 0.8793782

right_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_ten_composite.imaging_noddi_ficv numeric 0.4776771 0.8796096

right_amygdala

Description :

right amygdala NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_amygdala.imaging_noddi_ficv numeric 0 1

right_caudate

Description :

right caudate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_caudate.imaging_noddi_ficv numeric 0 1

right_cerebellum_cortex

Description :

right cerebellum cortex NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_cortex.imaging_noddi_ficv numeric 0 1

right_cerebellum_white_matter

Description :

right cerebellum white matter NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_white_matter.imaging_noddi_ficv numeric 0 1

right_choroid_plexus

Description :

right choroid plexus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_choroid_plexus.imaging_noddi_ficv numeric 0 1

right_frontal_composite

Variable Name Type Min Possible Max Possible
right_frontal_composite.imaging_noddi_ficv numeric 0.4398425 0.9567229

right_hippocampus

Description :

right hippocampus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_hippocampus.imaging_noddi_ficv numeric 0 1

right_inf_lat_vent

Description :

right inf lat vent NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_inf_lat_vent.imaging_noddi_ficv numeric 0 1

right_lateral_ventricle

Description :

right lateral ventricle NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_lateral_ventricle.imaging_noddi_ficv numeric 0 1

right_medial_temporal_composite

Variable Name Type Min Possible Max Possible
right_medial_temporal_composite.imaging_noddi_ficv numeric 0.5349477 0.9731770

right_occipital_composite

Variable Name Type Min Possible Max Possible
right_occipital_composite.imaging_noddi_ficv numeric 0.4204730 0.9093815

right_pallidum

Description :

right pallidum NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_pallidum.imaging_noddi_ficv numeric 0 1

right_parietal_composite

Variable Name Type Min Possible Max Possible
right_parietal_composite.imaging_noddi_ficv numeric 0.4361167 0.7980473

right_putamen

Description :

right putamen NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_putamen.imaging_noddi_ficv numeric 0 1

right_temporal_composite

Variable Name Type Min Possible Max Possible
right_temporal_composite.imaging_noddi_ficv numeric 0.4878995 0.8851367

right_thalamus_proper

Description :

right thalamus proper NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_thalamus_proper.imaging_noddi_ficv numeric 0 1

right_unsegmented_white_matter

Description :

right unsegmented white matter NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_unsegmented_white_matter.imaging_noddi_ficv numeric 0 1

right_ventral_dc

Description :

right ventral dc NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_ventral_dc.imaging_noddi_ficv numeric 0 1

right_vessel

Description :

right vessel NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_vessel.imaging_noddi_ficv numeric 0 1

temporal_composite

Description :

temporal composite

Variable Name Type Min Possible Max Possible
temporal_composite.imaging_noddi_ficv numeric 0 1

tiv

Description :

global total intracranial volume (mm^3)

Variable Name Type Min Possible Max Possible
tiv.imaging_noddi_ficv numeric 0 infinity

wm_hypointensities

Description :

white matter hypointensities NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_hypointensities.imaging_noddi_ficv numeric 0 1

wm_lh_bankssts

Description :

white matter left bankssts NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_bankssts.imaging_noddi_ficv numeric 0 1

wm_lh_caudalanteriorcingulate

Description :

white matter left caudalanteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalanteriorcingulate.imaging_noddi_ficv numeric 0 1

wm_lh_caudalmiddlefrontal

Description :

white matter left caudalmiddlefrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalmiddlefrontal.imaging_noddi_ficv numeric 0 1

wm_lh_cuneus

Description :

white matter left cuneus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_cuneus.imaging_noddi_ficv numeric 0 1

wm_lh_entorhinal

Description :

white matter left entorhinal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_entorhinal.imaging_noddi_ficv numeric 0 1

wm_lh_frontalpole

Description :

white matter left frontalpole NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_frontalpole.imaging_noddi_ficv numeric 0 1

wm_lh_fusiform

Description :

white matter left fusiform NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_fusiform.imaging_noddi_ficv numeric 0 1

wm_lh_inferiorparietal

Description :

white matter left inferiorparietal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiorparietal.imaging_noddi_ficv numeric 0 1

wm_lh_inferiortemporal

Description :

white matter left inferiortemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiortemporal.imaging_noddi_ficv numeric 0 1

wm_lh_insula

Description :

white matter left insula NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_insula.imaging_noddi_ficv numeric 0 1

wm_lh_isthmuscingulate

Description :

white matter left isthmuscingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_isthmuscingulate.imaging_noddi_ficv numeric 0 1

wm_lh_lateraloccipital

Description :

white matter left lateraloccipital NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateraloccipital.imaging_noddi_ficv numeric 0 1

wm_lh_lateralorbitofrontal

Description :

white matter left lateralorbitofrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateralorbitofrontal.imaging_noddi_ficv numeric 0 1

wm_lh_lingual

Description :

white matter left lingual NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lingual.imaging_noddi_ficv numeric 0 1

wm_lh_medialorbitofrontal

Description :

white matter left medialorbitofrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_medialorbitofrontal.imaging_noddi_ficv numeric 0 1

wm_lh_middletemporal

Description :

white matter left middletemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_middletemporal.imaging_noddi_ficv numeric 0 1

wm_lh_paracentral

Description :

white matter left paracentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_paracentral.imaging_noddi_ficv numeric 0 1

wm_lh_parahippocampal

Description :

white matter left parahippocampal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parahippocampal.imaging_noddi_ficv numeric 0 1

wm_lh_parsopercularis

Description :

white matter left parsopercularis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsopercularis.imaging_noddi_ficv numeric 0 1

wm_lh_parsorbitalis

Description :

white matter left parsorbitalis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsorbitalis.imaging_noddi_ficv numeric 0 1

wm_lh_parstriangularis

Description :

white matter left parstriangularis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parstriangularis.imaging_noddi_ficv numeric 0 1

wm_lh_pericalcarine

Description :

white matter left pericalcarine NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_pericalcarine.imaging_noddi_ficv numeric 0 1

wm_lh_postcentral

Description :

white matter left postcentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_postcentral.imaging_noddi_ficv numeric 0 1

wm_lh_posteriorcingulate

Description :

white matter left posteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_posteriorcingulate.imaging_noddi_ficv numeric 0 1

wm_lh_precentral

Description :

white matter left precentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precentral.imaging_noddi_ficv numeric 0 1

wm_lh_precuneus

Description :

white matter left precuneus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precuneus.imaging_noddi_ficv numeric 0 1

wm_lh_rostralanteriorcingulate

Description :

white matter left rostralanteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralanteriorcingulate.imaging_noddi_ficv numeric 0 1

wm_lh_rostralmiddlefrontal

Description :

white matter left rostralmiddlefrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralmiddlefrontal.imaging_noddi_ficv numeric 0 1

wm_lh_superiorfrontal

Description :

white matter left superiorfrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorfrontal.imaging_noddi_ficv numeric 0 1

wm_lh_superiorparietal

Description :

white matter left superiorparietal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorparietal.imaging_noddi_ficv numeric 0 1

wm_lh_superiortemporal

Description :

white matter left superiortemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiortemporal.imaging_noddi_ficv numeric 0 1

wm_lh_supramarginal

Description :

white matter left supramarginal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_supramarginal.imaging_noddi_ficv numeric 0 1

wm_lh_temporalpole

Description :

white matter left temporalpole NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_temporalpole.imaging_noddi_ficv numeric 0 1

wm_lh_transversetemporal

Description :

white matter left transversetemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_transversetemporal.imaging_noddi_ficv numeric 0 1

wm_rh_bankssts

Description :

white matter right bankssts NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_bankssts.imaging_noddi_ficv numeric 0 1

wm_rh_caudalanteriorcingulate

Description :

white matter right caudalanteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalanteriorcingulate.imaging_noddi_ficv numeric 0 1

wm_rh_caudalmiddlefrontal

Description :

white matter right caudalmiddlefrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalmiddlefrontal.imaging_noddi_ficv numeric 0 1

wm_rh_cuneus

Description :

white matter right cuneus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_cuneus.imaging_noddi_ficv numeric 0 1

wm_rh_entorhinal

Description :

white matter right entorhinal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_entorhinal.imaging_noddi_ficv numeric 0 1

wm_rh_frontalpole

Description :

white matter right frontalpole NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_frontalpole.imaging_noddi_ficv numeric 0 1

wm_rh_fusiform

Description :

white matter right fusiform NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_fusiform.imaging_noddi_ficv numeric 0 1

wm_rh_inferiorparietal

Description :

white matter right inferiorparietal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiorparietal.imaging_noddi_ficv numeric 0 1

wm_rh_inferiortemporal

Description :

white matter right inferiortemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiortemporal.imaging_noddi_ficv numeric 0 1

wm_rh_insula

Description :

white matter right insula NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_insula.imaging_noddi_ficv numeric 0 1

wm_rh_isthmuscingulate

Description :

white matter right isthmuscingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_isthmuscingulate.imaging_noddi_ficv numeric 0 1

wm_rh_lateraloccipital

Description :

white matter right lateraloccipital NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateraloccipital.imaging_noddi_ficv numeric 0 1

wm_rh_lateralorbitofrontal

Description :

white matter right lateralorbitofrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateralorbitofrontal.imaging_noddi_ficv numeric 0 1

wm_rh_lingual

Description :

white matter right lingual NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lingual.imaging_noddi_ficv numeric 0 1

wm_rh_medialorbitofrontal

Description :

white matter right medialorbitofrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_medialorbitofrontal.imaging_noddi_ficv numeric 0 1

wm_rh_middletemporal

Description :

white matter right middletemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_middletemporal.imaging_noddi_ficv numeric 0 1

wm_rh_paracentral

Description :

white matter right paracentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_paracentral.imaging_noddi_ficv numeric 0 1

wm_rh_parahippocampal

Description :

white matter right parahippocampal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parahippocampal.imaging_noddi_ficv numeric 0 1

wm_rh_parsopercularis

Description :

white matter right parsopercularis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsopercularis.imaging_noddi_ficv numeric 0 1

wm_rh_parsorbitalis

Description :

white matter right parsorbitalis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsorbitalis.imaging_noddi_ficv numeric 0 1

wm_rh_parstriangularis

Description :

white matter right parstriangularis NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parstriangularis.imaging_noddi_ficv numeric 0 1

wm_rh_pericalcarine

Description :

white matter right pericalcarine NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_pericalcarine.imaging_noddi_ficv numeric 0 1

wm_rh_postcentral

Description :

white matter right postcentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_postcentral.imaging_noddi_ficv numeric 0 1

wm_rh_posteriorcingulate

Description :

white matter right posteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_posteriorcingulate.imaging_noddi_ficv numeric 0 1

wm_rh_precentral

Description :

white matter right precentral NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precentral.imaging_noddi_ficv numeric 0 1

wm_rh_precuneus

Description :

white matter right precuneus NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precuneus.imaging_noddi_ficv numeric 0 1

wm_rh_rostralanteriorcingulate

Description :

white matter right rostralanteriorcingulate NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralanteriorcingulate.imaging_noddi_ficv numeric 0 1

wm_rh_rostralmiddlefrontal

Description :

white matter right rostralmiddlefrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralmiddlefrontal.imaging_noddi_ficv numeric 0 1

wm_rh_superiorfrontal

Description :

white matter right superiorfrontal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorfrontal.imaging_noddi_ficv numeric 0 1

wm_rh_superiorparietal

Description :

white matter right superiorparietal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorparietal.imaging_noddi_ficv numeric 0 1

wm_rh_superiortemporal

Description :

white matter right superiortemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiortemporal.imaging_noddi_ficv numeric 0 1

wm_rh_supramarginal

Description :

white matter right supramarginal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_supramarginal.imaging_noddi_ficv numeric 0 1

wm_rh_temporalpole

Description :

white matter right temporalpole NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_temporalpole.imaging_noddi_ficv numeric 0 1

wm_rh_transversetemporal

Description :

white matter right transversetemporal NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_transversetemporal.imaging_noddi_ficv numeric 0 1

wm

Description :

global white matter volume (mm^3)

Variable Name Type Min Possible Max Possible
wm.imaging_noddi_ficv numeric 0 infinity

x3rd_ventricle

Description :

3rd ventricle NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
x3rd_ventricle.imaging_noddi_ficv numeric 0 1

x4th_ventricle

Description :

4th ventricle NDI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
x4th_ventricle.imaging_noddi_ficv numeric 0 1

imaging_noddi_fiso

Description :

Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: free water fraction (FWF) estimates the extent of CSF contamination which points to a use as a marker for inflammation.

References :

  • Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908

  • Kraguljac, N. V., Guerreri, M., Strickland, M. J., & Zhang, H. (2023). Neurite orientation dispersion and density imaging in psychiatric disorders: A systematic literature review and a technical note. Biological Psychiatry Global Open Science, 3(1), 10–21. https://doi.org/10.1016/j.bpsgos.2021.12.012


ad_meta_six_composite

Description :

ad meta six composite

Variable Name Type Min Possible Max Possible
ad_meta_six_composite.imaging_noddi_fiso numeric 0 1

ad_meta_ten_composite

Description :

ad meta ten composite

Variable Name Type Min Possible Max Possible
ad_meta_ten_composite.imaging_noddi_fiso numeric 0 1

brain_stem

Description :

brain stem free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
brain_stem.imaging_noddi_fiso numeric 0 1

cc_anterior

Description :

anterior corpus callosum free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_anterior.imaging_noddi_fiso numeric 0 1

cc_central

Description :

central corpus callosum free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_central.imaging_noddi_fiso numeric 0 1

cc_mid_anterior

Description :

mid anterior corpus callosum free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_mid_anterior.imaging_noddi_fiso numeric 0 1

cc_mid_posterior

Description :

mid posterior corpus callosum free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_mid_posterior.imaging_noddi_fiso numeric 0 1

cc_posterior

Description :

posterior corpus callosum free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_posterior.imaging_noddi_fiso numeric 0 1

csf

Description :

csf free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
csf.imaging_noddi_fiso numeric 0 1

ctx_lh_bankssts

Description :

left bankssts free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_bankssts.imaging_noddi_fiso numeric 0 1

ctx_lh_caudalanteriorcingulate

Description :

left caudalanteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalanteriorcingulate.imaging_noddi_fiso numeric 0 1

ctx_lh_caudalmiddlefrontal

Description :

left caudalmiddlefrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalmiddlefrontal.imaging_noddi_fiso numeric 0 1

ctx_lh_cuneus

Description :

left cuneus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_cuneus.imaging_noddi_fiso numeric 0 1

ctx_lh_entorhinal

Description :

left entorhinal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_entorhinal.imaging_noddi_fiso numeric 0 1

ctx_lh_frontalpole

Description :

left frontalpole free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_frontalpole.imaging_noddi_fiso numeric 0 1

ctx_lh_fusiform

Description :

left fusiform free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_fusiform.imaging_noddi_fiso numeric 0 1

ctx_lh_inferiorparietal

Description :

left inferiorparietal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiorparietal.imaging_noddi_fiso numeric 0 1

ctx_lh_inferiortemporal

Description :

left inferiortemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiortemporal.imaging_noddi_fiso numeric 0 1

ctx_lh_insula

Description :

left insula free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_insula.imaging_noddi_fiso numeric 0 1

ctx_lh_isthmuscingulate

Description :

left isthmuscingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_isthmuscingulate.imaging_noddi_fiso numeric 0 1

ctx_lh_lateraloccipital

Description :

left lateraloccipital free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateraloccipital.imaging_noddi_fiso numeric 0 1

ctx_lh_lateralorbitofrontal

Description :

left lateralorbitofrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateralorbitofrontal.imaging_noddi_fiso numeric 0 1

ctx_lh_lingual

Description :

left lingual free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lingual.imaging_noddi_fiso numeric 0 1

ctx_lh_medialorbitofrontal

Description :

left medialorbitofrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_medialorbitofrontal.imaging_noddi_fiso numeric 0 1

ctx_lh_middletemporal

Description :

left middletemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_middletemporal.imaging_noddi_fiso numeric 0 1

ctx_lh_paracentral

Description :

left paracentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_paracentral.imaging_noddi_fiso numeric 0 1

ctx_lh_parahippocampal

Description :

left parahippocampal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parahippocampal.imaging_noddi_fiso numeric 0 1

ctx_lh_parsopercularis

Description :

left parsopercularis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsopercularis.imaging_noddi_fiso numeric 0 1

ctx_lh_parsorbitalis

Description :

left parsorbitalis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsorbitalis.imaging_noddi_fiso numeric 0 1

ctx_lh_parstriangularis

Description :

left parstriangularis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parstriangularis.imaging_noddi_fiso numeric 0 1

ctx_lh_pericalcarine

Description :

left pericalcarine free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_pericalcarine.imaging_noddi_fiso numeric 0 1

ctx_lh_postcentral

Description :

left postcentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_postcentral.imaging_noddi_fiso numeric 0 1

ctx_lh_posteriorcingulate

Description :

left posteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_posteriorcingulate.imaging_noddi_fiso numeric 0 1

ctx_lh_precentral

Description :

left precentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precentral.imaging_noddi_fiso numeric 0 1

ctx_lh_precuneus

Description :

left precuneus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precuneus.imaging_noddi_fiso numeric 0 1

ctx_lh_rostralanteriorcingulate

Description :

left rostralanteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralanteriorcingulate.imaging_noddi_fiso numeric 0 1

ctx_lh_rostralmiddlefrontal

Description :

left rostralmiddlefrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralmiddlefrontal.imaging_noddi_fiso numeric 0 1

ctx_lh_superiorfrontal

Description :

left superiorfrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorfrontal.imaging_noddi_fiso numeric 0 1

ctx_lh_superiorparietal

Description :

left superiorparietal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorparietal.imaging_noddi_fiso numeric 0 1

ctx_lh_superiortemporal

Description :

left superiortemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiortemporal.imaging_noddi_fiso numeric 0 1

ctx_lh_supramarginal

Description :

left supramarginal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_supramarginal.imaging_noddi_fiso numeric 0 1

ctx_lh_temporalpole

Description :

left temporalpole free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_temporalpole.imaging_noddi_fiso numeric 0 1

ctx_lh_transversetemporal

Description :

left transversetemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_transversetemporal.imaging_noddi_fiso numeric 0 1

ctx_lh_unknown

Description :

left unknown free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_unknown.imaging_noddi_fiso numeric 0 1

ctx_rh_bankssts

Description :

right bankssts free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_bankssts.imaging_noddi_fiso numeric 0 1

ctx_rh_caudalanteriorcingulate

Description :

right caudalanteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalanteriorcingulate.imaging_noddi_fiso numeric 0 1

ctx_rh_caudalmiddlefrontal

Description :

right caudalmiddlefrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalmiddlefrontal.imaging_noddi_fiso numeric 0 1

ctx_rh_cuneus

Description :

right cuneus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_cuneus.imaging_noddi_fiso numeric 0 1

ctx_rh_entorhinal

Description :

right entorhinal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_entorhinal.imaging_noddi_fiso numeric 0 1

ctx_rh_frontalpole

Description :

right frontalpole free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_frontalpole.imaging_noddi_fiso numeric 0 1

ctx_rh_fusiform

Description :

right fusiform free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_fusiform.imaging_noddi_fiso numeric 0 1

ctx_rh_inferiorparietal

Description :

right inferiorparietal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiorparietal.imaging_noddi_fiso numeric 0 1

ctx_rh_inferiortemporal

Description :

right inferiortemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiortemporal.imaging_noddi_fiso numeric 0 1

ctx_rh_insula

Description :

right insula free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_insula.imaging_noddi_fiso numeric 0 1

ctx_rh_isthmuscingulate

Description :

right isthmuscingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_isthmuscingulate.imaging_noddi_fiso numeric 0 1

ctx_rh_lateraloccipital

Description :

right lateraloccipital free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateraloccipital.imaging_noddi_fiso numeric 0 1

ctx_rh_lateralorbitofrontal

Description :

right lateralorbitofrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateralorbitofrontal.imaging_noddi_fiso numeric 0 1

ctx_rh_lingual

Description :

right lingual free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lingual.imaging_noddi_fiso numeric 0 1

ctx_rh_medialorbitofrontal

Description :

right medialorbitofrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_medialorbitofrontal.imaging_noddi_fiso numeric 0 1

ctx_rh_middletemporal

Description :

right middletemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_middletemporal.imaging_noddi_fiso numeric 0 1

ctx_rh_paracentral

Description :

right paracentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_paracentral.imaging_noddi_fiso numeric 0 1

ctx_rh_parahippocampal

Description :

right parahippocampal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parahippocampal.imaging_noddi_fiso numeric 0 1

ctx_rh_parsopercularis

Description :

right parsopercularis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsopercularis.imaging_noddi_fiso numeric 0 1

ctx_rh_parsorbitalis

Description :

right parsorbitalis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsorbitalis.imaging_noddi_fiso numeric 0 1

ctx_rh_parstriangularis

Description :

right parstriangularis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parstriangularis.imaging_noddi_fiso numeric 0 1

ctx_rh_pericalcarine

Description :

right pericalcarine free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_pericalcarine.imaging_noddi_fiso numeric 0 1

ctx_rh_postcentral

Description :

right postcentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_postcentral.imaging_noddi_fiso numeric 0 1

ctx_rh_posteriorcingulate

Description :

right posteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_posteriorcingulate.imaging_noddi_fiso numeric 0 1

ctx_rh_precentral

Description :

right precentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precentral.imaging_noddi_fiso numeric 0 1

ctx_rh_precuneus

Description :

right precuneus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precuneus.imaging_noddi_fiso numeric 0 1

ctx_rh_rostralanteriorcingulate

Description :

right rostralanteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralanteriorcingulate.imaging_noddi_fiso numeric 0 1

ctx_rh_rostralmiddlefrontal

Description :

right rostralmiddlefrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralmiddlefrontal.imaging_noddi_fiso numeric 0 1

ctx_rh_superiorfrontal

Description :

right superiorfrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorfrontal.imaging_noddi_fiso numeric 0 1

ctx_rh_superiorparietal

Description :

right superiorparietal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorparietal.imaging_noddi_fiso numeric 0 1

ctx_rh_superiortemporal

Description :

right superiortemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiortemporal.imaging_noddi_fiso numeric 0 1

ctx_rh_supramarginal

Description :

right supramarginal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_supramarginal.imaging_noddi_fiso numeric 0 1

ctx_rh_temporalpole

Description :

right temporalpole free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_temporalpole.imaging_noddi_fiso numeric 0 1

ctx_rh_transversetemporal

Description :

right transversetemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_transversetemporal.imaging_noddi_fiso numeric 0 1

ctx_rh_unknown

Description :

right unknown free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_unknown.imaging_noddi_fiso numeric 0 1

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_noddi_fiso numeric 0 infinty

frontal_composite

Description :

frontal composite

Variable Name Type Min Possible Max Possible
frontal_composite.imaging_noddi_fiso numeric 0 1

gm

Description :

global grey matter volume (mm^3)

Variable Name Type Min Possible Max Possible
gm.imaging_noddi_fiso numeric 0 infinty

label

Description :

Calculation of free water fraction in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_noddi_fiso Mean character

left_accumbens_area

Description :

left accumbens area free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_accumbens_area.imaging_noddi_fiso numeric 0 1

left_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_six_composite.imaging_noddi_fiso numeric 0.03746143 0.49354400

left_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_ten_composite.imaging_noddi_fiso numeric 0.03488694 0.48884290

left_amygdala

Description :

left amygdala free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_amygdala.imaging_noddi_fiso numeric 0 1

left_caudate

Description :

left caudate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_caudate.imaging_noddi_fiso numeric 0 1

left_cerebellum_cortex

Description :

left cerebellum cortex free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_cortex.imaging_noddi_fiso numeric 0 1

left_cerebellum_white_matter

Description :

left cerebellum white matter free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_white_matter.imaging_noddi_fiso numeric 0 1

left_choroid_plexus

Description :

left choroid plexus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_choroid_plexus.imaging_noddi_fiso numeric 0 1

left_frontal_composite

Variable Name Type Min Possible Max Possible
left_frontal_composite.imaging_noddi_fiso numeric 0.04986550 0.50509410

left_hippocampus

Description :

left hippocampus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_hippocampus.imaging_noddi_fiso numeric 0 1

left_inf_lat_vent

Description :

left inf lat vent free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_inf_lat_vent.imaging_noddi_fiso numeric 0 1

left_lateral_ventricle

Description :

left lateral ventricle free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_lateral_ventricle.imaging_noddi_fiso numeric 0 1

left_medial_temporal_composite

Variable Name Type Min Possible Max Possible
left_medial_temporal_composite.imaging_noddi_fiso numeric 0.06271857 0.49622000

left_occipital_composite

Variable Name Type Min Possible Max Possible
left_occipital_composite.imaging_noddi_fiso numeric 0.03683771 0.52225537

left_pallidum

Description :

left pallidum free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_pallidum.imaging_noddi_fiso numeric 0 1

left_parietal_composite

Variable Name Type Min Possible Max Possible
left_parietal_composite.imaging_noddi_fiso numeric 0.04079328 0.55622300

left_putamen

Description :

left putamen free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_putamen.imaging_noddi_fiso numeric 0 1

left_temporal_composite

Variable Name Type Min Possible Max Possible
left_temporal_composite.imaging_noddi_fiso numeric 0.03968512 0.48812327

left_thalamus_proper

Description :

left thalamus proper free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_thalamus_proper.imaging_noddi_fiso numeric 0 1

left_unsegmented_white_matter

Description :

left unsegmented white matter free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_unsegmented_white_matter.imaging_noddi_fiso numeric 0 1

left_ventral_dc

Description :

left ventral dc free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_ventral_dc.imaging_noddi_fiso numeric 0 1

left_vessel

Description :

left vessel free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_vessel.imaging_noddi_fiso numeric 0 1

medial_temporal_composite

Description :

medial temporal composite

Variable Name Type Min Possible Max Possible
medial_temporal_composite.imaging_noddi_fiso numeric 0 1

occipital_composite

Description :

occipital composite

Variable Name Type Min Possible Max Possible
occipital_composite.imaging_noddi_fiso numeric 0 1

optic_chiasm

Description :

optic chiasm free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
optic_chiasm.imaging_noddi_fiso numeric 0 1

parietal_composite

Description :

parietal composite

Variable Name Type Min Possible Max Possible
parietal_composite.imaging_noddi_fiso numeric 0 1

right_accumbens_area

Description :

right accumbens area free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_accumbens_area.imaging_noddi_fiso numeric 0 1

right_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_six_composite.imaging_noddi_fiso numeric 0.03734681 0.49804217

right_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_ten_composite.imaging_noddi_fiso numeric 0.03975091 0.48304460

right_amygdala

Description :

right amygdala free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_amygdala.imaging_noddi_fiso numeric 0 1

right_caudate

Description :

right caudate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_caudate.imaging_noddi_fiso numeric 0 1

right_cerebellum_cortex

Description :

right cerebellum cortex free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_cortex.imaging_noddi_fiso numeric 0 1

right_cerebellum_white_matter

Description :

right cerebellum white matter free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_white_matter.imaging_noddi_fiso numeric 0 1

right_choroid_plexus

Description :

right choroid plexus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_choroid_plexus.imaging_noddi_fiso numeric 0 1

right_frontal_composite

Variable Name Type Min Possible Max Possible
right_frontal_composite.imaging_noddi_fiso numeric 0.04790281 0.51155520

right_hippocampus

Description :

right hippocampus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_hippocampus.imaging_noddi_fiso numeric 0 1

right_inf_lat_vent

Description :

right inf lat vent free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_inf_lat_vent.imaging_noddi_fiso numeric 0 1

right_lateral_ventricle

Description :

right lateral ventricle free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_lateral_ventricle.imaging_noddi_fiso numeric 0 1

right_medial_temporal_composite

Variable Name Type Min Possible Max Possible
right_medial_temporal_composite.imaging_noddi_fiso numeric 0.07241590 0.51515600

right_occipital_composite

Variable Name Type Min Possible Max Possible
right_occipital_composite.imaging_noddi_fiso numeric 0.02757500 0.52851000

right_pallidum

Description :

right pallidum free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_pallidum.imaging_noddi_fiso numeric 0 1

right_parietal_composite

Variable Name Type Min Possible Max Possible
right_parietal_composite.imaging_noddi_fiso numeric 0.03990878 0.55479617

right_putamen

Description :

right putamen free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_putamen.imaging_noddi_fiso numeric 0 1

right_temporal_composite

Variable Name Type Min Possible Max Possible
right_temporal_composite.imaging_noddi_fiso numeric 0.04204959 0.47913809

right_thalamus_proper

Description :

right thalamus proper free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_thalamus_proper.imaging_noddi_fiso numeric 0 1

right_unsegmented_white_matter

Description :

right unsegmented white matter free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_unsegmented_white_matter.imaging_noddi_fiso numeric 0 1

right_ventral_dc

Description :

right ventral dc free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_ventral_dc.imaging_noddi_fiso numeric 0 1

right_vessel

Description :

right vessel free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_vessel.imaging_noddi_fiso numeric 0 1

temporal_composite

Description :

temporal composite

Variable Name Type Min Possible Max Possible
temporal_composite.imaging_noddi_fiso numeric 0 1

tiv

Description :

global total intracranial volume (mm^3)

Variable Name Type Min Possible Max Possible
tiv.imaging_noddi_fiso numeric 0 infinity

wm_hypointensities

Description :

white matter hypointensities free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_hypointensities.imaging_noddi_fiso numeric 0 1

wm_lh_bankssts

Description :

white matter left bankssts free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_bankssts.imaging_noddi_fiso numeric 0 1

wm_lh_caudalanteriorcingulate

Description :

white matter left caudalanteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalanteriorcingulate.imaging_noddi_fiso numeric 0 1

wm_lh_caudalmiddlefrontal

Description :

white matter left caudalmiddlefrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalmiddlefrontal.imaging_noddi_fiso numeric 0 1

wm_lh_cuneus

Description :

white matter left cuneus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_cuneus.imaging_noddi_fiso numeric 0 1

wm_lh_entorhinal

Description :

white matter left entorhinal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_entorhinal.imaging_noddi_fiso numeric 0 1

wm_lh_frontalpole

Description :

white matter left frontalpole free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_frontalpole.imaging_noddi_fiso numeric 0 1

wm_lh_fusiform

Description :

white matter left fusiform free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_fusiform.imaging_noddi_fiso numeric 0 1

wm_lh_inferiorparietal

Description :

white matter left inferiorparietal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiorparietal.imaging_noddi_fiso numeric 0 1

wm_lh_inferiortemporal

Description :

white matter left inferiortemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiortemporal.imaging_noddi_fiso numeric 0 1

wm_lh_insula

Description :

white matter left insula free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_insula.imaging_noddi_fiso numeric 0 1

wm_lh_isthmuscingulate

Description :

white matter left isthmuscingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_isthmuscingulate.imaging_noddi_fiso numeric 0 1

wm_lh_lateraloccipital

Description :

white matter left lateraloccipital free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateraloccipital.imaging_noddi_fiso numeric 0 1

wm_lh_lateralorbitofrontal

Description :

white matter left lateralorbitofrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateralorbitofrontal.imaging_noddi_fiso numeric 0 1

wm_lh_lingual

Description :

white matter left lingual free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lingual.imaging_noddi_fiso numeric 0 1

wm_lh_medialorbitofrontal

Description :

white matter left medialorbitofrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_medialorbitofrontal.imaging_noddi_fiso numeric 0 1

wm_lh_middletemporal

Description :

white matter left middletemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_middletemporal.imaging_noddi_fiso numeric 0 1

wm_lh_paracentral

Description :

white matter left paracentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_paracentral.imaging_noddi_fiso numeric 0 1

wm_lh_parahippocampal

Description :

white matter left parahippocampal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parahippocampal.imaging_noddi_fiso numeric 0 1

wm_lh_parsopercularis

Description :

white matter left parsopercularis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsopercularis.imaging_noddi_fiso numeric 0 1

wm_lh_parsorbitalis

Description :

white matter left parsorbitalis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsorbitalis.imaging_noddi_fiso numeric 0 1

wm_lh_parstriangularis

Description :

white matter left parstriangularis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parstriangularis.imaging_noddi_fiso numeric 0 1

wm_lh_pericalcarine

Description :

white matter left pericalcarine free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_pericalcarine.imaging_noddi_fiso numeric 0 1

wm_lh_postcentral

Description :

white matter left postcentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_postcentral.imaging_noddi_fiso numeric 0 1

wm_lh_posteriorcingulate

Description :

white matter left posteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_posteriorcingulate.imaging_noddi_fiso numeric 0 1

wm_lh_precentral

Description :

white matter left precentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precentral.imaging_noddi_fiso numeric 0 1

wm_lh_precuneus

Description :

white matter left precuneus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precuneus.imaging_noddi_fiso numeric 0 1

wm_lh_rostralanteriorcingulate

Description :

white matter left rostralanteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralanteriorcingulate.imaging_noddi_fiso numeric 0 1

wm_lh_rostralmiddlefrontal

Description :

white matter left rostralmiddlefrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralmiddlefrontal.imaging_noddi_fiso numeric 0 1

wm_lh_superiorfrontal

Description :

white matter left superiorfrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorfrontal.imaging_noddi_fiso numeric 0 1

wm_lh_superiorparietal

Description :

white matter left superiorparietal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorparietal.imaging_noddi_fiso numeric 0 1

wm_lh_superiortemporal

Description :

white matter left superiortemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiortemporal.imaging_noddi_fiso numeric 0 1

wm_lh_supramarginal

Description :

white matter left supramarginal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_supramarginal.imaging_noddi_fiso numeric 0 1

wm_lh_temporalpole

Description :

white matter left temporalpole free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_temporalpole.imaging_noddi_fiso numeric 0 1

wm_lh_transversetemporal

Description :

white matter left transversetemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_transversetemporal.imaging_noddi_fiso numeric 0 1

wm_rh_bankssts

Description :

white matter right bankssts free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_bankssts.imaging_noddi_fiso numeric 0 1

wm_rh_caudalanteriorcingulate

Description :

white matter right caudalanteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalanteriorcingulate.imaging_noddi_fiso numeric 0 1

wm_rh_caudalmiddlefrontal

Description :

white matter right caudalmiddlefrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalmiddlefrontal.imaging_noddi_fiso numeric 0 1

wm_rh_cuneus

Description :

white matter right cuneus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_cuneus.imaging_noddi_fiso numeric 0 1

wm_rh_entorhinal

Description :

white matter right entorhinal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_entorhinal.imaging_noddi_fiso numeric 0 1

wm_rh_frontalpole

Description :

white matter right frontalpole free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_frontalpole.imaging_noddi_fiso numeric 0 1

wm_rh_fusiform

Description :

white matter right fusiform free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_fusiform.imaging_noddi_fiso numeric 0 1

wm_rh_inferiorparietal

Description :

white matter right inferiorparietal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiorparietal.imaging_noddi_fiso numeric 0 1

wm_rh_inferiortemporal

Description :

white matter right inferiortemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiortemporal.imaging_noddi_fiso numeric 0 1

wm_rh_insula

Description :

white matter right insula free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_insula.imaging_noddi_fiso numeric 0 1

wm_rh_isthmuscingulate

Description :

white matter right isthmuscingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_isthmuscingulate.imaging_noddi_fiso numeric 0 1

wm_rh_lateraloccipital

Description :

white matter right lateraloccipital free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateraloccipital.imaging_noddi_fiso numeric 0 1

wm_rh_lateralorbitofrontal

Description :

white matter right lateralorbitofrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateralorbitofrontal.imaging_noddi_fiso numeric 0 1

wm_rh_lingual

Description :

white matter right lingual free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lingual.imaging_noddi_fiso numeric 0 1

wm_rh_medialorbitofrontal

Description :

white matter right medialorbitofrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_medialorbitofrontal.imaging_noddi_fiso numeric 0 1

wm_rh_middletemporal

Description :

white matter right middletemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_middletemporal.imaging_noddi_fiso numeric 0 1

wm_rh_paracentral

Description :

white matter right paracentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_paracentral.imaging_noddi_fiso numeric 0 1

wm_rh_parahippocampal

Description :

white matter right parahippocampal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parahippocampal.imaging_noddi_fiso numeric 0 1

wm_rh_parsopercularis

Description :

white matter right parsopercularis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsopercularis.imaging_noddi_fiso numeric 0 1

wm_rh_parsorbitalis

Description :

white matter right parsorbitalis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsorbitalis.imaging_noddi_fiso numeric 0 1

wm_rh_parstriangularis

Description :

white matter right parstriangularis free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parstriangularis.imaging_noddi_fiso numeric 0 1

wm_rh_pericalcarine

Description :

white matter right pericalcarine free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_pericalcarine.imaging_noddi_fiso numeric 0 1

wm_rh_postcentral

Description :

white matter right postcentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_postcentral.imaging_noddi_fiso numeric 0 1

wm_rh_posteriorcingulate

Description :

white matter right posteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_posteriorcingulate.imaging_noddi_fiso numeric 0 1

wm_rh_precentral

Description :

white matter right precentral free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precentral.imaging_noddi_fiso numeric 0 1

wm_rh_precuneus

Description :

white matter right precuneus free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precuneus.imaging_noddi_fiso numeric 0 1

wm_rh_rostralanteriorcingulate

Description :

white matter right rostralanteriorcingulate free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralanteriorcingulate.imaging_noddi_fiso numeric 0 1

wm_rh_rostralmiddlefrontal

Description :

white matter right rostralmiddlefrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralmiddlefrontal.imaging_noddi_fiso numeric 0 1

wm_rh_superiorfrontal

Description :

white matter right superiorfrontal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorfrontal.imaging_noddi_fiso numeric 0 1

wm_rh_superiorparietal

Description :

white matter right superiorparietal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorparietal.imaging_noddi_fiso numeric 0 1

wm_rh_superiortemporal

Description :

white matter right superiortemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiortemporal.imaging_noddi_fiso numeric 0 1

wm_rh_supramarginal

Description :

white matter right supramarginal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_supramarginal.imaging_noddi_fiso numeric 0 1

wm_rh_temporalpole

Description :

white matter right temporalpole free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_temporalpole.imaging_noddi_fiso numeric 0 1

wm_rh_transversetemporal

Description :

white matter right transversetemporal free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_transversetemporal.imaging_noddi_fiso numeric 0 1

wm

Description :

global white matter volume (mm^3)

Variable Name Type Min Possible Max Possible
wm.imaging_noddi_fiso numeric 0 infinity

x3rd_ventricle

Description :

3rd ventricle free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
x3rd_ventricle.imaging_noddi_fiso numeric 0 1

x4th_ventricle

Description :

4th ventricle free water fraction value (Deskian ROI)

Variable Name Type Min Possible Max Possible
x4th_ventricle.imaging_noddi_fiso numeric 0 1

imaging_noddi_odi

Description :

Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: orientation dispersion index (ODI) assesses the orientational coherence of neurites and generally shows a nonlinear increase until around 60 years, followed by a decrease.

References :

  • Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908

  • Kraguljac, N. V., Guerreri, M., Strickland, M. J., & Zhang, H. (2023). Neurite orientation dispersion and density imaging in psychiatric disorders: A systematic literature review and a technical note. Biological Psychiatry Global Open Science, 3(1), 10–21. https://doi.org/10.1016/j.bpsgos.2021.12.012


ad_meta_six_composite

Description :

ad meta six composite

Variable Name Type Min Possible Max Possible
ad_meta_six_composite.imaging_noddi_odi numeric 0 1

ad_meta_ten_composite

Description :

ad meta ten composite

Variable Name Type Min Possible Max Possible
ad_meta_ten_composite.imaging_noddi_odi numeric 0 1

brain_stem

Description :

brain stem ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
brain_stem.imaging_noddi_odi numeric 0 1

cc_anterior

Description :

anterior corpus callosum ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_anterior.imaging_noddi_odi numeric 0 1

cc_central

Description :

central corpus callosum ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_central.imaging_noddi_odi numeric 0 1

cc_mid_anterior

Description :

mid anterior corpus callosum ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_mid_anterior.imaging_noddi_odi numeric 0 1

cc_mid_posterior

Description :

mid posterior corpus callosum ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_mid_posterior.imaging_noddi_odi numeric 0 1

cc_posterior

Description :

posterior corpus callosum ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_posterior.imaging_noddi_odi numeric 0 1

csf

Description :

csf ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
csf.imaging_noddi_odi numeric 0 1

ctx_lh_bankssts

Description :

left bankssts ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_bankssts.imaging_noddi_odi numeric 0 1

ctx_lh_caudalanteriorcingulate

Description :

left caudalanteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalanteriorcingulate.imaging_noddi_odi numeric 0 1

ctx_lh_caudalmiddlefrontal

Description :

left caudalmiddlefrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalmiddlefrontal.imaging_noddi_odi numeric 0 1

ctx_lh_cuneus

Description :

left cuneus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_cuneus.imaging_noddi_odi numeric 0 1

ctx_lh_entorhinal

Description :

left entorhinal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_entorhinal.imaging_noddi_odi numeric 0 1

ctx_lh_frontalpole

Description :

left frontalpole ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_frontalpole.imaging_noddi_odi numeric 0 1

ctx_lh_fusiform

Description :

left fusiform ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_fusiform.imaging_noddi_odi numeric 0 1

ctx_lh_inferiorparietal

Description :

left inferiorparietal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiorparietal.imaging_noddi_odi numeric 0 1

ctx_lh_inferiortemporal

Description :

left inferiortemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiortemporal.imaging_noddi_odi numeric 0 1

ctx_lh_insula

Description :

left insula ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_insula.imaging_noddi_odi numeric 0 1

ctx_lh_isthmuscingulate

Description :

left isthmuscingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_isthmuscingulate.imaging_noddi_odi numeric 0 1

ctx_lh_lateraloccipital

Description :

left lateraloccipital ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateraloccipital.imaging_noddi_odi numeric 0 1

ctx_lh_lateralorbitofrontal

Description :

left lateralorbitofrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateralorbitofrontal.imaging_noddi_odi numeric 0 1

ctx_lh_lingual

Description :

left lingual ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lingual.imaging_noddi_odi numeric 0 1

ctx_lh_medialorbitofrontal

Description :

left medialorbitofrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_medialorbitofrontal.imaging_noddi_odi numeric 0 1

ctx_lh_middletemporal

Description :

left middletemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_middletemporal.imaging_noddi_odi numeric 0 1

ctx_lh_paracentral

Description :

left paracentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_paracentral.imaging_noddi_odi numeric 0 1

ctx_lh_parahippocampal

Description :

left parahippocampal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parahippocampal.imaging_noddi_odi numeric 0 1

ctx_lh_parsopercularis

Description :

left parsopercularis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsopercularis.imaging_noddi_odi numeric 0 1

ctx_lh_parsorbitalis

Description :

left parsorbitalis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsorbitalis.imaging_noddi_odi numeric 0 1

ctx_lh_parstriangularis

Description :

left parstriangularis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parstriangularis.imaging_noddi_odi numeric 0 1

ctx_lh_pericalcarine

Description :

left pericalcarine ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_pericalcarine.imaging_noddi_odi numeric 0 1

ctx_lh_postcentral

Description :

left postcentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_postcentral.imaging_noddi_odi numeric 0 1

ctx_lh_posteriorcingulate

Description :

left posteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_posteriorcingulate.imaging_noddi_odi numeric 0 1

ctx_lh_precentral

Description :

left precentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precentral.imaging_noddi_odi numeric 0 1

ctx_lh_precuneus

Description :

left precuneus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precuneus.imaging_noddi_odi numeric 0 1

ctx_lh_rostralanteriorcingulate

Description :

left rostralanteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralanteriorcingulate.imaging_noddi_odi numeric 0 1

ctx_lh_rostralmiddlefrontal

Description :

left rostralmiddlefrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralmiddlefrontal.imaging_noddi_odi numeric 0 1

ctx_lh_superiorfrontal

Description :

left superiorfrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorfrontal.imaging_noddi_odi numeric 0 1

ctx_lh_superiorparietal

Description :

left superiorparietal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorparietal.imaging_noddi_odi numeric 0 1

ctx_lh_superiortemporal

Description :

left superiortemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiortemporal.imaging_noddi_odi numeric 0 1

ctx_lh_supramarginal

Description :

left supramarginal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_supramarginal.imaging_noddi_odi numeric 0 1

ctx_lh_temporalpole

Description :

left temporalpole ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_temporalpole.imaging_noddi_odi numeric 0 1

ctx_lh_transversetemporal

Description :

left transversetemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_transversetemporal.imaging_noddi_odi numeric 0 1

ctx_lh_unknown

Description :

left unknown ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_unknown.imaging_noddi_odi numeric 0 1

ctx_rh_bankssts

Description :

right bankssts ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_bankssts.imaging_noddi_odi numeric 0 1

ctx_rh_caudalanteriorcingulate

Description :

right caudalanteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalanteriorcingulate.imaging_noddi_odi numeric 0 1

ctx_rh_caudalmiddlefrontal

Description :

right caudalmiddlefrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalmiddlefrontal.imaging_noddi_odi numeric 0 1

ctx_rh_cuneus

Description :

right cuneus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_cuneus.imaging_noddi_odi numeric 0 1

ctx_rh_entorhinal

Description :

right entorhinal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_entorhinal.imaging_noddi_odi numeric 0 1

ctx_rh_frontalpole

Description :

right frontalpole ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_frontalpole.imaging_noddi_odi numeric 0 1

ctx_rh_fusiform

Description :

right fusiform ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_fusiform.imaging_noddi_odi numeric 0 1

ctx_rh_inferiorparietal

Description :

right inferiorparietal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiorparietal.imaging_noddi_odi numeric 0 1

ctx_rh_inferiortemporal

Description :

right inferiortemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiortemporal.imaging_noddi_odi numeric 0 1

ctx_rh_insula

Description :

right insula ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_insula.imaging_noddi_odi numeric 0 1

ctx_rh_isthmuscingulate

Description :

right isthmuscingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_isthmuscingulate.imaging_noddi_odi numeric 0 1

ctx_rh_lateraloccipital

Description :

right lateraloccipital ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateraloccipital.imaging_noddi_odi numeric 0 1

ctx_rh_lateralorbitofrontal

Description :

right lateralorbitofrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateralorbitofrontal.imaging_noddi_odi numeric 0 1

ctx_rh_lingual

Description :

right lingual ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lingual.imaging_noddi_odi numeric 0 1

ctx_rh_medialorbitofrontal

Description :

right medialorbitofrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_medialorbitofrontal.imaging_noddi_odi numeric 0 1

ctx_rh_middletemporal

Description :

right middletemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_middletemporal.imaging_noddi_odi numeric 0 1

ctx_rh_paracentral

Description :

right paracentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_paracentral.imaging_noddi_odi numeric 0 1

ctx_rh_parahippocampal

Description :

right parahippocampal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parahippocampal.imaging_noddi_odi numeric 0 1

ctx_rh_parsopercularis

Description :

right parsopercularis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsopercularis.imaging_noddi_odi numeric 0 1

ctx_rh_parsorbitalis

Description :

right parsorbitalis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsorbitalis.imaging_noddi_odi numeric 0 1

ctx_rh_parstriangularis

Description :

right parstriangularis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parstriangularis.imaging_noddi_odi numeric 0 1

ctx_rh_pericalcarine

Description :

right pericalcarine ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_pericalcarine.imaging_noddi_odi numeric 0 1

ctx_rh_postcentral

Description :

right postcentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_postcentral.imaging_noddi_odi numeric 0 1

ctx_rh_posteriorcingulate

Description :

right posteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_posteriorcingulate.imaging_noddi_odi numeric 0 1

ctx_rh_precentral

Description :

right precentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precentral.imaging_noddi_odi numeric 0 1

ctx_rh_precuneus

Description :

right precuneus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precuneus.imaging_noddi_odi numeric 0 1

ctx_rh_rostralanteriorcingulate

Description :

right rostralanteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralanteriorcingulate.imaging_noddi_odi numeric 0 1

ctx_rh_rostralmiddlefrontal

Description :

right rostralmiddlefrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralmiddlefrontal.imaging_noddi_odi numeric 0 1

ctx_rh_superiorfrontal

Description :

right superiorfrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorfrontal.imaging_noddi_odi numeric 0 1

ctx_rh_superiorparietal

Description :

right superiorparietal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorparietal.imaging_noddi_odi numeric 0 1

ctx_rh_superiortemporal

Description :

right superiortemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiortemporal.imaging_noddi_odi numeric 0 1

ctx_rh_supramarginal

Description :

right supramarginal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_supramarginal.imaging_noddi_odi numeric 0 1

ctx_rh_temporalpole

Description :

right temporalpole ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_temporalpole.imaging_noddi_odi numeric 0 1

ctx_rh_transversetemporal

Description :

right transversetemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_transversetemporal.imaging_noddi_odi numeric 0 1

ctx_rh_unknown

Description :

right unknown ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_unknown.imaging_noddi_odi numeric 0 1

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_noddi_odi numeric 0 infinity

frontal_composite

Description :

frontal composite

Variable Name Type Min Possible Max Possible
frontal_composite.imaging_noddi_odi numeric 0 1

gm

Description :

global grey matter volume (mm^3)

Variable Name Type Min Possible Max Possible
gm.imaging_noddi_odi numeric 0 infinity

label

Description :

Calculation of ODI in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_noddi_odi Mean character

left_accumbens_area

Description :

left accumbens area ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_accumbens_area.imaging_noddi_odi numeric 0 1

left_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_six_composite.imaging_noddi_odi numeric 0.5017342 0.6957600

left_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_ten_composite.imaging_noddi_odi numeric 0.5116984 0.6690579

left_amygdala

Description :

left amygdala ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_amygdala.imaging_noddi_odi numeric 0 1

left_caudate

Description :

left caudate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_caudate.imaging_noddi_odi numeric 0 1

left_cerebellum_cortex

Description :

left cerebellum cortex ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_cortex.imaging_noddi_odi numeric 0 1

left_cerebellum_white_matter

Description :

left cerebellum white matter ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_white_matter.imaging_noddi_odi numeric 0 1

left_choroid_plexus

Description :

left choroid plexus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_choroid_plexus.imaging_noddi_odi numeric 0 1

left_frontal_composite

Variable Name Type Min Possible Max Possible
left_frontal_composite.imaging_noddi_odi numeric 0.4978984 0.7251463

left_hippocampus

Description :

left hippocampus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_hippocampus.imaging_noddi_odi numeric 0 1

left_inf_lat_vent

Description :

left inf lat vent ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_inf_lat_vent.imaging_noddi_odi numeric 0 1

left_lateral_ventricle

Description :

left lateral ventricle ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_lateral_ventricle.imaging_noddi_odi numeric 0 1

left_medial_temporal_composite

Variable Name Type Min Possible Max Possible
left_medial_temporal_composite.imaging_noddi_odi numeric 0.5604377 0.7650453

left_occipital_composite

Variable Name Type Min Possible Max Possible
left_occipital_composite.imaging_noddi_odi numeric 0.5106432 0.6527217

left_pallidum

Description :

left pallidum ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_pallidum.imaging_noddi_odi numeric 0 1

left_parietal_composite

Variable Name Type Min Possible Max Possible
left_parietal_composite.imaging_noddi_odi numeric 0.4797904 0.6032680

left_putamen

Description :

left putamen ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_putamen.imaging_noddi_odi numeric 0 1

left_temporal_composite

Variable Name Type Min Possible Max Possible
left_temporal_composite.imaging_noddi_odi numeric 0.5279805 0.6823442

left_thalamus_proper

Description :

left thalamus proper ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_thalamus_proper.imaging_noddi_odi numeric 0 1

left_unsegmented_white_matter

Description :

left unsegmented white matter ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_unsegmented_white_matter.imaging_noddi_odi numeric 0 1

left_ventral_dc

Description :

left ventral dc ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_ventral_dc.imaging_noddi_odi numeric 0 1

left_vessel

Description :

left vessel ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_vessel.imaging_noddi_odi numeric 0 1

medial_temporal_composite

Description :

medial temporal composite

Variable Name Type Min Possible Max Possible
medial_temporal_composite.imaging_noddi_odi numeric 0 1

occipital_composite

Description :

occipital composite

Variable Name Type Min Possible Max Possible
occipital_composite.imaging_noddi_odi numeric 0 1

optic_chiasm

Description :

optic chiasm ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
optic_chiasm.imaging_noddi_odi numeric 0 1

parietal_composite

Description :

parietal composite

Variable Name Type Min Possible Max Possible
parietal_composite.imaging_noddi_odi numeric 0 1

right_accumbens_area

Description :

right accumbens area ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_accumbens_area.imaging_noddi_odi numeric 0 1

right_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_six_composite.imaging_noddi_odi numeric 0.5384152 0.7193815

right_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_ten_composite.imaging_noddi_odi numeric 0.5355784 0.6875598

right_amygdala

Description :

right amygdala ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_amygdala.imaging_noddi_odi numeric 0 1

right_caudate

Description :

right caudate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_caudate.imaging_noddi_odi numeric 0 1

right_cerebellum_cortex

Description :

right cerebellum cortex ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_cortex.imaging_noddi_odi numeric 0 1

right_cerebellum_white_matter

Description :

right cerebellum white matter ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_white_matter.imaging_noddi_odi numeric 0 1

right_choroid_plexus

Description :

right choroid plexus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_choroid_plexus.imaging_noddi_odi numeric 0 1

right_frontal_composite

Variable Name Type Min Possible Max Possible
right_frontal_composite.imaging_noddi_odi numeric 0.4878051 0.7193713

right_hippocampus

Description :

right hippocampus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_hippocampus.imaging_noddi_odi numeric 0 1

right_inf_lat_vent

Description :

right inf lat vent ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_inf_lat_vent.imaging_noddi_odi numeric 0 1

right_lateral_ventricle

Description :

right lateral ventricle ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_lateral_ventricle.imaging_noddi_odi numeric 0 1

right_medial_temporal_composite

Variable Name Type Min Possible Max Possible
right_medial_temporal_composite.imaging_noddi_odi numeric 0.5675093 0.7628787

right_occipital_composite

Variable Name Type Min Possible Max Possible
right_occipital_composite.imaging_noddi_odi numeric 0.4840530 0.6685028

right_pallidum

Description :

right pallidum ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_pallidum.imaging_noddi_odi numeric 0 1

right_parietal_composite

Variable Name Type Min Possible Max Possible
right_parietal_composite.imaging_noddi_odi numeric 0.5051765 0.6119965

right_putamen

Description :

right putamen ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_putamen.imaging_noddi_odi numeric 0 1

right_temporal_composite

Variable Name Type Min Possible Max Possible
right_temporal_composite.imaging_noddi_odi numeric 0.5383616 0.6977409

right_thalamus_proper

Description :

right thalamus proper ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_thalamus_proper.imaging_noddi_odi numeric 0 1

right_unsegmented_white_matter

Description :

right unsegmented white matter ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_unsegmented_white_matter.imaging_noddi_odi numeric 0 1

right_ventral_dc

Description :

right ventral dc ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_ventral_dc.imaging_noddi_odi numeric 0 1

right_vessel

Description :

right vessel ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_vessel.imaging_noddi_odi numeric 0 1

temporal_composite

Description :

temporal composite

Variable Name Type Min Possible Max Possible
temporal_composite.imaging_noddi_odi numeric 0 1

tiv

Description :

global total intracranial volume (mm^3)

Variable Name Type Min Possible Max Possible
tiv.imaging_noddi_odi numeric 0 infinity

wm_hypointensities

Description :

white matter hypointensities ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_hypointensities.imaging_noddi_odi numeric 0 1

wm_lh_bankssts

Description :

white matter left bankssts ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_bankssts.imaging_noddi_odi numeric 0 1

wm_lh_caudalanteriorcingulate

Description :

white matter left caudalanteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalanteriorcingulate.imaging_noddi_odi numeric 0 1

wm_lh_caudalmiddlefrontal

Description :

white matter left caudalmiddlefrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalmiddlefrontal.imaging_noddi_odi numeric 0 1

wm_lh_cuneus

Description :

white matter left cuneus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_cuneus.imaging_noddi_odi numeric 0 1

wm_lh_entorhinal

Description :

white matter left entorhinal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_entorhinal.imaging_noddi_odi numeric 0 1

wm_lh_frontalpole

Description :

white matter left frontalpole ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_frontalpole.imaging_noddi_odi numeric 0 1

wm_lh_fusiform

Description :

white matter left fusiform ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_fusiform.imaging_noddi_odi numeric 0 1

wm_lh_inferiorparietal

Description :

white matter left inferiorparietal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiorparietal.imaging_noddi_odi numeric 0 1

wm_lh_inferiortemporal

Description :

white matter left inferiortemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiortemporal.imaging_noddi_odi numeric 0 1

wm_lh_insula

Description :

white matter left insula ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_insula.imaging_noddi_odi numeric 0 1

wm_lh_isthmuscingulate

Description :

white matter left isthmuscingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_isthmuscingulate.imaging_noddi_odi numeric 0 1

wm_lh_lateraloccipital

Description :

white matter left lateraloccipital ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateraloccipital.imaging_noddi_odi numeric 0 1

wm_lh_lateralorbitofrontal

Description :

white matter left lateralorbitofrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateralorbitofrontal.imaging_noddi_odi numeric 0 1

wm_lh_lingual

Description :

white matter left lingual ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lingual.imaging_noddi_odi numeric 0 1

wm_lh_medialorbitofrontal

Description :

white matter left medialorbitofrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_medialorbitofrontal.imaging_noddi_odi numeric 0 1

wm_lh_middletemporal

Description :

white matter left middletemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_middletemporal.imaging_noddi_odi numeric 0 1

wm_lh_paracentral

Description :

white matter left paracentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_paracentral.imaging_noddi_odi numeric 0 1

wm_lh_parahippocampal

Description :

white matter left parahippocampal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parahippocampal.imaging_noddi_odi numeric 0 1

wm_lh_parsopercularis

Description :

white matter left parsopercularis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsopercularis.imaging_noddi_odi numeric 0 1

wm_lh_parsorbitalis

Description :

white matter left parsorbitalis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsorbitalis.imaging_noddi_odi numeric 0 1

wm_lh_parstriangularis

Description :

white matter left parstriangularis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parstriangularis.imaging_noddi_odi numeric 0 1

wm_lh_pericalcarine

Description :

white matter left pericalcarine ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_pericalcarine.imaging_noddi_odi numeric 0 1

wm_lh_postcentral

Description :

white matter left postcentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_postcentral.imaging_noddi_odi numeric 0 1

wm_lh_posteriorcingulate

Description :

white matter left posteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_posteriorcingulate.imaging_noddi_odi numeric 0 1

wm_lh_precentral

Description :

white matter left precentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precentral.imaging_noddi_odi numeric 0 1

wm_lh_precuneus

Description :

white matter left precuneus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precuneus.imaging_noddi_odi numeric 0 1

wm_lh_rostralanteriorcingulate

Description :

white matter left rostralanteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralanteriorcingulate.imaging_noddi_odi numeric 0 1

wm_lh_rostralmiddlefrontal

Description :

white matter left rostralmiddlefrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralmiddlefrontal.imaging_noddi_odi numeric 0 1

wm_lh_superiorfrontal

Description :

white matter left superiorfrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorfrontal.imaging_noddi_odi numeric 0 1

wm_lh_superiorparietal

Description :

white matter left superiorparietal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorparietal.imaging_noddi_odi numeric 0 1

wm_lh_superiortemporal

Description :

white matter left superiortemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiortemporal.imaging_noddi_odi numeric 0 1

wm_lh_supramarginal

Description :

white matter left supramarginal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_supramarginal.imaging_noddi_odi numeric 0 1

wm_lh_temporalpole

Description :

white matter left temporalpole ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_temporalpole.imaging_noddi_odi numeric 0 1

wm_lh_transversetemporal

Description :

white matter left transversetemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_transversetemporal.imaging_noddi_odi numeric 0 1

wm_rh_bankssts

Description :

white matter right bankssts ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_bankssts.imaging_noddi_odi numeric 0 1

wm_rh_caudalanteriorcingulate

Description :

white matter right caudalanteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalanteriorcingulate.imaging_noddi_odi numeric 0 1

wm_rh_caudalmiddlefrontal

Description :

white matter right caudalmiddlefrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalmiddlefrontal.imaging_noddi_odi numeric 0 1

wm_rh_cuneus

Description :

white matter right cuneus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_cuneus.imaging_noddi_odi numeric 0 1

wm_rh_entorhinal

Description :

white matter right entorhinal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_entorhinal.imaging_noddi_odi numeric 0 1

wm_rh_frontalpole

Description :

white matter right frontalpole ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_frontalpole.imaging_noddi_odi numeric 0 1

wm_rh_fusiform

Description :

white matter right fusiform ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_fusiform.imaging_noddi_odi numeric 0 1

wm_rh_inferiorparietal

Description :

white matter right inferiorparietal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiorparietal.imaging_noddi_odi numeric 0 1

wm_rh_inferiortemporal

Description :

white matter right inferiortemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiortemporal.imaging_noddi_odi numeric 0 1

wm_rh_insula

Description :

white matter right insula ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_insula.imaging_noddi_odi numeric 0 1

wm_rh_isthmuscingulate

Description :

white matter right isthmuscingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_isthmuscingulate.imaging_noddi_odi numeric 0 1

wm_rh_lateraloccipital

Description :

white matter right lateraloccipital ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateraloccipital.imaging_noddi_odi numeric 0 1

wm_rh_lateralorbitofrontal

Description :

white matter right lateralorbitofrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateralorbitofrontal.imaging_noddi_odi numeric 0 1

wm_rh_lingual

Description :

white matter right lingual ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lingual.imaging_noddi_odi numeric 0 1

wm_rh_medialorbitofrontal

Description :

white matter right medialorbitofrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_medialorbitofrontal.imaging_noddi_odi numeric 0 1

wm_rh_middletemporal

Description :

white matter right middletemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_middletemporal.imaging_noddi_odi numeric 0 1

wm_rh_paracentral

Description :

white matter right paracentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_paracentral.imaging_noddi_odi numeric 0 1

wm_rh_parahippocampal

Description :

white matter right parahippocampal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parahippocampal.imaging_noddi_odi numeric 0 1

wm_rh_parsopercularis

Description :

white matter right parsopercularis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsopercularis.imaging_noddi_odi numeric 0 1

wm_rh_parsorbitalis

Description :

white matter right parsorbitalis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsorbitalis.imaging_noddi_odi numeric 0 1

wm_rh_parstriangularis

Description :

white matter right parstriangularis ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parstriangularis.imaging_noddi_odi numeric 0 1

wm_rh_pericalcarine

Description :

white matter right pericalcarine ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_pericalcarine.imaging_noddi_odi numeric 0 1

wm_rh_postcentral

Description :

white matter right postcentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_postcentral.imaging_noddi_odi numeric 0 1

wm_rh_posteriorcingulate

Description :

white matter right posteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_posteriorcingulate.imaging_noddi_odi numeric 0 1

wm_rh_precentral

Description :

white matter right precentral ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precentral.imaging_noddi_odi numeric 0 1

wm_rh_precuneus

Description :

white matter right precuneus ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precuneus.imaging_noddi_odi numeric 0 1

wm_rh_rostralanteriorcingulate

Description :

white matter right rostralanteriorcingulate ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralanteriorcingulate.imaging_noddi_odi numeric 0 1

wm_rh_rostralmiddlefrontal

Description :

white matter right rostralmiddlefrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralmiddlefrontal.imaging_noddi_odi numeric 0 1

wm_rh_superiorfrontal

Description :

white matter right superiorfrontal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorfrontal.imaging_noddi_odi numeric 0 1

wm_rh_superiorparietal

Description :

white matter right superiorparietal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorparietal.imaging_noddi_odi numeric 0 1

wm_rh_superiortemporal

Description :

white matter right superiortemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiortemporal.imaging_noddi_odi numeric 0 1

wm_rh_supramarginal

Description :

white matter right supramarginal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_supramarginal.imaging_noddi_odi numeric 0 1

wm_rh_temporalpole

Description :

white matter right temporalpole ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_temporalpole.imaging_noddi_odi numeric 0 1

wm_rh_transversetemporal

Description :

white matter right transversetemporal ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_transversetemporal.imaging_noddi_odi numeric 0 1

wm

Description :

global white matter volume (mm^3)

Variable Name Type Min Possible Max Possible
wm.imaging_noddi_odi numeric 0 infinity

x3rd_ventricle

Description :

3rd ventricle ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
x3rd_ventricle.imaging_noddi_odi numeric 0 1

x4th_ventricle

Description :

4th ventricle ODI value (Deskian ROI)

Variable Name Type Min Possible Max Possible
x4th_ventricle.imaging_noddi_odi numeric 0 1

imaging_pasl

Description :

PASL, or pulsed pseudocontinuous arterial spin labeling, is an MRI sequence used to non-invasively measure cerebral blood flow (CBF). Values in this sheet represent CBF in raw units of mL/100g tissues/min

References :

  • Dolui, S., Vidorreta, M., Wang, Z., Nasrallah, I. M., Alavi, A., Wolk, D. A., & Detre, J. A. (2017). Comparison of PASL, PCASL, and background‐suppressed 3D PCASL in mild cognitive impairment. Human brain mapping, 38(10), 5260-5273.

  • van Osch, M. J. P., Hendrikse, J., & van der Grond, J. (2006). Sensitivity comparison of multiple vs. single inversion time pulsed arterial spin labeling fmri. Journal of Magnetic Resonance Imaging, 25(1), 215–221. https://doi.org/10.1002/jmri.20823


ad_meta_six_composite

Description :

ad meta six composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
ad_meta_six_composite.imaging_pasl numeric 0 42.905092

ad_meta_ten_composite

Description :

ad meta ten composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
ad_meta_ten_composite.imaging_pasl numeric 0 41.026320

brain_stem

Description :

brainstem CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
brain_stem.imaging_pasl numeric 0 5.838820

cbf

Description :

whole brain CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
cbf.imaging_pasl numeric 0 48.597288

cc_anterior

Description :

anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_anterior.imaging_pasl numeric 0 -0.34388400

cc_central

Description :

central corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_central.imaging_pasl numeric 0 -1.07872000

cc_mid_anterior

Description :

mid anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_mid_anterior.imaging_pasl numeric 0 -9.82317e-02

cc_mid_posterior

Description :

mid posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_mid_posterior.imaging_pasl numeric 0 10.2442000

cc_posterior

Description :

posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_posterior.imaging_pasl numeric 0 -1.419870000

csf

Description :

csf CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
csf.imaging_pasl numeric 0 26.611700

ctx_lh_bankssts

Description :

left banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_bankssts.imaging_pasl numeric 0 96.08980

ctx_lh_caudalanteriorcingulate

Description :

left caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalanteriorcingulate.imaging_pasl numeric 0 33.772300

ctx_lh_caudalmiddlefrontal

Description :

left caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalmiddlefrontal.imaging_pasl numeric 0 36.34160

ctx_lh_cuneus

Description :

left cuneus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_cuneus.imaging_pasl numeric 0 64.97480

ctx_lh_entorhinal

Description :

left entorhinal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_entorhinal.imaging_pasl numeric 0 55.218200

ctx_lh_frontalpole

Description :

left frontalpole CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_frontalpole.imaging_pasl numeric 0 -15.842900

ctx_lh_fusiform

Description :

left fusiform CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_fusiform.imaging_pasl numeric 0 47.00600

ctx_lh_inferiorparietal

Description :

left inferiorparietal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiorparietal.imaging_pasl numeric 0 45.894900

ctx_lh_inferiortemporal

Description :

left inferiortemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiortemporal.imaging_pasl numeric 0 46.03040000

ctx_lh_insula

Description :

left insula CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_insula.imaging_pasl numeric 0 49.18260

ctx_lh_isthmuscingulate

Description :

left isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_isthmuscingulate.imaging_pasl numeric 0 61.85910

ctx_lh_lateraloccipital

Description :

left lateraloccipital CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateraloccipital.imaging_pasl numeric 0 64.02000

ctx_lh_lateralorbitofrontal

Description :

left lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateralorbitofrontal.imaging_pasl numeric 0 -25.1460000

ctx_lh_lingual

Description :

left lingual CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lingual.imaging_pasl numeric 0 70.56480

ctx_lh_medialorbitofrontal

Description :

left medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_medialorbitofrontal.imaging_pasl numeric 0 -21.63080

ctx_lh_middletemporal

Description :

left middletemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_middletemporal.imaging_pasl numeric 0 50.314700

ctx_lh_paracentral

Description :

left paracentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_paracentral.imaging_pasl numeric 0 47.473400

ctx_lh_parahippocampal

Description :

left parahippocampal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parahippocampal.imaging_pasl numeric 0 62.15120

ctx_lh_parsopercularis

Description :

left parsopercularis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsopercularis.imaging_pasl numeric 0 50.13850

ctx_lh_parsorbitalis

Description :

left parsorbitalis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsorbitalis.imaging_pasl numeric 0 -15.071500

ctx_lh_parstriangularis

Description :

left parstriangularis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parstriangularis.imaging_pasl numeric 0 48.83140

ctx_lh_pericalcarine

Description :

left pericalcarine CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_pericalcarine.imaging_pasl numeric 0 66.84170

ctx_lh_postcentral

Description :

left postcentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_postcentral.imaging_pasl numeric 0 40.07190

ctx_lh_posteriorcingulate

Description :

left posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_posteriorcingulate.imaging_pasl numeric 0 62.371700

ctx_lh_precentral

Description :

left precentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precentral.imaging_pasl numeric 0 37.26010

ctx_lh_precuneus

Description :

left precuneus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precuneus.imaging_pasl numeric 0 50.5834000

ctx_lh_rostralanteriorcingulate

Description :

left rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralanteriorcingulate.imaging_pasl numeric 0 36.757800

ctx_lh_rostralmiddlefrontal

Description :

left rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralmiddlefrontal.imaging_pasl numeric 0 36.38880

ctx_lh_superiorfrontal

Description :

left superiorfrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorfrontal.imaging_pasl numeric 0 31.87120

ctx_lh_superiorparietal

Description :

left superiorparietal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorparietal.imaging_pasl numeric 0 33.678600

ctx_lh_superiortemporal

Description :

left superiortemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiortemporal.imaging_pasl numeric 0 58.68570

ctx_lh_supramarginal

Description :

left supramarginal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_supramarginal.imaging_pasl numeric 0 67.10780

ctx_lh_temporalpole

Description :

left temporalpole CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_temporalpole.imaging_pasl numeric 0 -42.085400

ctx_lh_transversetemporal

Description :

left transversetemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_transversetemporal.imaging_pasl numeric 0 66.95150

ctx_lh_unknown

Description :

left unknown CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_unknown.imaging_pasl numeric 0 34.025700

ctx_rh_bankssts

Description :

right banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_bankssts.imaging_pasl numeric 0 77.46440

ctx_rh_caudalanteriorcingulate

Description :

right caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalanteriorcingulate.imaging_pasl numeric 0 67.18200

ctx_rh_caudalmiddlefrontal

Description :

right caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalmiddlefrontal.imaging_pasl numeric 0 33.580500

ctx_rh_cuneus

Description :

right cuneus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_cuneus.imaging_pasl numeric 0 64.531600

ctx_rh_entorhinal

Description :

right entorhinal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_entorhinal.imaging_pasl numeric 0 -22.7758000

ctx_rh_frontalpole

Description :

right frontalpole CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_frontalpole.imaging_pasl numeric 0 -41.6373000

ctx_rh_fusiform

Description :

right fusiform CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_fusiform.imaging_pasl numeric 0 47.688100

ctx_rh_inferiorparietal

Description :

right inferiorparietal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiorparietal.imaging_pasl numeric 0 51.804300

ctx_rh_inferiortemporal

Description :

right inferiortemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiortemporal.imaging_pasl numeric 0 42.0412000

ctx_rh_insula

Description :

right insula CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_insula.imaging_pasl numeric 0 62.14270

ctx_rh_isthmuscingulate

Description :

right isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_isthmuscingulate.imaging_pasl numeric 0 67.46070

ctx_rh_lateraloccipital

Description :

right lateraloccipital CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateraloccipital.imaging_pasl numeric 0 52.461400

ctx_rh_lateralorbitofrontal

Description :

right lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateralorbitofrontal.imaging_pasl numeric 0 -22.34480

ctx_rh_lingual

Description :

right lingual CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lingual.imaging_pasl numeric 0 61.6776

ctx_rh_medialorbitofrontal

Description :

right medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_medialorbitofrontal.imaging_pasl numeric 0 -18.0972000

ctx_rh_middletemporal

Description :

right middletemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_middletemporal.imaging_pasl numeric 0 58.4179000

ctx_rh_paracentral

Description :

right paracentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_paracentral.imaging_pasl numeric 0 51.56490

ctx_rh_parahippocampal

Description :

right parahippocampal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parahippocampal.imaging_pasl numeric 0 64.62400

ctx_rh_parsopercularis

Description :

right parsopercularis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsopercularis.imaging_pasl numeric 0 60.06110

ctx_rh_parsorbitalis

Description :

right parsorbitalis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsorbitalis.imaging_pasl numeric 0 -10.820600

ctx_rh_parstriangularis

Description :

right parstriangularis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parstriangularis.imaging_pasl numeric 0 61.84620

ctx_rh_pericalcarine

Description :

right pericalcarine CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_pericalcarine.imaging_pasl numeric 0 70.60640

ctx_rh_postcentral

Description :

right postcentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_postcentral.imaging_pasl numeric 0 39.06360

ctx_rh_posteriorcingulate

Description :

right posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_posteriorcingulate.imaging_pasl numeric 0 112.12600

ctx_rh_precentral

Description :

right precentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precentral.imaging_pasl numeric 0 39.40180

ctx_rh_precuneus

Description :

right precuneus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precuneus.imaging_pasl numeric 0 52.44960

ctx_rh_rostralanteriorcingulate

Description :

right rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralanteriorcingulate.imaging_pasl numeric 0 -21.93730

ctx_rh_rostralmiddlefrontal

Description :

right rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralmiddlefrontal.imaging_pasl numeric 0 35.3218000

ctx_rh_superiorfrontal

Description :

right superiorfrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorfrontal.imaging_pasl numeric 0 38.76000

ctx_rh_superiorparietal

Description :

right superiorparietal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorparietal.imaging_pasl numeric 0 31.831100

ctx_rh_superiortemporal

Description :

right superiortemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiortemporal.imaging_pasl numeric 0 75.75780

ctx_rh_supramarginal

Description :

right supramarginal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_supramarginal.imaging_pasl numeric 0 58.54960

ctx_rh_temporalpole

Description :

right temporalpole CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_temporalpole.imaging_pasl numeric 0 -28.388600

ctx_rh_transversetemporal

Description :

right transversetemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_transversetemporal.imaging_pasl numeric 0 87.1071

ctx_rh_unknown

Description :

right unknown CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_unknown.imaging_pasl numeric 0 45.786800

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_pasl numeric 0 infinity

frontal_composite

Description :

frontal composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
frontal_composite.imaging_pasl numeric 0 36.435655

gm

Description :

global grey matter volume (mm3)

Variable Name Type Min Possible Max Possible
gm.imaging_pasl numeric 0 infinity

label

Description :

Calculation of CBF in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_pasl Mean character

left_accumbens_area

Description :

left accumbens area CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_accumbens_area.imaging_pasl numeric 0 46.98080

left_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_six_composite.imaging_pasl numeric 4.7904724 47.5018000

left_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_ten_composite.imaging_pasl numeric 5.798903 41.755200

left_amygdala

Description :

left amygdala CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_amygdala.imaging_pasl numeric 0 51.67600

left_caudate

Description :

left caudate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_caudate.imaging_pasl numeric 0 31.72720

left_cerebellum_cortex

Description :

left cerebellum cortex CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_cortex.imaging_pasl numeric 0 47.25200

left_cerebellum_white_matter

Description :

left cerebellum white matter CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_white_matter.imaging_pasl numeric 0 12.40110000

left_choroid_plexus

Description :

left choroid plexus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_choroid_plexus.imaging_pasl numeric 0 17.783600

left_frontal_composite

Variable Name Type Min Possible Max Possible
left_frontal_composite.imaging_pasl numeric 3.044970 37.126320

left_hippocampus

Description :

left hippocampus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_hippocampus.imaging_pasl numeric 0 49.95020

left_inf_lat_vent

Description :

left inf lat vent CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_inf_lat_vent.imaging_pasl numeric 0 32.701100

left_lateral_ventricle

Description :

left lateral ventricle CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_lateral_ventricle.imaging_pasl numeric 0 5.6376700

left_medial_temporal_composite

Variable Name Type Min Possible Max Possible
left_medial_temporal_composite.imaging_pasl numeric 2.539067 45.596400

left_occipital_composite

Variable Name Type Min Possible Max Possible
left_occipital_composite.imaging_pasl numeric 8.09869 53.71102

left_pallidum

Description :

left pallidum CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_pallidum.imaging_pasl numeric 0 7.666590

left_parietal_composite

Variable Name Type Min Possible Max Possible
left_parietal_composite.imaging_pasl numeric 5.143659 41.692340

left_putamen

Description :

left putamen CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_putamen.imaging_pasl numeric 0 45.5755

left_temporal_composite

Variable Name Type Min Possible Max Possible
left_temporal_composite.imaging_pasl numeric 6.100476 45.025036

left_thalamus_proper

Description :

left thalamus proper CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_thalamus_proper.imaging_pasl numeric 0 35.39800

left_unsegmented_white_matter

Description :

left unsegmented white matter CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_unsegmented_white_matter.imaging_pasl numeric 0 -0.1604700

left_ventral_dc

Description :

left ventral dc CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_ventral_dc.imaging_pasl numeric 0 14.311000

left_vessel

Description :

left vessel CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_vessel.imaging_pasl numeric 0 52.05920

medial_temporal_composite

Description :

medial temporal composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
medial_temporal_composite.imaging_pasl numeric 0 44.674817

occipital_composite

Description :

occipital composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
occipital_composite.imaging_pasl numeric 0 53.71102

optic_chiasm

Description :

optic chiasm CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
optic_chiasm.imaging_pasl numeric 0 19.48280000

parietal_composite

Description :

parietal composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
parietal_composite.imaging_pasl numeric 0 41.876280

right_accumbens_area

Description :

right accumbens area CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_accumbens_area.imaging_pasl numeric 0 -13.87700

right_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_six_composite.imaging_pasl numeric 1.579717 48.657500

right_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_ten_composite.imaging_pasl numeric 1.807209 44.149230

right_amygdala

Description :

right amygdala CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_amygdala.imaging_pasl numeric 0 60.72200

right_caudate

Description :

right caudate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_caudate.imaging_pasl numeric 0 31.59500

right_cerebellum_cortex

Description :

right cerebellum cortex CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_cortex.imaging_pasl numeric 0 48.32400

right_cerebellum_white_matter

Description :

right cerebellum white matter CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_white_matter.imaging_pasl numeric 0 10.0875000

right_choroid_plexus

Description :

right choroid plexus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_choroid_plexus.imaging_pasl numeric 0 20.07650

right_frontal_composite

Variable Name Type Min Possible Max Possible
right_frontal_composite.imaging_pasl numeric 3.546092 38.628910

right_hippocampus

Description :

right hippocampus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_hippocampus.imaging_pasl numeric 0 55.71020

right_inf_lat_vent

Description :

right inf lat vent CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_inf_lat_vent.imaging_pasl numeric 0 34.207700

right_lateral_ventricle

Description :

right lateral ventricle CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_lateral_ventricle.imaging_pasl numeric 0 3.8153000

right_medial_temporal_composite

Variable Name Type Min Possible Max Possible
right_medial_temporal_composite.imaging_pasl numeric 2.834333 47.991533

right_occipital_composite

Variable Name Type Min Possible Max Possible
right_occipital_composite.imaging_pasl numeric 10.34520 54.98035

right_pallidum

Description :

right pallidum CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_pallidum.imaging_pasl numeric 0 3.162990

right_parietal_composite

Variable Name Type Min Possible Max Possible
right_parietal_composite.imaging_pasl numeric 7.457093 42.538450

right_putamen

Description :

right putamen CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_putamen.imaging_pasl numeric 0 46.14060

right_temporal_composite

Variable Name Type Min Possible Max Possible
right_temporal_composite.imaging_pasl numeric 3.200217 49.025009

right_thalamus_proper

Description :

right thalamus proper CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_thalamus_proper.imaging_pasl numeric 0 39.32210

right_unsegmented_white_matter

Description :

right unsegmented white matter CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_unsegmented_white_matter.imaging_pasl numeric 0 -0.0367542

right_ventral_dc

Description :

right ventral dc CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_ventral_dc.imaging_pasl numeric 0 17.99840

right_vessel

Description :

right vessel CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_vessel.imaging_pasl numeric 0 51.976500

temporal_composite

Description :

temporal composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
temporal_composite.imaging_pasl numeric 0 47.025023

tiv

Description :

global total intracranial volume (mm3)

Variable Name Type Min Possible Max Possible
tiv.imaging_pasl numeric 0 2039491

wm_hypointensities

Description :

white matter hypointensities CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_hypointensities.imaging_pasl numeric 0 40.00370

wm_lh_bankssts

Description :

white matter left bankssts CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_bankssts.imaging_pasl numeric 0 20.277800

wm_lh_caudalanteriorcingulate

Description :

white matter left caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalanteriorcingulate.imaging_pasl numeric 0 -0.430474000

wm_lh_caudalmiddlefrontal

Description :

white matter left caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalmiddlefrontal.imaging_pasl numeric 0 15.660400

wm_lh_cuneus

Description :

white matter left cuneus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_cuneus.imaging_pasl numeric 0 34.145000

wm_lh_entorhinal

Description :

white matter left entorhinal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_entorhinal.imaging_pasl numeric 0 21.7266000

wm_lh_frontalpole

Description :

white matter left frontalpole CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_frontalpole.imaging_pasl numeric 0 34.794000

wm_lh_fusiform

Description :

white matter left fusiform CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_fusiform.imaging_pasl numeric 0 20.21880

wm_lh_inferiorparietal

Description :

white matter left inferiorparietal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiorparietal.imaging_pasl numeric 0 23.8169000

wm_lh_inferiortemporal

Description :

white matter left inferiortemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiortemporal.imaging_pasl numeric 0 -10.3157000

wm_lh_insula

Description :

white matter left insula CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_insula.imaging_pasl numeric 0 15.35160

wm_lh_isthmuscingulate

Description :

white matter left isthmuscingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_isthmuscingulate.imaging_pasl numeric 0 9.338530

wm_lh_lateraloccipital

Description :

white matter left lateraloccipital CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateraloccipital.imaging_pasl numeric 0 32.155200

wm_lh_lateralorbitofrontal

Description :

white matter left lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateralorbitofrontal.imaging_pasl numeric 0 14.602400

wm_lh_lingual

Description :

white matter left lingual CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lingual.imaging_pasl numeric 0 30.39160

wm_lh_medialorbitofrontal

Description :

white matter left medialorbitofrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_medialorbitofrontal.imaging_pasl numeric 0 12.268100

wm_lh_middletemporal

Description :

white matter left middletemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_middletemporal.imaging_pasl numeric 0 27.03220

wm_lh_paracentral

Description :

white matter left paracentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_paracentral.imaging_pasl numeric 0 -1.1495800

wm_lh_parahippocampal

Description :

white matter left parahippocampal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parahippocampal.imaging_pasl numeric 0 19.84480

wm_lh_parsopercularis

Description :

white matter left parsopercularis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsopercularis.imaging_pasl numeric 0 12.92010

wm_lh_parsorbitalis

Description :

white matter left parsorbitalis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsorbitalis.imaging_pasl numeric 0 25.936900

wm_lh_parstriangularis

Description :

white matter left parstriangularis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parstriangularis.imaging_pasl numeric 0 21.78530

wm_lh_pericalcarine

Description :

white matter left pericalcarine CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_pericalcarine.imaging_pasl numeric 0 26.344000

wm_lh_postcentral

Description :

white matter left postcentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_postcentral.imaging_pasl numeric 0 25.70490

wm_lh_posteriorcingulate

Description :

white matter left posteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_posteriorcingulate.imaging_pasl numeric 0 11.2279000

wm_lh_precentral

Description :

white matter left precentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precentral.imaging_pasl numeric 0 12.5106000

wm_lh_precuneus

Description :

white matter left precuneus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precuneus.imaging_pasl numeric 0 17.282800

wm_lh_rostralanteriorcingulate

Description :

white matter left rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralanteriorcingulate.imaging_pasl numeric 0 -0.173023000

wm_lh_rostralmiddlefrontal

Description :

white matter left rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralmiddlefrontal.imaging_pasl numeric 0 16.281600

wm_lh_superiorfrontal

Description :

white matter left superiorfrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorfrontal.imaging_pasl numeric 0 -0.9617850

wm_lh_superiorparietal

Description :

white matter left superiorparietal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorparietal.imaging_pasl numeric 0 12.85440000

wm_lh_superiortemporal

Description :

white matter left superiortemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiortemporal.imaging_pasl numeric 0 18.66070

wm_lh_supramarginal

Description :

white matter left supramarginal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_supramarginal.imaging_pasl numeric 0 23.49320

wm_lh_temporalpole

Description :

white matter left temporalpole CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_temporalpole.imaging_pasl numeric 0 -16.359100

wm_lh_transversetemporal

Description :

white matter left transversetemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_transversetemporal.imaging_pasl numeric 0 23.83980

wm_rh_bankssts

Description :

white matter right bankssts CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_bankssts.imaging_pasl numeric 0 10.97010

wm_rh_caudalanteriorcingulate

Description :

white matter right caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalanteriorcingulate.imaging_pasl numeric 0 11.6144000

wm_rh_caudalmiddlefrontal

Description :

white matter right caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalmiddlefrontal.imaging_pasl numeric 0 10.776900

wm_rh_cuneus

Description :

white matter right cuneus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_cuneus.imaging_pasl numeric 0 34.01130

wm_rh_entorhinal

Description :

white matter right entorhinal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_entorhinal.imaging_pasl numeric 0 17.2635000

wm_rh_frontalpole

Description :

white matter right frontalpole CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_frontalpole.imaging_pasl numeric 0 -23.5439000

wm_rh_fusiform

Description :

white matter right fusiform CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_fusiform.imaging_pasl numeric 0 22.23840

wm_rh_inferiorparietal

Description :

white matter right inferiorparietal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiorparietal.imaging_pasl numeric 0 21.495800

wm_rh_inferiortemporal

Description :

white matter right inferiortemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiortemporal.imaging_pasl numeric 0 21.1081000

wm_rh_insula

Description :

white matter right insula CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_insula.imaging_pasl numeric 0 14.27250

wm_rh_isthmuscingulate

Description :

white matter right isthmuscingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_isthmuscingulate.imaging_pasl numeric 0 12.413200

wm_rh_lateraloccipital

Description :

white matter right lateraloccipital CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateraloccipital.imaging_pasl numeric 0 31.23930

wm_rh_lateralorbitofrontal

Description :

white matter right lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateralorbitofrontal.imaging_pasl numeric 0 17.22780

wm_rh_lingual

Description :

white matter right lingual CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lingual.imaging_pasl numeric 0 30.72980

wm_rh_medialorbitofrontal

Description :

white matter right medialorbitofrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_medialorbitofrontal.imaging_pasl numeric 0 12.0676000

wm_rh_middletemporal

Description :

white matter right middletemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_middletemporal.imaging_pasl numeric 0 20.430700

wm_rh_paracentral

Description :

white matter right paracentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_paracentral.imaging_pasl numeric 0 -1.5267000

wm_rh_parahippocampal

Description :

white matter right parahippocampal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parahippocampal.imaging_pasl numeric 0 22.40610

wm_rh_parsopercularis

Description :

white matter right parsopercularis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsopercularis.imaging_pasl numeric 0 11.01320

wm_rh_parsorbitalis

Description :

white matter right parsorbitalis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsorbitalis.imaging_pasl numeric 0 28.303500

wm_rh_parstriangularis

Description :

white matter right parstriangularis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parstriangularis.imaging_pasl numeric 0 20.13200

wm_rh_pericalcarine

Description :

white matter right pericalcarine CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_pericalcarine.imaging_pasl numeric 0 33.77730

wm_rh_postcentral

Description :

white matter right postcentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_postcentral.imaging_pasl numeric 0 17.440200

wm_rh_posteriorcingulate

Description :

white matter right posteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_posteriorcingulate.imaging_pasl numeric 0 26.9787000

wm_rh_precentral

Description :

white matter right precentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precentral.imaging_pasl numeric 0 -0.4669170

wm_rh_precuneus

Description :

white matter right precuneus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precuneus.imaging_pasl numeric 0 15.30730

wm_rh_rostralanteriorcingulate

Description :

white matter right rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralanteriorcingulate.imaging_pasl numeric 0 10.4125000

wm_rh_rostralmiddlefrontal

Description :

white matter right rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralmiddlefrontal.imaging_pasl numeric 0 12.697700

wm_rh_superiorfrontal

Description :

white matter right superiorfrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorfrontal.imaging_pasl numeric 0 10.041000

wm_rh_superiorparietal

Description :

white matter right superiorparietal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorparietal.imaging_pasl numeric 0 14.0930000

wm_rh_superiortemporal

Description :

white matter right superiortemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiortemporal.imaging_pasl numeric 0 16.47790

wm_rh_supramarginal

Description :

white matter right supramarginal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_supramarginal.imaging_pasl numeric 0 17.23680

wm_rh_temporalpole

Description :

white matter right temporalpole CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_temporalpole.imaging_pasl numeric 0 23.9682000

wm_rh_transversetemporal

Description :

white matter right transversetemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_transversetemporal.imaging_pasl numeric 0 15.372000

wm

Description :

global white matter volume (mm3)

Variable Name Type Min Possible Max Possible
wm.imaging_pasl numeric 0 643893.3

x3rd_ventricle

Description :

3rd ventricle CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
x3rd_ventricle.imaging_pasl numeric 0 16.9449000

x4th_ventricle

Description :

4th ventricle CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
x4th_ventricle.imaging_pasl numeric 0 19.7679000

imaging_pcasl

Description :

PCASL, or pseudocontinuous arterial spin labeling, is an MRI sequence used to non-invasively measure cerebral blood flow (CBF). PCASL is typically thought to have better signal-to-noise ratio and higher test-retest reliability than other ASL methods (e.g., pulsed ASL; continuous ASL). Values in this sheet represent CBF in raw units of mL/100g tissues/min

References :

  • Dai, W., Garcia, D., De Bazelaire, C., & Alsop, D. C. (2008). Continuous flow‐driven inversion for arterial spin labeling using pulsed radio frequency and gradient fields. Magnetic Resonance in Medicine: An Official Journal of the International Society for Magnetic Resonance in Medicine, 60(6), 1488-1497.

  • Dolui, S., Vidorreta, M., Wang, Z., Nasrallah, I. M., Alavi, A., Wolk, D. A., & Detre, J. A. (2017). Comparison of PASL, PCASL, and background‐suppressed 3D PCASL in mild cognitive impairment. Human brain mapping, 38(10), 5260-5273.


ad_meta_six_composite

Description :

ad meta six composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
ad_meta_six_composite.imaging_pcasl numeric 0 34.446175

ad_meta_ten_composite

Description :

ad meta ten composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
ad_meta_ten_composite.imaging_pcasl numeric 0 37.677820

brain_stem

Description :

brainstem CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
brain_stem.imaging_pcasl numeric 0 -1.4589800

cbf

Description :

whole brain CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
cbf.imaging_pcasl numeric 0 54.31068

cc_anterior

Description :

anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_anterior.imaging_pcasl numeric 0 -0.291158

cc_central

Description :

central corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_central.imaging_pcasl numeric 0 26.160800000

cc_mid_anterior

Description :

mid anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_mid_anterior.imaging_pcasl numeric 0 -1.46639000

cc_mid_posterior

Description :

mid posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_mid_posterior.imaging_pcasl numeric 0 16.3073000

cc_posterior

Description :

posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
cc_posterior.imaging_pcasl numeric 0 -1.00238000

csf

Description :

csf CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
csf.imaging_pcasl numeric 0 28.7916000

ctx_lh_bankssts

Description :

left banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_bankssts.imaging_pcasl numeric 0 45.5427

ctx_lh_caudalanteriorcingulate

Description :

left caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalanteriorcingulate.imaging_pcasl numeric 0 50.24070

ctx_lh_caudalmiddlefrontal

Description :

left caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalmiddlefrontal.imaging_pcasl numeric 0 50.77770

ctx_lh_cuneus

Description :

left cuneus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_cuneus.imaging_pcasl numeric 0 55.54520

ctx_lh_entorhinal

Description :

left entorhinal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_entorhinal.imaging_pcasl numeric 0 -15.706400

ctx_lh_frontalpole

Description :

left frontalpole CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_frontalpole.imaging_pcasl numeric 0 59.784000

ctx_lh_fusiform

Description :

left fusiform CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_fusiform.imaging_pcasl numeric 0 37.176900

ctx_lh_inferiorparietal

Description :

left inferiorparietal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiorparietal.imaging_pcasl numeric 0 51.12080

ctx_lh_inferiortemporal

Description :

left inferiortemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiortemporal.imaging_pcasl numeric 0 43.02690

ctx_lh_insula

Description :

left insula CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_insula.imaging_pcasl numeric 0 40.0207

ctx_lh_isthmuscingulate

Description :

left isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_isthmuscingulate.imaging_pcasl numeric 0 49.29320

ctx_lh_lateraloccipital

Description :

left lateraloccipital CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateraloccipital.imaging_pcasl numeric 0 53.92090

ctx_lh_lateralorbitofrontal

Description :

left lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateralorbitofrontal.imaging_pcasl numeric 0 46.69690

ctx_lh_lingual

Description :

left lingual CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lingual.imaging_pcasl numeric 0 48.440400

ctx_lh_medialorbitofrontal

Description :

left medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_medialorbitofrontal.imaging_pcasl numeric 0 47.56020

ctx_lh_middletemporal

Description :

left middletemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_middletemporal.imaging_pcasl numeric 0 42.8341

ctx_lh_paracentral

Description :

left paracentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_paracentral.imaging_pcasl numeric 0 43.13260

ctx_lh_parahippocampal

Description :

left parahippocampal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parahippocampal.imaging_pcasl numeric 0 -10.716500

ctx_lh_parsopercularis

Description :

left parsopercularis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsopercularis.imaging_pcasl numeric 0 46.8145

ctx_lh_parsorbitalis

Description :

left parsorbitalis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsorbitalis.imaging_pcasl numeric 0 49.8189

ctx_lh_parstriangularis

Description :

left parstriangularis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parstriangularis.imaging_pcasl numeric 0 44.2379

ctx_lh_pericalcarine

Description :

left pericalcarine CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_pericalcarine.imaging_pcasl numeric 0 51.86560

ctx_lh_postcentral

Description :

left postcentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_postcentral.imaging_pcasl numeric 0 41.01860

ctx_lh_posteriorcingulate

Description :

left posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_posteriorcingulate.imaging_pcasl numeric 0 53.41060

ctx_lh_precentral

Description :

left precentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precentral.imaging_pcasl numeric 0 44.60060

ctx_lh_precuneus

Description :

left precuneus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precuneus.imaging_pcasl numeric 0 52.83330

ctx_lh_rostralanteriorcingulate

Description :

left rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralanteriorcingulate.imaging_pcasl numeric 0 47.2348

ctx_lh_rostralmiddlefrontal

Description :

left rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralmiddlefrontal.imaging_pcasl numeric 0 52.43950

ctx_lh_superiorfrontal

Description :

left superiorfrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorfrontal.imaging_pcasl numeric 0 48.60700

ctx_lh_superiorparietal

Description :

left superiorparietal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorparietal.imaging_pcasl numeric 0 46.262500

ctx_lh_superiortemporal

Description :

left superiortemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiortemporal.imaging_pcasl numeric 0 41.6325

ctx_lh_supramarginal

Description :

left supramarginal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_supramarginal.imaging_pcasl numeric 0 43.4903

ctx_lh_temporalpole

Description :

left temporalpole CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_temporalpole.imaging_pcasl numeric 0 33.212700

ctx_lh_transversetemporal

Description :

left transversetemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_transversetemporal.imaging_pcasl numeric 0 56.4887

ctx_lh_unknown

Description :

left unknown CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_unknown.imaging_pcasl numeric 0 24.15610

ctx_rh_bankssts

Description :

right banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_bankssts.imaging_pcasl numeric 0 47.9254

ctx_rh_caudalanteriorcingulate

Description :

right caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalanteriorcingulate.imaging_pcasl numeric 0 58.84400

ctx_rh_caudalmiddlefrontal

Description :

right caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalmiddlefrontal.imaging_pcasl numeric 0 52.74430

ctx_rh_cuneus

Description :

right cuneus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_cuneus.imaging_pcasl numeric 0 56.27520

ctx_rh_entorhinal

Description :

right entorhinal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_entorhinal.imaging_pcasl numeric 0 36.82920000

ctx_rh_frontalpole

Description :

right frontalpole CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_frontalpole.imaging_pcasl numeric 0 74.75130

ctx_rh_fusiform

Description :

right fusiform CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_fusiform.imaging_pcasl numeric 0 33.80820

ctx_rh_inferiorparietal

Description :

right inferiorparietal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiorparietal.imaging_pcasl numeric 0 58.18610

ctx_rh_inferiortemporal

Description :

right inferiortemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiortemporal.imaging_pcasl numeric 0 45.07720

ctx_rh_insula

Description :

right insula CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_insula.imaging_pcasl numeric 0 40.02420

ctx_rh_isthmuscingulate

Description :

right isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_isthmuscingulate.imaging_pcasl numeric 0 55.42110

ctx_rh_lateraloccipital

Description :

right lateraloccipital CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateraloccipital.imaging_pcasl numeric 0 50.08340

ctx_rh_lateralorbitofrontal

Description :

right lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateralorbitofrontal.imaging_pcasl numeric 0 49.3001

ctx_rh_lingual

Description :

right lingual CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lingual.imaging_pcasl numeric 0 47.56860

ctx_rh_medialorbitofrontal

Description :

right medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_medialorbitofrontal.imaging_pcasl numeric 0 52.58100

ctx_rh_middletemporal

Description :

right middletemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_middletemporal.imaging_pcasl numeric 0 47.0305

ctx_rh_paracentral

Description :

right paracentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_paracentral.imaging_pcasl numeric 0 43.71320

ctx_rh_parahippocampal

Description :

right parahippocampal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parahippocampal.imaging_pcasl numeric 0 32.96340

ctx_rh_parsopercularis

Description :

right parsopercularis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsopercularis.imaging_pcasl numeric 0 55.7225

ctx_rh_parsorbitalis

Description :

right parsorbitalis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsorbitalis.imaging_pcasl numeric 0 50.00450

ctx_rh_parstriangularis

Description :

right parstriangularis CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parstriangularis.imaging_pcasl numeric 0 47.3771

ctx_rh_pericalcarine

Description :

right pericalcarine CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_pericalcarine.imaging_pcasl numeric 0 54.44980

ctx_rh_postcentral

Description :

right postcentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_postcentral.imaging_pcasl numeric 0 46.15340

ctx_rh_posteriorcingulate

Description :

right posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_posteriorcingulate.imaging_pcasl numeric 0 61.4821

ctx_rh_precentral

Description :

right precentral CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precentral.imaging_pcasl numeric 0 46.16800

ctx_rh_precuneus

Description :

right precuneus CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precuneus.imaging_pcasl numeric 0 49.34570

ctx_rh_rostralanteriorcingulate

Description :

right rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralanteriorcingulate.imaging_pcasl numeric 0 49.9981

ctx_rh_rostralmiddlefrontal

Description :

right rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralmiddlefrontal.imaging_pcasl numeric 0 52.68880

ctx_rh_superiorfrontal

Description :

right superiorfrontal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorfrontal.imaging_pcasl numeric 0 49.12480

ctx_rh_superiorparietal

Description :

right superiorparietal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorparietal.imaging_pcasl numeric 0 51.740000

ctx_rh_superiortemporal

Description :

right superiortemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiortemporal.imaging_pcasl numeric 0 42.13770

ctx_rh_supramarginal

Description :

right supramarginal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_supramarginal.imaging_pcasl numeric 0 47.7366

ctx_rh_temporalpole

Description :

right temporalpole CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_temporalpole.imaging_pcasl numeric 0 36.77440

ctx_rh_transversetemporal

Description :

right transversetemporal CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_transversetemporal.imaging_pcasl numeric 0 58.8117

ctx_rh_unknown

Description :

right unknown CBF in ml/100g/min (Freesurfer ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_unknown.imaging_pcasl numeric 0 35.05890

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_pcasl numeric 0 infinity

frontal_composite

Description :

frontal composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
frontal_composite.imaging_pcasl numeric 0 48.12895

gm

Description :

global grey matter volume (mm3)

Variable Name Type Min Possible Max Possible
gm.imaging_pcasl numeric 0 infinity

label

Description :

Calculation of CBF in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_pcasl Mean character

left_accumbens_area

Description :

left accumbens area CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_accumbens_area.imaging_pcasl numeric 0 -10.63870

left_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_six_composite.imaging_pcasl numeric 4.438522 32.782767

left_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_ten_composite.imaging_pcasl numeric 6.655443 36.260220

left_amygdala

Description :

left amygdala CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_amygdala.imaging_pcasl numeric 0 38.310800

left_caudate

Description :

left caudate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_caudate.imaging_pcasl numeric 0 34.609600

left_cerebellum_cortex

Description :

left cerebellum cortex CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_cortex.imaging_pcasl numeric 0 -18.807900

left_cerebellum_white_matter

Description :

left cerebellum white matter CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_white_matter.imaging_pcasl numeric 0 10.9110000

left_choroid_plexus

Description :

left choroid plexus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_choroid_plexus.imaging_pcasl numeric 0 17.153000

left_frontal_composite

Variable Name Type Min Possible Max Possible
left_frontal_composite.imaging_pcasl numeric 9.927425 46.137600

left_hippocampus

Description :

left hippocampus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_hippocampus.imaging_pcasl numeric 0 39.15720

left_inf_lat_vent

Description :

left inf lat vent CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_inf_lat_vent.imaging_pcasl numeric 0 26.786200

left_lateral_ventricle

Description :

left lateral ventricle CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_lateral_ventricle.imaging_pcasl numeric 0 -1.269170

left_medial_temporal_composite

Variable Name Type Min Possible Max Possible
left_medial_temporal_composite.imaging_pcasl numeric 4.636722 32.794533

left_occipital_composite

Variable Name Type Min Possible Max Possible
left_occipital_composite.imaging_pcasl numeric 5.035354 52.166550

left_pallidum

Description :

left pallidum CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_pallidum.imaging_pcasl numeric 0 10.300600

left_parietal_composite

Variable Name Type Min Possible Max Possible
left_parietal_composite.imaging_pcasl numeric 7.911658 45.570740

left_putamen

Description :

left putamen CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_putamen.imaging_pcasl numeric 0 37.9508

left_temporal_composite

Variable Name Type Min Possible Max Possible
left_temporal_composite.imaging_pcasl numeric 7.210142 35.655582

left_thalamus_proper

Description :

left thalamus proper CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_thalamus_proper.imaging_pcasl numeric 0 23.405500

left_unsegmented_white_matter

Description :

left unsegmented white matter CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_unsegmented_white_matter.imaging_pcasl numeric 0 0.976057

left_ventral_dc

Description :

left ventral dc CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_ventral_dc.imaging_pcasl numeric 0 16.547900

left_vessel

Description :

left vessel CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_vessel.imaging_pcasl numeric 0 48.56790

medial_temporal_composite

Description :

medial temporal composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
medial_temporal_composite.imaging_pcasl numeric 0 32.403400

occipital_composite

Description :

occipital composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
occipital_composite.imaging_pcasl numeric 0 52.166550

optic_chiasm

Description :

optic chiasm CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
optic_chiasm.imaging_pcasl numeric 0 18.222700

parietal_composite

Description :

parietal composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
parietal_composite.imaging_pcasl numeric 0 47.658110

right_accumbens_area

Description :

right accumbens area CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_accumbens_area.imaging_pcasl numeric 0 58.996200

right_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_six_composite.imaging_pcasl numeric 6.218467 36.640817

right_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_ten_composite.imaging_pcasl numeric 6.887535 39.095420

right_amygdala

Description :

right amygdala CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_amygdala.imaging_pcasl numeric 0 44.55870

right_caudate

Description :

right caudate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_caudate.imaging_pcasl numeric 0 38.284900

right_cerebellum_cortex

Description :

right cerebellum cortex CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_cortex.imaging_pcasl numeric 0 40.990800

right_cerebellum_white_matter

Description :

right cerebellum white matter CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_white_matter.imaging_pcasl numeric 0 -1.80809000

right_choroid_plexus

Description :

right choroid plexus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_choroid_plexus.imaging_pcasl numeric 0 19.496800

right_frontal_composite

Variable Name Type Min Possible Max Possible
right_frontal_composite.imaging_pcasl numeric 11.75054 50.12029

right_hippocampus

Description :

right hippocampus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_hippocampus.imaging_pcasl numeric 0 45.89640

right_inf_lat_vent

Description :

right inf lat vent CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_inf_lat_vent.imaging_pcasl numeric 0 27.167700

right_lateral_ventricle

Description :

right lateral ventricle CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_lateral_ventricle.imaging_pcasl numeric 0 -0.198145

right_medial_temporal_composite

Variable Name Type Min Possible Max Possible
right_medial_temporal_composite.imaging_pcasl numeric 3.896760 33.942733

right_occipital_composite

Variable Name Type Min Possible Max Possible
right_occipital_composite.imaging_pcasl numeric 3.522730 52.020400

right_pallidum

Description :

right pallidum CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_pallidum.imaging_pcasl numeric 0 -0.0905455

right_parietal_composite

Variable Name Type Min Possible Max Possible
right_parietal_composite.imaging_pcasl numeric 8.292881 49.204900

right_putamen

Description :

right putamen CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_putamen.imaging_pcasl numeric 0 35.08960

right_temporal_composite

Variable Name Type Min Possible Max Possible
right_temporal_composite.imaging_pcasl numeric 8.618654 38.444691

right_thalamus_proper

Description :

right thalamus proper CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_thalamus_proper.imaging_pcasl numeric 0 34.944900

right_unsegmented_white_matter

Description :

right unsegmented white matter CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_unsegmented_white_matter.imaging_pcasl numeric 0 1.228620

right_ventral_dc

Description :

right ventral dc CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_ventral_dc.imaging_pcasl numeric 0 20.313600

right_vessel

Description :

right vessel CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_vessel.imaging_pcasl numeric 0 -10.61880

temporal_composite

Description :

temporal composite CBF in ml/100g/min

Variable Name Type Min Possible Max Possible
temporal_composite.imaging_pcasl numeric 0 37.050136

tiv

Description :

global total intracranial volume (mm3)

Variable Name Type Min Possible Max Possible
tiv.imaging_pcasl numeric 0 2075711

wm_hypointensities

Description :

white matter hypointensities CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_hypointensities.imaging_pcasl numeric 0 39.57300

wm_lh_bankssts

Description :

white matter left bankssts CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_bankssts.imaging_pcasl numeric 0 10.71620

wm_lh_caudalanteriorcingulate

Description :

white matter left caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalanteriorcingulate.imaging_pcasl numeric 0 6.347070

wm_lh_caudalmiddlefrontal

Description :

white matter left caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalmiddlefrontal.imaging_pcasl numeric 0 20.83140

wm_lh_cuneus

Description :

white matter left cuneus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_cuneus.imaging_pcasl numeric 0 30.12670

wm_lh_entorhinal

Description :

white matter left entorhinal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_entorhinal.imaging_pcasl numeric 0 15.934100

wm_lh_frontalpole

Description :

white matter left frontalpole CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_frontalpole.imaging_pcasl numeric 0 38.151600

wm_lh_fusiform

Description :

white matter left fusiform CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_fusiform.imaging_pcasl numeric 0 14.752100

wm_lh_inferiorparietal

Description :

white matter left inferiorparietal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiorparietal.imaging_pcasl numeric 0 22.48270

wm_lh_inferiortemporal

Description :

white matter left inferiortemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiortemporal.imaging_pcasl numeric 0 21.81510

wm_lh_insula

Description :

white matter left insula CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_insula.imaging_pcasl numeric 0 15.73410

wm_lh_isthmuscingulate

Description :

white matter left isthmuscingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_isthmuscingulate.imaging_pcasl numeric 0 -0.0930159

wm_lh_lateraloccipital

Description :

white matter left lateraloccipital CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateraloccipital.imaging_pcasl numeric 0 26.091400

wm_lh_lateralorbitofrontal

Description :

white matter left lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateralorbitofrontal.imaging_pcasl numeric 0 14.633500

wm_lh_lingual

Description :

white matter left lingual CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lingual.imaging_pcasl numeric 0 21.51930

wm_lh_medialorbitofrontal

Description :

white matter left medialorbitofrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_medialorbitofrontal.imaging_pcasl numeric 0 13.53620

wm_lh_middletemporal

Description :

white matter left middletemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_middletemporal.imaging_pcasl numeric 0 23.55950

wm_lh_paracentral

Description :

white matter left paracentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_paracentral.imaging_pcasl numeric 0 -0.078523

wm_lh_parahippocampal

Description :

white matter left parahippocampal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parahippocampal.imaging_pcasl numeric 0 16.5060000

wm_lh_parsopercularis

Description :

white matter left parsopercularis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsopercularis.imaging_pcasl numeric 0 13.75780

wm_lh_parsorbitalis

Description :

white matter left parsorbitalis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsorbitalis.imaging_pcasl numeric 0 32.02480

wm_lh_parstriangularis

Description :

white matter left parstriangularis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parstriangularis.imaging_pcasl numeric 0 18.67790

wm_lh_pericalcarine

Description :

white matter left pericalcarine CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_pericalcarine.imaging_pcasl numeric 0 21.999200

wm_lh_postcentral

Description :

white matter left postcentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_postcentral.imaging_pcasl numeric 0 24.49010

wm_lh_posteriorcingulate

Description :

white matter left posteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_posteriorcingulate.imaging_pcasl numeric 0 10.79740

wm_lh_precentral

Description :

white matter left precentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precentral.imaging_pcasl numeric 0 14.90210

wm_lh_precuneus

Description :

white matter left precuneus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precuneus.imaging_pcasl numeric 0 14.38330

wm_lh_rostralanteriorcingulate

Description :

white matter left rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralanteriorcingulate.imaging_pcasl numeric 0 6.49873

wm_lh_rostralmiddlefrontal

Description :

white matter left rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralmiddlefrontal.imaging_pcasl numeric 0 25.47280

wm_lh_superiorfrontal

Description :

white matter left superiorfrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorfrontal.imaging_pcasl numeric 0 10.47840

wm_lh_superiorparietal

Description :

white matter left superiorparietal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorparietal.imaging_pcasl numeric 0 18.720000

wm_lh_superiortemporal

Description :

white matter left superiortemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiortemporal.imaging_pcasl numeric 0 14.77530

wm_lh_supramarginal

Description :

white matter left supramarginal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_supramarginal.imaging_pcasl numeric 0 20.61580

wm_lh_temporalpole

Description :

white matter left temporalpole CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_temporalpole.imaging_pcasl numeric 0 18.186500

wm_lh_transversetemporal

Description :

white matter left transversetemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_transversetemporal.imaging_pcasl numeric 0 19.17270

wm_rh_bankssts

Description :

white matter right bankssts CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_bankssts.imaging_pcasl numeric 0 8.78415

wm_rh_caudalanteriorcingulate

Description :

white matter right caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalanteriorcingulate.imaging_pcasl numeric 0 12.17120

wm_rh_caudalmiddlefrontal

Description :

white matter right caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalmiddlefrontal.imaging_pcasl numeric 0 20.23110

wm_rh_cuneus

Description :

white matter right cuneus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_cuneus.imaging_pcasl numeric 0 30.9932000

wm_rh_entorhinal

Description :

white matter right entorhinal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_entorhinal.imaging_pcasl numeric 0 14.6136000

wm_rh_frontalpole

Description :

white matter right frontalpole CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_frontalpole.imaging_pcasl numeric 0 41.71660

wm_rh_fusiform

Description :

white matter right fusiform CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_fusiform.imaging_pcasl numeric 0 12.6659000

wm_rh_inferiorparietal

Description :

white matter right inferiorparietal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiorparietal.imaging_pcasl numeric 0 25.08210

wm_rh_inferiortemporal

Description :

white matter right inferiortemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiortemporal.imaging_pcasl numeric 0 18.30250

wm_rh_insula

Description :

white matter right insula CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_insula.imaging_pcasl numeric 0 11.37480

wm_rh_isthmuscingulate

Description :

white matter right isthmuscingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_isthmuscingulate.imaging_pcasl numeric 0 10.288100

wm_rh_lateraloccipital

Description :

white matter right lateraloccipital CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateraloccipital.imaging_pcasl numeric 0 28.29520

wm_rh_lateralorbitofrontal

Description :

white matter right lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateralorbitofrontal.imaging_pcasl numeric 0 17.68690

wm_rh_lingual

Description :

white matter right lingual CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lingual.imaging_pcasl numeric 0 24.46320

wm_rh_medialorbitofrontal

Description :

white matter right medialorbitofrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_medialorbitofrontal.imaging_pcasl numeric 0 16.20200

wm_rh_middletemporal

Description :

white matter right middletemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_middletemporal.imaging_pcasl numeric 0 15.28800

wm_rh_paracentral

Description :

white matter right paracentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_paracentral.imaging_pcasl numeric 0 6.137420

wm_rh_parahippocampal

Description :

white matter right parahippocampal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parahippocampal.imaging_pcasl numeric 0 14.485600

wm_rh_parsopercularis

Description :

white matter right parsopercularis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsopercularis.imaging_pcasl numeric 0 11.75570

wm_rh_parsorbitalis

Description :

white matter right parsorbitalis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsorbitalis.imaging_pcasl numeric 0 38.565100

wm_rh_parstriangularis

Description :

white matter right parstriangularis CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parstriangularis.imaging_pcasl numeric 0 16.30950

wm_rh_pericalcarine

Description :

white matter right pericalcarine CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_pericalcarine.imaging_pcasl numeric 0 26.54310

wm_rh_postcentral

Description :

white matter right postcentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_postcentral.imaging_pcasl numeric 0 19.30660

wm_rh_posteriorcingulate

Description :

white matter right posteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_posteriorcingulate.imaging_pcasl numeric 0 18.44670

wm_rh_precentral

Description :

white matter right precentral CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precentral.imaging_pcasl numeric 0 12.02330

wm_rh_precuneus

Description :

white matter right precuneus CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precuneus.imaging_pcasl numeric 0 12.77760

wm_rh_rostralanteriorcingulate

Description :

white matter right rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralanteriorcingulate.imaging_pcasl numeric 0 14.06790

wm_rh_rostralmiddlefrontal

Description :

white matter right rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralmiddlefrontal.imaging_pcasl numeric 0 20.89920

wm_rh_superiorfrontal

Description :

white matter right superiorfrontal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorfrontal.imaging_pcasl numeric 0 10.81920

wm_rh_superiorparietal

Description :

white matter right superiorparietal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorparietal.imaging_pcasl numeric 0 16.838300

wm_rh_superiortemporal

Description :

white matter right superiortemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiortemporal.imaging_pcasl numeric 0 12.40050

wm_rh_supramarginal

Description :

white matter right supramarginal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_supramarginal.imaging_pcasl numeric 0 15.46090

wm_rh_temporalpole

Description :

white matter right temporalpole CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_temporalpole.imaging_pcasl numeric 0 12.1033000

wm_rh_transversetemporal

Description :

white matter right transversetemporal CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_transversetemporal.imaging_pcasl numeric 0 11.481200

wm

Description :

global white matter volume (mm3)

Variable Name Type Min Possible Max Possible
wm.imaging_pcasl numeric 0 627774.2

x3rd_ventricle

Description :

3rd ventricle CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
x3rd_ventricle.imaging_pcasl numeric 0 39.8600000

x4th_ventricle

Description :

4th ventricle CBF in ml/100g/min (Deskian ROI)

Variable Name Type Min Possible Max Possible
x4th_ventricle.imaging_pcasl numeric 0 -16.75690000

imaging_t1

Description :

Structural MRI is a technique that looks at the anatomical information of the gray and white matter structures of the brain. Brain volume is a widely used analysis that takes structural MRI to investigate volumetric changes in brain regions as it has been shown that aging, brain injury, and diseases like dementia can cause reductions in specific parts of the brain.


ad_meta_six_composite

Description :

ad meta six composite volume in mm3

Variable Name Type Min Possible Max Possible
ad_meta_six_composite.imaging_t1 numeric 23643.50 52917.30

ad_meta_ten_composite

Description :

ad meta ten composite volume in mm3

Variable Name Type Min Possible Max Possible
ad_meta_ten_composite.imaging_t1 numeric 45128.22 100966.39

brain_stem

Description :

brain stem volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
brain_stem.imaging_t1 numeric 1435.455 4168.125

cc_anterior

Description :

anterior corpus callosum volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_anterior.imaging_t1 numeric 70.43119 191.56466

cc_central

Description :

central corpus callosum volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_central.imaging_t1 numeric 10.24154 112.58629

cc_mid_anterior

Description :

mid anterior corpus callosum volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_mid_anterior.imaging_t1 numeric 6.072097 109.048275

cc_mid_posterior

Description :

mid posterior corpus callosum volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_mid_posterior.imaging_t1 numeric 20.94356 113.01053

cc_posterior

Description :

posterior corpus callosum volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
cc_posterior.imaging_t1 numeric 36.35516 171.35888

csf_22

Description :

global csf volume in mm3

Variable Name Type Min Possible Max Possible
csf_22.imaging_t1 numeric 275.3865 770.6576

csf_7

Description :

csf volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
csf_7.imaging_t1 numeric 165129.9 1105035.9

ctx_lh_bankssts

Description :

left bankssts volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_bankssts.imaging_t1 numeric 594.4286 1742.6408

ctx_lh_caudalanteriorcingulate

Description :

left caudalanteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalanteriorcingulate.imaging_t1 numeric 284.4980 918.3881

ctx_lh_caudalmiddlefrontal

Description :

left caudalmiddlefrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_caudalmiddlefrontal.imaging_t1 numeric 1519.796 4929.154

ctx_lh_cuneus

Description :

left cuneus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_cuneus.imaging_t1 numeric 627.3146 2009.4109

ctx_lh_entorhinal

Description :

left entorhinal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_entorhinal.imaging_t1 numeric 838.2724 2095.4464

ctx_lh_frontalpole

Description :

left frontalpole volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_frontalpole.imaging_t1 numeric 144.1125 685.5874

ctx_lh_fusiform

Description :

left fusiform volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_fusiform.imaging_t1 numeric 4092.457 8702.539

ctx_lh_inferiorparietal

Description :

left inferiorparietal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiorparietal.imaging_t1 numeric 3196.095 9184.522

ctx_lh_inferiortemporal

Description :

left inferiortemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_inferiortemporal.imaging_t1 numeric 3487.354 8623.834

ctx_lh_insula

Description :

left insula volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_insula.imaging_t1 numeric 2487.091 5651.842

ctx_lh_isthmuscingulate

Description :

left isthmuscingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_isthmuscingulate.imaging_t1 numeric 617.5744 1682.0325

ctx_lh_lateraloccipital

Description :

left lateraloccipital volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateraloccipital.imaging_t1 numeric 2235.151 7438.230

ctx_lh_lateralorbitofrontal

Description :

left lateralorbitofrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lateralorbitofrontal.imaging_t1 numeric 1903.824 4918.792

ctx_lh_lingual

Description :

left lingual volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_lingual.imaging_t1 numeric 1908.043 4460.839

ctx_lh_medialorbitofrontal

Description :

left medialorbitofrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_medialorbitofrontal.imaging_t1 numeric 1472.236 3737.812

ctx_lh_middletemporal

Description :

left middletemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_middletemporal.imaging_t1 numeric 3537.506 9519.761

ctx_lh_paracentral

Description :

left paracentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_paracentral.imaging_t1 numeric 696.2287 2001.9623

ctx_lh_parahippocampal

Description :

left parahippocampal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parahippocampal.imaging_t1 numeric 743.6812 1483.2450

ctx_lh_parsopercularis

Description :

left parsopercularis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsopercularis.imaging_t1 numeric 1011.896 3189.520

ctx_lh_parsorbitalis

Description :

left parsorbitalis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parsorbitalis.imaging_t1 numeric 460.9136 1676.5076

ctx_lh_parstriangularis

Description :

left parstriangularis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_parstriangularis.imaging_t1 numeric 710.7986 2371.9061

ctx_lh_pericalcarine

Description :

left pericalcarine volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_pericalcarine.imaging_t1 numeric 410.4675 1279.3309

ctx_lh_postcentral

Description :

left postcentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_postcentral.imaging_t1 numeric 1513.438 4570.155

ctx_lh_posteriorcingulate

Description :

left posteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_posteriorcingulate.imaging_t1 numeric 568.3129 2037.2580

ctx_lh_precentral

Description :

left precentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precentral.imaging_t1 numeric 2170.412 6667.717

ctx_lh_precuneus

Description :

left precuneus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_precuneus.imaging_t1 numeric 2346.610 6700.219

ctx_lh_rostralanteriorcingulate

Description :

left rostralanteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralanteriorcingulate.imaging_t1 numeric 717.2516 2175.8828

ctx_lh_rostralmiddlefrontal

Description :

left rostralmiddlefrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_rostralmiddlefrontal.imaging_t1 numeric 3317.034 11865.353

ctx_lh_superiorfrontal

Description :

left superiorfrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorfrontal.imaging_t1 numeric 4917.746 15391.552

ctx_lh_superiorparietal

Description :

left superiorparietal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiorparietal.imaging_t1 numeric 2767.358 7128.844

ctx_lh_superiortemporal

Description :

left superiortemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_superiortemporal.imaging_t1 numeric 3645.844 9481.894

ctx_lh_supramarginal

Description :

left supramarginal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_supramarginal.imaging_t1 numeric 2638.238 6600.589

ctx_lh_temporalpole

Description :

left temporalpole volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_temporalpole.imaging_t1 numeric 306.2178 2068.6793

ctx_lh_transversetemporal

Description :

left transversetemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_transversetemporal.imaging_t1 numeric 233.3701 924.2100

ctx_lh_unknown

Description :

left unknown volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_lh_unknown.imaging_t1 numeric 248.2329 535.3830

ctx_rh_bankssts

Description :

right bankssts volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_bankssts.imaging_t1 numeric 710.8391 2137.6946

ctx_rh_caudalanteriorcingulate

Description :

right caudalanteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalanteriorcingulate.imaging_t1 numeric 350.7097 1366.1662

ctx_rh_caudalmiddlefrontal

Description :

right caudalmiddlefrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_caudalmiddlefrontal.imaging_t1 numeric 1164.031 4002.818

ctx_rh_cuneus

Description :

right cuneus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_cuneus.imaging_t1 numeric 749.2264 2221.2022

ctx_rh_entorhinal

Description :

right entorhinal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_entorhinal.imaging_t1 numeric 568.1509 1783.7044

ctx_rh_frontalpole

Description :

right frontalpole volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_frontalpole.imaging_t1 numeric 149.5159 687.1365

ctx_rh_fusiform

Description :

right fusiform volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_fusiform.imaging_t1 numeric 3558.532 7846.335

ctx_rh_inferiorparietal

Description :

right inferiorparietal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiorparietal.imaging_t1 numeric 3033.302 9556.245

ctx_rh_inferiortemporal

Description :

right inferiortemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_inferiortemporal.imaging_t1 numeric 3523.635 8988.266

ctx_rh_insula

Description :

right insula volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_insula.imaging_t1 numeric 2577.454 5944.961

ctx_rh_isthmuscingulate

Description :

right isthmuscingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_isthmuscingulate.imaging_t1 numeric 625.2727 1571.3359

ctx_rh_lateraloccipital

Description :

right lateraloccipital volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateraloccipital.imaging_t1 numeric 2584.136 7552.204

ctx_rh_lateralorbitofrontal

Description :

right lateralorbitofrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lateralorbitofrontal.imaging_t1 numeric 1967.881 4714.267

ctx_rh_lingual

Description :

right lingual volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_lingual.imaging_t1 numeric 2115.612 4430.464

ctx_rh_medialorbitofrontal

Description :

right medialorbitofrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_medialorbitofrontal.imaging_t1 numeric 1108.681 3150.498

ctx_rh_middletemporal

Description :

right middletemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_middletemporal.imaging_t1 numeric 3222.102 9522.866

ctx_rh_paracentral

Description :

right paracentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_paracentral.imaging_t1 numeric 751.5315 2381.7173

ctx_rh_parahippocampal

Description :

right parahippocampal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parahippocampal.imaging_t1 numeric 593.0381 1202.7386

ctx_rh_parsopercularis

Description :

right parsopercularis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsopercularis.imaging_t1 numeric 942.3135 3086.8594

ctx_rh_parsorbitalis

Description :

right parsorbitalis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parsorbitalis.imaging_t1 numeric 417.7474 1613.9385

ctx_rh_parstriangularis

Description :

right parstriangularis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_parstriangularis.imaging_t1 numeric 1088.620 3354.791

ctx_rh_pericalcarine

Description :

right pericalcarine volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_pericalcarine.imaging_t1 numeric 594.7223 1848.8486

ctx_rh_postcentral

Description :

right postcentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_postcentral.imaging_t1 numeric 1411.104 4239.000

ctx_rh_posteriorcingulate

Description :

right posteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_posteriorcingulate.imaging_t1 numeric 482.4664 2233.9665

ctx_rh_precentral

Description :

right precentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precentral.imaging_t1 numeric 2281.203 7464.690

ctx_rh_precuneus

Description :

right precuneus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_precuneus.imaging_t1 numeric 2451.826 7862.704

ctx_rh_rostralanteriorcingulate

Description :

right rostralanteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralanteriorcingulate.imaging_t1 numeric 476.7862 1503.7954

ctx_rh_rostralmiddlefrontal

Description :

right rostralmiddlefrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_rostralmiddlefrontal.imaging_t1 numeric 3242.460 13084.605

ctx_rh_superiorfrontal

Description :

right superiorfrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorfrontal.imaging_t1 numeric 4881.971 15666.649

ctx_rh_superiorparietal

Description :

right superiorparietal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiorparietal.imaging_t1 numeric 2491.287 7332.795

ctx_rh_superiortemporal

Description :

right superiortemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_superiortemporal.imaging_t1 numeric 3465.045 8986.815

ctx_rh_supramarginal

Description :

right supramarginal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_supramarginal.imaging_t1 numeric 2449.322 6528.600

ctx_rh_temporalpole

Description :

right temporalpole volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_temporalpole.imaging_t1 numeric 447.7714 1551.2006

ctx_rh_transversetemporal

Description :

right transversetemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_transversetemporal.imaging_t1 numeric 195.1165 640.1835

ctx_rh_unknown

Description :

right unknown volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
ctx_rh_unknown.imaging_t1 numeric 390.8891 898.6174

delta_t

Description :

Days between scans for each PIDN

Variable Name Type Min Possible Max Possible
delta_t.imaging_t1 numeric 0 Infinity

frontal_composite

Description :

frontal composite volume in mm3

Variable Name Type Min Possible Max Possible
frontal_composite.imaging_t1 numeric 32984.59 99604.15

gm

Description :

global grey matter volume (mm3)

Variable Name Type Min Possible Max Possible
gm.imaging_t1 numeric 392434.3 856851.3

label

Description :

Calculation of volume in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_t1 Sum character

left_accumbens_area

Description :

left accumbens area volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_accumbens_area.imaging_t1 numeric 171.4932 455.2841

left_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_six_composite.imaging_t1 numeric 11703.66 26784.82

left_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
left_ad_meta_ten_composite.imaging_t1 numeric 22959.13 50889.86

left_amygdala

Description :

left amygdala volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_amygdala.imaging_t1 numeric 674.8920 1528.8986

left_caudate

Description :

left caudate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_caudate.imaging_t1 numeric 681.5374 2800.1295

left_cerebellum_cortex

Description :

left cerebellum cortex volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_cortex.imaging_t1 numeric 21294.26 46504.46

left_cerebellum_white_matter

Description :

left cerebellum white matter volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_cerebellum_white_matter.imaging_t1 numeric 2452.852 5457.847

left_choroid_plexus

Description :

left choroid plexus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_choroid_plexus.imaging_t1 numeric 370.9564 1008.8381

left_frontal_composite

Variable Name Type Min Possible Max Possible
left_frontal_composite.imaging_t1 numeric 16820.46 50012.90

left_hippocampus

Description :

left hippocampus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_hippocampus.imaging_t1 numeric 1619.501 3971.869

left_inf_lat_vent

Description :

left inf lat vent volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_inf_lat_vent.imaging_t1 numeric 76.63140 196.22081

left_lateral_ventricle

Description :

left lateral ventricle volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_lateral_ventricle.imaging_t1 numeric 730.7516 2672.3250

left_medial_temporal_composite

Variable Name Type Min Possible Max Possible
left_medial_temporal_composite.imaging_t1 numeric 3246.308 7462.753

left_occipital_composite

Variable Name Type Min Possible Max Possible
left_occipital_composite.imaging_t1 numeric 12139.49 30404.09

left_pallidum

Description :

left pallidum volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_pallidum.imaging_t1 numeric 251.9812 648.1620

left_parietal_composite

Variable Name Type Min Possible Max Possible
left_parietal_composite.imaging_t1 numeric 13044.83 32757.48

left_putamen

Description :

left putamen volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_putamen.imaging_t1 numeric 1733.197 4520.745

left_temporal_composite

Variable Name Type Min Possible Max Possible
left_temporal_composite.imaging_t1 numeric 22068.10 48869.71

left_thalamus_proper

Description :

left thalamus proper volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_thalamus_proper.imaging_t1 numeric 938.2703 3209.0479

left_unsegmented_white_matter

Description :

left unsegmented white matter volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_unsegmented_white_matter.imaging_t1 numeric 1872.032 4423.477

left_ventral_dc

Description :

left ventral dc volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_ventral_dc.imaging_t1 numeric 555.1470 1299.3446

left_vessel

Description :

left vessel volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
left_vessel.imaging_t1 numeric 21.20438 43.95735

medial_temporal_composite

Description :

medial temporal composite volume in mm3

Variable Name Type Min Possible Max Possible
medial_temporal_composite.imaging_t1 numeric 6203.739 13669.806

occipital_composite

Description :

occipital composite volume in mm3

Variable Name Type Min Possible Max Possible
occipital_composite.imaging_t1 numeric 12139.49 30404.09

optic_chiasm

Description :

optic chiasm volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
optic_chiasm.imaging_t1 numeric 52.17514 147.22931

parietal_composite

Description :

parietal composite volume in mm3

Variable Name Type Min Possible Max Possible
parietal_composite.imaging_t1 numeric 25199.84 66543.02

right_accumbens_area

Description :

right accumbens area volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_accumbens_area.imaging_t1 numeric 160.9261 351.3071

right_ad_meta_six_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_six_composite.imaging_t1 numeric 10813.95 26332.34

right_ad_meta_ten_composite

Variable Name Type Min Possible Max Possible
right_ad_meta_ten_composite.imaging_t1 numeric 22169.09 50360.08

right_amygdala

Description :

right amygdala volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_amygdala.imaging_t1 numeric 623.8148 1554.8456

right_caudate

Description :

right caudate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_caudate.imaging_t1 numeric 741.2141 3147.8220

right_cerebellum_cortex

Description :

right cerebellum cortex volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_cortex.imaging_t1 numeric 23486.73 51290.55

right_cerebellum_white_matter

Description :

right cerebellum white matter volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_cerebellum_white_matter.imaging_t1 numeric 2499.238 5578.267

right_choroid_plexus

Description :

right choroid plexus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_choroid_plexus.imaging_t1 numeric 473.5598 1186.7445

right_frontal_composite

Variable Name Type Min Possible Max Possible
right_frontal_composite.imaging_t1 numeric 16164.13 49591.25

right_hippocampus

Description :

right hippocampus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_hippocampus.imaging_t1 numeric 1473.147 3630.116

right_inf_lat_vent

Description :

right inf lat vent volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_inf_lat_vent.imaging_t1 numeric 68.66404 198.80032

right_lateral_ventricle

Description :

right lateral ventricle volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_lateral_ventricle.imaging_t1 numeric 687.0589 2542.0365

right_medial_temporal_composite

Variable Name Type Min Possible Max Possible
right_medial_temporal_composite.imaging_t1 numeric 2737.324 6539.765

right_occipital_composite

Variable Name Type Min Possible Max Possible
right_occipital_composite.imaging_t1 numeric 6091.271 15470.720

right_pallidum

Description :

right pallidum volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_pallidum.imaging_t1 numeric 178.3897 526.6485

right_parietal_composite

Variable Name Type Min Possible Max Possible
right_parietal_composite.imaging_t1 numeric 14849.48 39671.10

right_putamen

Description :

right putamen volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_putamen.imaging_t1 numeric 1310.205 4115.542

right_temporal_composite

Variable Name Type Min Possible Max Possible
right_temporal_composite.imaging_t1 numeric 19470.07 46584.54

right_thalamus_proper

Description :

right thalamus proper volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_thalamus_proper.imaging_t1 numeric 1113.429 3513.139

right_unsegmented_white_matter

Description :

right unsegmented white matter volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_unsegmented_white_matter.imaging_t1 numeric 2050.137 4765.095

right_ventral_dc

Description :

right ventral dc volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_ventral_dc.imaging_t1 numeric 508.9736 1175.4990

right_vessel

Description :

right vessel volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
right_vessel.imaging_t1 numeric 11.30149 24.77098

temporal_composite

Description :

temporal composite volume in mm3

Variable Name Type Min Possible Max Possible
temporal_composite.imaging_t1 numeric 43460.43 95160.62

tiv

Description :

global total intracranial volume (mm3)

Variable Name Type Min Possible Max Possible
tiv.imaging_t1 numeric 1111535 2100666

wm_hypointensities

Description :

white matter hypointensities volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_hypointensities.imaging_t1 numeric 22.00510 62.42434

wm_lh_bankssts

Description :

white matter left bankssts volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_bankssts.imaging_t1 numeric 514.3770 1489.5563

wm_lh_caudalanteriorcingulate

Description :

white matter left caudalanteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalanteriorcingulate.imaging_t1 numeric 301.9029 932.9006

wm_lh_caudalmiddlefrontal

Description :

white matter left caudalmiddlefrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_caudalmiddlefrontal.imaging_t1 numeric 1169.448 3039.140

wm_lh_cuneus

Description :

white matter left cuneus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_cuneus.imaging_t1 numeric 584.7323 1807.2450

wm_lh_entorhinal

Description :

white matter left entorhinal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_entorhinal.imaging_t1 numeric 321.0739 815.6160

wm_lh_frontalpole

Description :

white matter left frontalpole volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_frontalpole.imaging_t1 numeric 45.66004 181.36001

wm_lh_fusiform

Description :

white matter left fusiform volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_fusiform.imaging_t1 numeric 1426.052 3252.221

wm_lh_inferiorparietal

Description :

white matter left inferiorparietal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiorparietal.imaging_t1 numeric 1880.196 5181.536

wm_lh_inferiortemporal

Description :

white matter left inferiortemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_inferiortemporal.imaging_t1 numeric 1445.421 3652.155

wm_lh_insula

Description :

white matter left insula volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_insula.imaging_t1 numeric 1781.180 3848.816

wm_lh_isthmuscingulate

Description :

white matter left isthmuscingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_isthmuscingulate.imaging_t1 numeric 523.0271 1203.9604

wm_lh_lateraloccipital

Description :

white matter left lateraloccipital volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateraloccipital.imaging_t1 numeric 1842.682 6814.733

wm_lh_lateralorbitofrontal

Description :

white matter left lateralorbitofrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lateralorbitofrontal.imaging_t1 numeric 1398.576 3383.505

wm_lh_lingual

Description :

white matter left lingual volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_lingual.imaging_t1 numeric 1471.831 3534.334

wm_lh_medialorbitofrontal

Description :

white matter left medialorbitofrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_medialorbitofrontal.imaging_t1 numeric 867.2839 2063.9880

wm_lh_middletemporal

Description :

white matter left middletemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_middletemporal.imaging_t1 numeric 1518.544 3865.894

wm_lh_paracentral

Description :

white matter left paracentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_paracentral.imaging_t1 numeric 566.8447 1589.8309

wm_lh_parahippocampal

Description :

white matter left parahippocampal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parahippocampal.imaging_t1 numeric 559.4839 1152.9405

wm_lh_parsopercularis

Description :

white matter left parsopercularis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsopercularis.imaging_t1 numeric 661.2806 1822.1726

wm_lh_parsorbitalis

Description :

white matter left parsorbitalis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parsorbitalis.imaging_t1 numeric 179.3100 523.7257

wm_lh_parstriangularis

Description :

white matter left parstriangularis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_parstriangularis.imaging_t1 numeric 549.5175 1375.2146

wm_lh_pericalcarine

Description :

white matter left pericalcarine volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_pericalcarine.imaging_t1 numeric 750.6405 2278.0744

wm_lh_postcentral

Description :

white matter left postcentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_postcentral.imaging_t1 numeric 1397.483 3877.875

wm_lh_posteriorcingulate

Description :

white matter left posteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_posteriorcingulate.imaging_t1 numeric 356.2819 1622.0857

wm_lh_precentral

Description :

white matter left precentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precentral.imaging_t1 numeric 1940.639 5455.114

wm_lh_precuneus

Description :

white matter left precuneus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_precuneus.imaging_t1 numeric 1466.360 4179.870

wm_lh_rostralanteriorcingulate

Description :

white matter left rostralanteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralanteriorcingulate.imaging_t1 numeric 343.4164 909.4714

wm_lh_rostralmiddlefrontal

Description :

white matter left rostralmiddlefrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_rostralmiddlefrontal.imaging_t1 numeric 1973.896 6114.488

wm_lh_superiorfrontal

Description :

white matter left superiorfrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorfrontal.imaging_t1 numeric 2503.062 7051.658

wm_lh_superiorparietal

Description :

white matter left superiorparietal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiorparietal.imaging_t1 numeric 2463.278 6232.714

wm_lh_superiortemporal

Description :

white matter left superiortemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_superiortemporal.imaging_t1 numeric 1609.629 3944.734

wm_lh_supramarginal

Description :

white matter left supramarginal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_supramarginal.imaging_t1 numeric 1705.131 4414.534

wm_lh_temporalpole

Description :

white matter left temporalpole volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_temporalpole.imaging_t1 numeric 123.0852 426.7991

wm_lh_transversetemporal

Description :

white matter left transversetemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_lh_transversetemporal.imaging_t1 numeric 107.8967 413.6062

wm_rh_bankssts

Description :

white matter right bankssts volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_bankssts.imaging_t1 numeric 518.3122 1529.5534

wm_rh_caudalanteriorcingulate

Description :

white matter right caudalanteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalanteriorcingulate.imaging_t1 numeric 276.6494 1114.5128

wm_rh_caudalmiddlefrontal

Description :

white matter right caudalmiddlefrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_caudalmiddlefrontal.imaging_t1 numeric 870.5610 2282.9040

wm_rh_cuneus

Description :

white matter right cuneus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_cuneus.imaging_t1 numeric 637.2675 1891.9507

wm_rh_entorhinal

Description :

white matter right entorhinal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_entorhinal.imaging_t1 numeric 191.1708 572.5924

wm_rh_frontalpole

Description :

white matter right frontalpole volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_frontalpole.imaging_t1 numeric 45.66105 174.22965

wm_rh_fusiform

Description :

white matter right fusiform volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_fusiform.imaging_t1 numeric 1427.774 3079.704

wm_rh_inferiorparietal

Description :

white matter right inferiorparietal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiorparietal.imaging_t1 numeric 2051.595 5968.417

wm_rh_inferiortemporal

Description :

white matter right inferiortemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_inferiortemporal.imaging_t1 numeric 1184.652 3230.675

wm_rh_insula

Description :

white matter right insula volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_insula.imaging_t1 numeric 1900.375 4279.061

wm_rh_isthmuscingulate

Description :

white matter right isthmuscingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_isthmuscingulate.imaging_t1 numeric 528.3967 1200.6360

wm_rh_lateraloccipital

Description :

white matter right lateraloccipital volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateraloccipital.imaging_t1 numeric 2180.425 7067.385

wm_rh_lateralorbitofrontal

Description :

white matter right lateralorbitofrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lateralorbitofrontal.imaging_t1 numeric 1317.728 2926.631

wm_rh_lingual

Description :

white matter right lingual volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_lingual.imaging_t1 numeric 1691.418 3600.787

wm_rh_medialorbitofrontal

Description :

white matter right medialorbitofrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_medialorbitofrontal.imaging_t1 numeric 652.0399 1821.0859

wm_rh_middletemporal

Description :

white matter right middletemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_middletemporal.imaging_t1 numeric 1290.445 3732.379

wm_rh_paracentral

Description :

white matter right paracentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_paracentral.imaging_t1 numeric 627.1931 1870.8637

wm_rh_parahippocampal

Description :

white matter right parahippocampal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parahippocampal.imaging_t1 numeric 580.7025 1193.0557

wm_rh_parsopercularis

Description :

white matter right parsopercularis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsopercularis.imaging_t1 numeric 518.9602 1535.8073

wm_rh_parsorbitalis

Description :

white matter right parsorbitalis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parsorbitalis.imaging_t1 numeric 155.8251 535.3796

wm_rh_parstriangularis

Description :

white matter right parstriangularis volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_parstriangularis.imaging_t1 numeric 655.9312 1775.9621

wm_rh_pericalcarine

Description :

white matter right pericalcarine volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_pericalcarine.imaging_t1 numeric 803.6989 2418.4778

wm_rh_postcentral

Description :

white matter right postcentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_postcentral.imaging_t1 numeric 1159.360 3324.740

wm_rh_posteriorcingulate

Description :

white matter right posteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_posteriorcingulate.imaging_t1 numeric 329.6761 1811.8991

wm_rh_precentral

Description :

white matter right precentral volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precentral.imaging_t1 numeric 1947.928 5364.360

wm_rh_precuneus

Description :

white matter right precuneus volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_precuneus.imaging_t1 numeric 1439.340 4578.356

wm_rh_rostralanteriorcingulate

Description :

white matter right rostralanteriorcingulate volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralanteriorcingulate.imaging_t1 numeric 318.4923 936.7650

wm_rh_rostralmiddlefrontal

Description :

white matter right rostralmiddlefrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_rostralmiddlefrontal.imaging_t1 numeric 1887.391 5851.778

wm_rh_superiorfrontal

Description :

white matter right superiorfrontal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorfrontal.imaging_t1 numeric 2549.927 7268.467

wm_rh_superiorparietal

Description :

white matter right superiorparietal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiorparietal.imaging_t1 numeric 1839.669 5294.092

wm_rh_superiortemporal

Description :

white matter right superiortemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_superiortemporal.imaging_t1 numeric 1474.021 3681.787

wm_rh_supramarginal

Description :

white matter right supramarginal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_supramarginal.imaging_t1 numeric 1363.858 3526.571

wm_rh_temporalpole

Description :

white matter right temporalpole volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_temporalpole.imaging_t1 numeric 114.4712 361.0845

wm_rh_transversetemporal

Description :

white matter right transversetemporal volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
wm_rh_transversetemporal.imaging_t1 numeric 83.11241 270.02936

wm

Description :

global white matter volume (mm3)

Variable Name Type Min Possible Max Possible
wm.imaging_t1 numeric 271997.7 676189.9

x3rd_ventricle

Description :

3rd ventricle volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
x3rd_ventricle.imaging_t1 numeric 253.7916 738.8449

x4th_ventricle

Description :

4th ventricle volume in mm3 (Deskian ROI)

Variable Name Type Min Possible Max Possible
x4th_ventricle.imaging_t1 numeric 431.9561 1150.9627

imaging_wmh

Description :

White matter hyperintensities (WMH) are lesions in the brain that are likely the result of demyelination and axonal loss due to cerebral small vessel disease. These hyperintense areas are predominantly seen near the ventricles or in subcortical white matter areas and are quantified through segmentation from FLAIR MR images. While the exact underlying cause of WMH is not yet fully understood, age is an important risk factor as WMH becomes more prevalent and severe with older age. There has also been evidence to suggest that WMH play a role in cognitive decline and risk of dementia.

References :

  • Kim, K. W., MacFall, J. R., & Payne, M. E. (2008). Classification of white matter lesions on magnetic resonance imaging in elderly persons. Biological Psychiatry, 64(4), 273–280. https://doi.org/10.1016/j.biopsych.2008.03.024

  • Prins, N. D., & Scheltens, P. (2015). White matter hyperintensities, cognitive impairment and dementia: An update. Nature Reviews Neurology, 11(3), 157–165. https://doi.org/10.1038/nrneurol.2015.10


csf

Description :

global CSF volume (mm3)

Variable Name Type Min Possible Max Possible
csf.imaging_wmh numeric 158716.4 1199485.8

delta_t

Description :

Days between scans for each PIDN

Variable Name All Possible Values (Categorical) Type
delta_t.imaging_wmh 0 numeric

FLAIR

Variable Name Type
FLAIR.imaging_wmh numeric

gm

Description :

global grey matter volume (mm3)

Variable Name Type Min Possible Max Possible
gm.imaging_wmh numeric 354034.9 846619.1

label

Description :

Calculation of volume in each region

Variable Name All Possible Values (Categorical) Type
label.imaging_wmh Sum character

log_wmh_mm3_prisma

Variable Name Type
log_wmh_mm3_prisma.imaging_wmh numeric

log_wmh_mm3_trio

Variable Name Type
log_wmh_mm3_trio.imaging_wmh numeric

mci_dataset

Variable Name Type
mci_dataset.imaging_wmh numeric

new

Variable Name Type
new.imaging_wmh numeric

old

Variable Name Type
old.imaging_wmh numeric

source_id

Description :

Suject Source ID

Variable Name Type
source_id.imaging_wmh character

tiv

Description :

global total intracranial volume (mm3)

Variable Name Type Min Possible Max Possible
tiv.imaging_wmh numeric 1105908 2200421

wm

Description :

global white matter volume (mm3)

Variable Name Type Min Possible Max Possible
wm.imaging_wmh numeric 265428.6 667508.4

wmh_mm3_prisma

Description :

WMH volume (mm3) for Prisma Scanner

Variable Name Type
wmh_mm3_prisma.imaging_wmh numeric

wmh_mm3_trio

Description :

WMH volume (mm3) for Trio Scanner

Variable Name Type
wmh_mm3_trio.imaging_wmh numeric

wmh

Description :

WMH volume (mm3)

Variable Name Type Min Possible Max Possible
wmh.imaging_wmh numeric 13.4783 236932.4043

WMH

Variable Name Type
WMH.imaging_wmh numeric

infoprocessingspeed

Description :

Info Processing Speed is a computerized battery of 10 binary choice reaction time tasks that rely upon non-verbal visuospatial cues, developed at the UCSF Memory and Aging Center and designed to measure cognitive processing speed. Tasks include abstract matching, mental rotation, visual search, distance judgement, length judgement, shape judgement, and semantic language tasks.

References :

  • Kerchner, G. A., Racine, C. A., Hale, S., Wilheim, R., Laluz, V., Miller, B. L., & Kramer, J. H. (2012). Cognitive processing speed in older adults: relationship with white matter integrity. PloS one, 7(11), e50425. https://doi.org/10.1371/journal.pone.0050425

animnoz

Description :

Z-score for Animal task: non-animal word performance

Variable Name Type Min Possible Max Possible
animnoz.infoprocessingspeed numeric 0.000 37.209

animyesz

Description :

Z-score for Animal task: animal word performance

Variable Name Type Min Possible Max Possible
animyesz.infoprocessingspeed numeric 0.000 343.560

animz

Description :

Z-score for Animal task performance

Variable Name Type Min Possible Max Possible
animz.infoprocessingspeed numeric 0.003 29.369

dotz

Description :

Z-score for Dot task (distance judgement) performance

Variable Name Type Min Possible Max Possible
dotz.infoprocessingspeed numeric 0.002 47.265

line10z

Description :

Z-score for Line task: lines differing by 10% performance

Variable Name Type Min Possible Max Possible
line10z.infoprocessingspeed numeric 0.002 37.900

line20z

Description :

Z-score for Line task: lines differing by 20% performance

Variable Name Type Min Possible Max Possible
line20z.infoprocessingspeed numeric 0.000 42.412

linez

Description :

Z-score for Line task (length judgement) performance

Variable Name Type Min Possible Max Possible
linez.infoprocessingspeed numeric 0.001 37.513

match1z

Description :

Z-score for Abstract Matching task: matching arrays equivalent on 2 dimensions performance

Variable Name Type Min Possible Max Possible
match1z.infoprocessingspeed numeric 0.003 39.640

match21z

Description :

Z-score for Abstract Matching 2 task: matching arrays equivalent on 3 dimensions performance

Variable Name Type Min Possible Max Possible
match21z.infoprocessingspeed numeric 0.002 15.185

match22z

Description :

Z-score for Abstract Matching 2 task: matching arrays equivalent on 2 dimensions performance

Variable Name Type Min Possible Max Possible
match22z.infoprocessingspeed numeric 0.002 12.496

match23z

Description :

Z-score for Abstract Matching 2 task: matching arrays equivalent on 1 dimension performance

Variable Name Type Min Possible Max Possible
match23z.infoprocessingspeed numeric 0.005 19.285

match2z

Description :

Z-score for Abstract Matching task: matching arrays equivalent on 1 dimension performance

Variable Name Type Min Possible Max Possible
match2z.infoprocessingspeed numeric 0.002 12.881

pronz

Description :

Z-score for Pronounce task performance

Variable Name Type Min Possible Max Possible
pronz.infoprocessingspeed numeric 0.001 18.053

rhymenoz

Description :

Z-score for Rhyme task: non-rhyming word pair performance

Variable Name Type Min Possible Max Possible
rhymenoz.infoprocessingspeed numeric 0.001 19.395

rhymeyesz

Description :

Z-score for Rhyme task: rhyming word pair performance

Variable Name Type Min Possible Max Possible
rhymeyesz.infoprocessingspeed numeric 0.003 20.130

rhymez

Description :

Z-score for Rhyme task performance

Variable Name Type Min Possible Max Possible
rhymez.infoprocessingspeed numeric 0.000 19.763

rotate120z

Description :

Z-score for Rotation task: 120° mental rotation performance

Variable Name Type Min Possible Max Possible
rotate120z.infoprocessingspeed numeric 0.023 -0.569

rotate60z

Description :

Z-score for Rotation task: 60° mental rotation performance

Variable Name Type Min Possible Max Possible
rotate60z.infoprocessingspeed numeric 0.026 -0.717

rotatez

Description :

Z-score for Rotation task performance

Variable Name Type Min Possible Max Possible
rotatez.infoprocessingspeed numeric 0.023 -0.510

search16nz

Description :

Z-score for Search task: 16 object array without target performance

Variable Name Type Min Possible Max Possible
search16nz.infoprocessingspeed numeric 0.001 21.526

search16yz

Description :

Z-score for Search task: 16 object array with target performance

Variable Name Type Min Possible Max Possible
search16yz.infoprocessingspeed numeric 0.024 41.002

search24nz

Description :

Z-score for Search task: 24 object array without target performance

Variable Name Type Min Possible Max Possible
search24nz.infoprocessingspeed numeric 0.011 18.071

search24yz

Description :

Z-score for Search task: 24 object array with target performance

Variable Name Type Min Possible Max Possible
search24yz.infoprocessingspeed numeric 0.008 51.355

searchz

Description :

Z-score for Search task performance

Variable Name Type Min Possible Max Possible
searchz.infoprocessingspeed numeric 0.038 30.126

shapez

Description :

Z-score for Shape task performance

Variable Name Type Min Possible Max Possible
shapez.infoprocessingspeed numeric 0.112 52.837

spatial

Description :

Z-score for performance on Spacial tasks

Variable Name Type Min Possible Max Possible
spatial.infoprocessingspeed numeric 0.003 15.904

task

Variable Name All Possible Values (Categorical) Type
task.infoprocessingspeed AgingCog_RXNTestsPart1, AgingCog_RXNTestsPart2 character

verbal

Description :

Z-score for performance on Verbal tasks

Variable Name Type Min Possible Max Possible
verbal.infoprocessingspeed numeric 0.000 22.346

version

Variable Name All Possible Values (Categorical) Type
version.infoprocessingspeed 1.0.1 character

wordnoz

Description :

Z-score for Word task: non-real English word performance

Variable Name Type Min Possible Max Possible
wordnoz.infoprocessingspeed numeric 0.008 26.391

wordyesz

Description :

Z-score for Word task: real English word performance

Variable Name Type Min Possible Max Possible
wordyesz.infoprocessingspeed numeric 0.003 25.787

wordz

Description :

Z-score for Word task performance

Variable Name Type Min Possible Max Possible
wordz.infoprocessingspeed numeric 0.002 26.089

insomnia_severity_index

Description :

7-item questionnaire asks respondents to rate the nature and symptoms of their sleep problems (the severity of symptoms, the respondent’s satisfaction with his or her sleep patterns, the degree to which insomnia interferes with daily functioning, how noticeable the respondent feels his or her insomnia is to others, and the overall level of distress)

References :

  • Bastien, C. H., Vallières, A., & Morin, C. M. (2001). Validation of the insomnia severity index as an outcome measure for insomnia research. Sleep Medicine, 2 , 297–307

dont_worry_abt_col_names:

  • https://www.ons.org/sites/default/files/InsomniaSeverityIndex_ISI.pdf

ISIdx

Description :

level of insomnia by category - total score of 0–7 indicates “no clinically signifi cant insomnia,” 8–14 means “subthreshold insomnia,” 15–21 is “clinical insomnia (moderate severity),” and 22–28 means “clinical insomnia (severe).”

References :

  • Bastien, C. H., Vallières, A., & Morin, C. M. (2001). Validation of the insomnia severity index as an outcome measure for insomnia research. Sleep Medicine, 2 , 297–307.
Variable Name All Possible Values (Categorical) Type
ISIdx.insomnia_severity_index clinical insomnia (moderate), no clinical insomnia, subthreshold insomnia character

ISItotal

Description :

level of insomnia by total score - total score of 0–7 indicates “no clinically signifi cant insomnia,” 8–14 means “subthreshold insomnia,” 15–21 is “clinical insomnia (moderate severity),” and 22–28 means “clinical insomnia (severe).”

Variable Name Type Min Possible Max Possible
ISItotal.insomnia_severity_index numeric 0 21

janssen

Description :

Plasma biomarker assays performed in collaboration with Janssen. P-tau217 was measured using an in-house SiMOA assay developed by Janssen. GFAP and NfL were measured using the Quanterix SiMOA Neurology 2‐Plex B kit.

References :

  • Saloner, R., VandeVrede, L., Asken, B. M., Paolillo, E. W., Gontrum, E. Q., Wolf, A., Lario-Lago, A., Milà-Alomà, M., Triana-Baltzer, G., Kolb, H. C., Dubal, D. B., Rabinovici, G. D., Miller, B. L., Boxer, A. L., Casaletto, K. B., & Kramer, J. H. (2024). Plasma phosphorylated tau-217 exhibits sex-specific prognostication of cognitive decline and brain atrophy in cognitively unimpaired adults. Alzheimer’s & dementia : the journal of the Alzheimer’s Association, 20(1), 376–387. https://doi.org/10.1002/alz.13454

  • Triana-Baltzer, G., Moughadam, S., Slemmon, R., Van Kolen, K., Theunis, C., Mercken, M., & Kolb, H. C. (2021). Development and validation of a high-sensitivity assay for measuring p217+tau in plasma. Alzheimer’s & dementia (Amsterdam, Netherlands), 13(1), e12204. https://doi.org/10.1002/dad2.12204


gfap_cv_janssen

Description :

Glial fibrillary acidic protein (GFAP) coefficient of variation (cv)

Variable Name Type Min Possible Max Possible
gfap_cv_janssen.janssen numeric 0 18.871068623

gfap_janssen

Description :

GFAP concentration (pg/ml)

Variable Name Type Min Possible Max Possible
gfap_janssen.janssen numeric 0 1121.44195

nfl_cv_janssen

Description :

Neurofilament light chain (nfl) coefficient of variation (cv)

Variable Name Type Min Possible Max Possible
nfl_cv_janssen.janssen numeric 0 17.66269943

nfl_janssen

Description :

Nfl concentration (pg/ml)

Variable Name Type Min Possible Max Possible
nfl_janssen.janssen numeric 0 116.103074

ptau217_cv_janssen

Description :

Phosphorylated tau-217 (P-tau217) coefficient of variation (cv)

Variable Name Type Min Possible Max Possible
ptau217_cv_janssen.janssen numeric 0 44.73198027

ptau217_janssen

Description :

P-tau217 concentration (pg/ml)

Variable Name Type Min Possible Max Possible
ptau217_janssen.janssen numeric 0 0.54509011

maas_mindfulness

Description :

The MAAS is a 15-item scale designed to assess a core characteristic of dispositional mindfulness, namely, open or receptive awareness of and attention to what is taking place in the present.

References :

  • Brown, K.W. & Ryan, R.M. (2003). The benefits of being present: Mindfulness and its role in psychological well-being. Journal of Personality and Social Psychology, 84, 822-848.

maas_mindfulnessscore

Description :

MAAS score: mean mindfulness score of 15 item scale

References :

  • Brown, K.W. & Ryan, R.M. (2003). The benefits of being present: Mindfulness and its role in psychological well-being. Journal of Personality and Social Psychology, 84, 822-848.
Variable Name Type Min Possible Max Possible
maas_mindfulnessscore.maas_mindfulness numeric 1 6.00

maas_mindfulnesstot

Description :

total score of 15 mindfullnesss items

Variable Name Type Min Possible Max Possible
maas_mindfulnesstot.maas_mindfulness numeric 15 90

med_conditions

Description :

Clinician-assessed medical conditions from Form D2 UDS version 3

References :

  • Besser, L., Kukull, W., Knopman, D. S., Chui, H., Galasko, D., Weintraub, S., … & Neuropsychology Work Group. (2018). Version 3 of the national Alzheimer’s coordinating center’s uniform data set. Alzheimer Disease & Associated Disorders, 32(4), 351-358.

  • https://naccdata.org/data-collection/forms-documentation/uds-3


afibrill

Description :

Atrial fibrillation

References :

  • https://naccdata.org/data-collection/forms-documentation/uds-3
Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
afibrill.med_conditions 0, 1 numeric no, yes

angina

Description :

Angina

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
angina.med_conditions 0, 1 numeric no, yes

angiocp

Description :

Carotid procedure: angioplasty, endarterectomy, or stent

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
angiocp.med_conditions 0, 1 numeric no, yes

angiopci

Description :

Percutaneous coronary intervention: angioplasty and/or stent

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
angiopci.med_conditions 0, 1 numeric no, yes

antienc

Description :

Antibody-mediated encephalopathy

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
antienc.med_conditions 0, 1 numeric no, yes

antiencx

Description :

Antibody-mediated encephalopathy, specify

Variable Name Type
antiencx.med_conditions character

arth

Description :

Arthritis

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
arth.med_conditions 0, 1 numeric no, yes

artloex

Description :

Arthritis region affected — lower extremity

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
artloex.med_conditions 0, 1 numeric no, yes

artspin

Description :

Arthritis region affected — spine

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
artspin.med_conditions 0, 1 numeric no, yes

artunkn

Description :

Arthritis region affected — unknown

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
artunkn.med_conditions 0, 1 numeric no, yes

artupex

Description :

Arthritis region affected — upper extremity

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
artupex.med_conditions 0, 1 numeric no, yes

artype

Description :

Arthritis type

Label Value
1 Rheumatoid
2 Osteoarthritis
3 Other
Variable Name All Possible Values (Categorical) Type Value Labels
artype.med_conditions 1, 2, 3 numeric Rheumatoid, Osteoarthritis, Other

artypex

Description :

Other arthritis type specification

Variable Name Type
artypex.med_conditions character

bowlinc

Description :

Incontinence — bowel

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
bowlinc.med_conditions 0, 1 numeric no, yes

cancer

Description :

Cancer (excluding non-melanoma skin cancer), primary or metastatic

Variable Name All Possible Values (Categorical) Type Value Labels
cancer.med_conditions 0, 1, 2 numeric no, yes, primary/non-metastatic, yes, metastatic

cancsite

Description :

Cancer primary site specification

Variable Name Type
cancsite.med_conditions character

conghrt

Description :

Congestive Heart Failure

Label Value
0 absent
1 recent/active
Variable Name All Possible Values (Categorical) Type Value Labels
conghrt.med_conditions 0, 1 numeric absent, recent/active

diabet

Description :

Diabetes

Label Value
0 no
1 yes type 1
2 yes type 2
3 yes other type
Variable Name All Possible Values (Categorical) Type Value Labels
diabet.med_conditions 0, 1, 2, 3 numeric no, yes type 1, yes type 2, yes other type

form_ver

Description :

Form Type

Label Value
3.0 form version 3.0
3.2 form version 3.2
Variable Name All Possible Values (Categorical) Type Value Labels
form_ver.med_conditions 3.0, 3.2 numeric form version 3.0, form version 3.2

hvalve

Description :

heart valve replacement or repair

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
hvalve.med_conditions 0, 1 numeric no, yes

hypchol

Description :

Hypercholesterolemia

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
hypchol.med_conditions 0, 1 numeric no, yes

hypert

Description :

Hypertension

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
hypert.med_conditions 0, 1 numeric no, yes

hyposom

Description :

Hyposomnia/insomnia

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
hyposom.med_conditions 0, 1 numeric no, yes

myoinf

Description :

Myocardial infarct

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
myoinf.med_conditions 0, 1 numeric no, yes

othcond

Description :

Other medical conditions or procedures not listed above

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
othcond.med_conditions 0, 1 numeric no, yes

othcondx

Description :

Other medical conditions specification

Variable Name Type
othcondx.med_conditions character

pacemake

Description :

Pacemaker and/or defrbillator

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
pacemake.med_conditions 0, 1 numeric no, yes

remdis

Description :

REM sleep behavior disorder (RBD)

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
remdis.med_conditions 0, 1 numeric no, yes

sleepap

Description :

Sleep apnea

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
sleepap.med_conditions 0, 1 numeric no, yes

sleepoth

Description :

other sleep disorder

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
sleepoth.med_conditions 0, 1 numeric no, yes

sleepotx

Description :

Other sleep disorder specification

Variable Name Type
sleepotx.med_conditions character

thydis

Description :

Thyroid disease

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
thydis.med_conditions 0, 1 numeric no, yes

urineinc

Description :

Incontinence — urinary

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
urineinc.med_conditions 0, 1 numeric no, yes

vb12def

Description :

B12 deficiency

Label Value
0 no
1 yes
Variable Name All Possible Values (Categorical) Type Value Labels
vb12def.med_conditions 0, 1 numeric no, yes

mesoscale


ang_bfgf_clncv

Variable Name Type Min Possible Max Possible
ang_bfgf_clncv.mesoscale numeric 0.570 796.740

ang_bfgf_cv

Variable Name Type Min Possible Max Possible
ang_bfgf_cv.mesoscale numeric 0.008 30.700

ang_bfgf

Variable Name Type Min Possible Max Possible
ang_bfgf.mesoscale numeric 0.570 796.740

ang_flt_1_clncv

Variable Name Type Min Possible Max Possible
ang_flt_1_clncv.mesoscale numeric 9.112 163.670

ang_flt_1_cv

Variable Name Type Min Possible Max Possible
ang_flt_1_cv.mesoscale numeric 0.000 20.927

ang_flt_1

Variable Name Type Min Possible Max Possible
ang_flt_1.mesoscale numeric 9.112 163.670

ang_plgf_clncv

Variable Name Type Min Possible Max Possible
ang_plgf_clncv.mesoscale numeric 3.840 19.186

ang_plgf_cv

Variable Name Type Min Possible Max Possible
ang_plgf_cv.mesoscale numeric 0.000 17.266

ang_plgf

Variable Name Type Min Possible Max Possible
ang_plgf.mesoscale numeric 3.840 19.186

ang_tie_2_clncv

Variable Name Type Min Possible Max Possible
ang_tie_2_clncv.mesoscale numeric 193.982 14804.620

ang_tie_2_cv

Variable Name Type Min Possible Max Possible
ang_tie_2_cv.mesoscale numeric 0.007 100.440

ang_tie_2

Variable Name Type Min Possible Max Possible
ang_tie_2.mesoscale numeric 193.982 14804.620

ang_vegf_c_clncv

Variable Name Type Min Possible Max Possible
ang_vegf_c_clncv.mesoscale numeric 25.280 2032.100

ang_vegf_c_cv

Variable Name Type Min Possible Max Possible
ang_vegf_c_cv.mesoscale numeric 0.000 98.730

ang_vegf_c

Variable Name Type Min Possible Max Possible
ang_vegf_c.mesoscale numeric 24.038 2032.100

ang_vegf_clncv

Variable Name Type Min Possible Max Possible
ang_vegf_clncv.mesoscale numeric 25.420 864.460

ang_vegf_cv

Variable Name Type Min Possible Max Possible
ang_vegf_cv.mesoscale numeric 0.000 19.200

ang_vegf_d_clncv

Variable Name Type Min Possible Max Possible
ang_vegf_d_clncv.mesoscale numeric 45.690 2271.960

ang_vegf_d_cv

Variable Name Type Min Possible Max Possible
ang_vegf_d_cv.mesoscale numeric 0.010 41.370

ang_vegf_d

Variable Name Type Min Possible Max Possible
ang_vegf_d.mesoscale numeric 45.690 2271.960

ang_vegf

Variable Name Type Min Possible Max Possible
ang_vegf.mesoscale numeric 25.420 864.460

chem_eotaxin_3_clncv

Variable Name Type Min Possible Max Possible
chem_eotaxin_3_clncv.mesoscale numeric 0.7896232 3316.2327580

chem_eotaxin_3_cv

Variable Name Type Min Possible Max Possible
chem_eotaxin_3_cv.mesoscale numeric 0.0000000 136.6200000

chem_eotaxin_3

Variable Name Type Min Possible Max Possible
chem_eotaxin_3.mesoscale numeric 0.7896232 3316.2327580

chem_eotaxin_clncv

Variable Name Type Min Possible Max Possible
chem_eotaxin_clncv.mesoscale numeric 35.25931 2201.45200

chem_eotaxin_cv

Variable Name Type Min Possible Max Possible
chem_eotaxin_cv.mesoscale numeric 0.000000000 49.815000000

chem_eotaxin

Variable Name Type Min Possible Max Possible
chem_eotaxin.mesoscale numeric 35.25931 2201.45200

chem_ip_10_clncv

Variable Name Type Min Possible Max Possible
chem_ip_10_clncv.mesoscale numeric 0.0000 14793.9526

chem_ip_10_cv

Variable Name Type Min Possible Max Possible
chem_ip_10_cv.mesoscale numeric 0.000000e+00 9.995000e+00

chem_ip_10

Variable Name Type Min Possible Max Possible
chem_ip_10.mesoscale numeric 0.0000 14793.9526

chem_mcp_1_clncv

Variable Name Type Min Possible Max Possible
chem_mcp_1_clncv.mesoscale numeric 16.09000 333.35351

chem_mcp_1_cv

Variable Name Type Min Possible Max Possible
chem_mcp_1_cv.mesoscale numeric 0.006000000 85.540000000

chem_mcp_1

Variable Name Type Min Possible Max Possible
chem_mcp_1.mesoscale numeric 16.09000 333.35351

chem_mcp_4_clncv

Variable Name Type Min Possible Max Possible
chem_mcp_4_clncv.mesoscale numeric 11.40600 1734.23700

chem_mcp_4_cv

Variable Name Type Min Possible Max Possible
chem_mcp_4_cv.mesoscale numeric 0.000000000 68.910000000

chem_mcp_4

Variable Name Type Min Possible Max Possible
chem_mcp_4.mesoscale numeric 11.40600 1734.23700

chem_mdc_clncv

Variable Name Type Min Possible Max Possible
chem_mdc_clncv.mesoscale numeric 217.3490 23498.9500

chem_mdc_cv

Variable Name Type Min Possible Max Possible
chem_mdc_cv.mesoscale numeric 0.01045173 77.05000000

chem_mdc

Variable Name Type Min Possible Max Possible
chem_mdc.mesoscale numeric 217.3490 23498.9500

chem_mip_1alpha_clncv

Variable Name Type Min Possible Max Possible
chem_mip_1alpha_clncv.mesoscale numeric 3.513518 746.952854

chem_mip_1alpha_cv

Variable Name Type Min Possible Max Possible
chem_mip_1alpha_cv.mesoscale numeric 0.0000000 123.0300000

chem_mip_1alpha

Variable Name Type Min Possible Max Possible
chem_mip_1alpha.mesoscale numeric 1.581820 746.952854

chem_mip_1beta_clncv

Variable Name Type Min Possible Max Possible
chem_mip_1beta_clncv.mesoscale numeric 13.62669 523.93000

chem_mip_1beta_cv

Variable Name Type Min Possible Max Possible
chem_mip_1beta_cv.mesoscale numeric 0.003557655 56.700000000

chem_mip_1beta

Variable Name Type Min Possible Max Possible
chem_mip_1beta.mesoscale numeric 13.62669 523.93000

chem_tarc_clncv

Variable Name Type Min Possible Max Possible
chem_tarc_clncv.mesoscale numeric 8.859382 3710.250000

chem_tarc_cv

Variable Name Type Min Possible Max Possible
chem_tarc_cv.mesoscale numeric 0.00000000 73.88000000

chem_tarc

Variable Name Type Min Possible Max Possible
chem_tarc.mesoscale numeric 6.972760 3710.250000

cyt_ifn_gamma_clncv

Variable Name Type Min Possible Max Possible
cyt_ifn_gamma_clncv.mesoscale numeric 0.4066359 749.5975302

cyt_ifn_gamma_cv

Variable Name Type Min Possible Max Possible
cyt_ifn_gamma_cv.mesoscale numeric 0.00000000 67.13834315

cyt_ifn_gamma

Variable Name Type Min Possible Max Possible
cyt_ifn_gamma.mesoscale numeric 0.3210666 749.5975302

cyt_il_10_clncv

Variable Name Type Min Possible Max Possible
cyt_il_10_clncv.mesoscale numeric 0.06847087 16.84495125

cyt_il_10_cv

Variable Name Type Min Possible Max Possible
cyt_il_10_cv.mesoscale numeric 0.00000000 103.38000000

cyt_il_10

Variable Name Type Min Possible Max Possible
cyt_il_10.mesoscale numeric 0.03740846 16.84495125

cyt_il_12p70_clncv

Variable Name Type Min Possible Max Possible
cyt_il_12p70_clncv.mesoscale numeric 0.008135177 6.021390238

cyt_il_12p70_cv

Variable Name Type Min Possible Max Possible
cyt_il_12p70_cv.mesoscale numeric 0.0000000 140.5465313

cyt_il_12p70

Variable Name Type Min Possible Max Possible
cyt_il_12p70.mesoscale numeric 0.001958770 6.021390238

cyt_il_13_clncv

Variable Name Type Min Possible Max Possible
cyt_il_13_clncv.mesoscale numeric 0.1281520 8.1599861

cyt_il_13_cv

Variable Name Type Min Possible Max Possible
cyt_il_13_cv.mesoscale numeric 0.0000000 134.2184627

cyt_il_13

Variable Name Type Min Possible Max Possible
cyt_il_13.mesoscale numeric 0.07670215 8.15998614

cyt_il_1beta_clncv

Variable Name Type Min Possible Max Possible
cyt_il_1beta_clncv.mesoscale numeric 0.004834041 1.790074301

cyt_il_1beta_cv

Variable Name Type Min Possible Max Possible
cyt_il_1beta_cv.mesoscale numeric 0.4354365 131.4346251

cyt_il_1beta

Variable Name Type Min Possible Max Possible
cyt_il_1beta.mesoscale numeric 0.004184987 14.539722000

cyt_il_2_clncv

Variable Name Type Min Possible Max Possible
cyt_il_2_clncv.mesoscale numeric 0.00006890 113.89536090

cyt_il_2_cv

Variable Name Type Min Possible Max Possible
cyt_il_2_cv.mesoscale numeric 0.0000000 135.4783285

cyt_il_2

Variable Name Type Min Possible Max Possible
cyt_il_2.mesoscale numeric 1.006149e-01 9.949623e-02

cyt_il_4_clncv

Variable Name Type Min Possible Max Possible
cyt_il_4_clncv.mesoscale numeric 0.001259597 1.529505746

cyt_il_4_cv

Variable Name Type Min Possible Max Possible
cyt_il_4_cv.mesoscale numeric 0.0000000 139.4589891

cyt_il_4

Variable Name Type Min Possible Max Possible
cyt_il_4.mesoscale numeric 0.000172982 1.529505746

cyt_il_6_clncv

Variable Name Type Min Possible Max Possible
cyt_il_6_clncv.mesoscale numeric 0.1150000 62.0100000

cyt_il_6_cv

Variable Name Type Min Possible Max Possible
cyt_il_6_cv.mesoscale numeric 0.00000000 80.38000000

cyt_il_6

Variable Name Type Min Possible Max Possible
cyt_il_6.mesoscale numeric 0.0500000 62.0100000

cyt_il_8_clncv

Variable Name Type Min Possible Max Possible
cyt_il_8_clncv.mesoscale numeric 1.262448 3541.786927

cyt_il_8_cv

Variable Name Type Min Possible Max Possible
cyt_il_8_cv.mesoscale numeric 0.0000000 140.9614505

cyt_il_8

Variable Name Type Min Possible Max Possible
cyt_il_8.mesoscale numeric 1.262448 3677.231791

cyt_tnf_alph_clncv

Variable Name Type Min Possible Max Possible
cyt_tnf_alph_clncv.mesoscale numeric 0.7900000 35.1600000

cyt_tnf_alph_cv

Variable Name Type Min Possible Max Possible
cyt_tnf_alph_cv.mesoscale numeric 0.00000000 17.89000000

cyt_tnf_alph

Variable Name Type Min Possible Max Possible
cyt_tnf_alph.mesoscale numeric 0.7900000 35.1600000

il_8_p_clncv

Variable Name Type Min Possible Max Possible
il_8_p_clncv.mesoscale numeric 1.439664 660.294828

il_8_p_cv

Variable Name Type Min Possible Max Possible
il_8_p_cv.mesoscale numeric 0.00000000 67.36930440

il_8_p

Variable Name Type Min Possible Max Possible
il_8_p.mesoscale numeric 1.439664 660.294828

meso_plate

Variable Name Type Min Possible Max Possible
meso_plate.mesoscale numeric 1 34

pro_gm_csf

Variable Name Type Min Possible Max Possible
pro_gm_csf.mesoscale numeric 0.006118335 0.791806968

pro_il_1

Variable Name Type Min Possible Max Possible
pro_il_1.mesoscale numeric 0.2552253 101.0278045

pro_il_12p40

Variable Name Type Min Possible Max Possible
pro_il_12p40.mesoscale numeric 24.50345 1184.51537

pro_il_15

Variable Name Type Min Possible Max Possible
pro_il_15.mesoscale numeric 0.9717009 7.0070758

pro_il_16

Variable Name Type Min Possible Max Possible
pro_il_16.mesoscale numeric 20.81769 1470.61875

pro_il_17

Variable Name Type Min Possible Max Possible
pro_il_17.mesoscale numeric 0.2712118 13.3502784

pro_il_5

Variable Name Type Min Possible Max Possible
pro_il_5.mesoscale numeric 0.1482988 2.9899785

pro_il_7

Variable Name Type Min Possible Max Possible
pro_il_7.mesoscale numeric 0.8170460 28.3601503

pro_tnf

Variable Name Type Min Possible Max Possible
pro_tnf.mesoscale numeric 0.03474753 1.03086943

pro_vegf

Variable Name Type Min Possible Max Possible
pro_vegf.mesoscale numeric 18.37737 443.96111

vasc_crp_clncv

Variable Name Type Min Possible Max Possible
vasc_crp_clncv.mesoscale numeric 71604.29 84889271.68

vasc_crp_cv

Variable Name Type Min Possible Max Possible
vasc_crp_cv.mesoscale numeric 0.00000000 62.26000000

vasc_crp

Variable Name Type Min Possible Max Possible
vasc_crp.mesoscale numeric 71604.29 92167127.44

vasc_icam_1_clncv

Variable Name Type Min Possible Max Possible
vasc_icam_1_clncv.mesoscale numeric 212627.0 2078658.3

vasc_icam_1_cv

Variable Name Type Min Possible Max Possible
vasc_icam_1_cv.mesoscale numeric 0.0150000 58.3300000

vasc_icam_1

Variable Name Type Min Possible Max Possible
vasc_icam_1.mesoscale numeric 212627.0 2078658.3

vasc_saa_clncv

Variable Name Type Min Possible Max Possible
vasc_saa_clncv.mesoscale numeric 162223.6 304395515.3

vasc_saa_cv

Variable Name Type Min Possible Max Possible
vasc_saa_cv.mesoscale numeric 0.000000000 65.170000000

vasc_saa

Variable Name Type Min Possible Max Possible
vasc_saa.mesoscale numeric 162223.6 304395515.3

vasc_vcam_1_clncv

Variable Name Type Min Possible Max Possible
vasc_vcam_1_clncv.mesoscale numeric 199334.6 2739272.1

vasc_vcam_1_cv

Variable Name Type Min Possible Max Possible
vasc_vcam_1_cv.mesoscale numeric 0.00000000 62.78000000

vasc_vcam_1

Variable Name Type Min Possible Max Possible
vasc_vcam_1.mesoscale numeric 199334.6 2739272.1

npi

Description :

The NPI-Q is based on a study partner interview in which a series of questions are read about 12 behaviors. After each behavior, the study partner responds yes or no. If the study partner responds yes, then they are asked to rate the behavior as mild, moderate, or severe.

References :

  • Gontrum, E. Q., Paolillo, E. W., Lee, S., Diaz, V., Ehrenberg, A., Saloner, R., … & Casaletto, K. (2024). Neuropsychiatric profiles and cerebral amyloid burden in adults without dementia. Dementia and Geriatric Cognitive Disorders.

abandon

Variable Name All Possible Values (Categorical) Type
abandon.npi 1, 2 numeric

affair

Variable Name All Possible Values (Categorical) Type
affair.npi 1, 2 numeric

ag_dis

Variable Name Type
ag_dis.npi numeric

ag_freq

Variable Name All Possible Values (Categorical) Type
ag_freq.npi 1, 2, 3, 4 numeric

ag_oth

Variable Name All Possible Values (Categorical) Type
ag_oth.npi 1, 2 numeric

ag_sev

Variable Name All Possible Values (Categorical) Type
ag_sev.npi 1, 2, 3 numeric

ag_totl

Variable Name Type
ag_totl.npi numeric

agitate

Variable Name All Possible Values (Categorical) Type
agitate.npi 1, 2 numeric

anger

Variable Name All Possible Values (Categorical) Type
anger.npi 1, 2 numeric

anx_dis

Variable Name Type
anx_dis.npi numeric

anx_freq

Variable Name All Possible Values (Categorical) Type
anx_freq.npi 1, 2, 3, 4 numeric

anx_oth

Variable Name All Possible Values (Categorical) Type
anx_oth.npi 1, 2 numeric

anx_sev

Variable Name All Possible Values (Categorical) Type
anx_sev.npi 1, 2, 3 numeric

anx_totl

Variable Name Type
anx_totl.npi numeric

anxiety

Variable Name All Possible Values (Categorical) Type
anxiety.npi 1, 2 numeric

apathy

Variable Name All Possible Values (Categorical) Type
apathy.npi 1, 2 numeric

appetite

Variable Name All Possible Values (Categorical) Type
appetite.npi 1, 2 numeric

apth_dis

Variable Name Type
apth_dis.npi numeric

apth_freq

Variable Name All Possible Values (Categorical) Type
apth_freq.npi 1, 2, 3, 4 numeric

apth_oth

Variable Name All Possible Values (Categorical) Type
apth_oth.npi 1, 2 numeric

apth_sev

Variable Name All Possible Values (Categorical) Type
apth_sev.npi 1, 2, 3 numeric

apth_totl

Variable Name Type
apth_totl.npi numeric

avoid

Variable Name All Possible Values (Categorical) Type
avoid.npi 1, 2 numeric

awaken

Variable Name All Possible Values (Categorical) Type
awaken.npi 1, 2 numeric

behavior

Variable Name All Possible Values (Categorical) Type
behavior.npi 1, 2 numeric

burden

Variable Name All Possible Values (Categorical) Type
burden.npi 1, 2 numeric

change

Variable Name All Possible Values (Categorical) Type
change.npi 1, 2 numeric

chores

Variable Name All Possible Values (Categorical) Type
chores.npi 1, 2 numeric

claim

Variable Name All Possible Values (Categorical) Type
claim.npi 1, 2 numeric

clothing

Variable Name All Possible Values (Categorical) Type
clothing.npi 1, 2 numeric

convrs

Variable Name All Possible Values (Categorical) Type
convrs.npi 1, 2 numeric

coping

Variable Name All Possible Values (Categorical) Type
coping.npi 1, 2 numeric

cranky

Variable Name All Possible Values (Categorical) Type
cranky.npi 1, 2 numeric

crude

Variable Name All Possible Values (Categorical) Type
crude.npi 1, 2 numeric

curse

Variable Name All Possible Values (Categorical) Type
curse.npi 1, 2 numeric

day

Variable Name All Possible Values (Categorical) Type
day.npi 1, 2 numeric

death

Variable Name All Possible Values (Categorical) Type
death.npi 1, 2 numeric

del_dis

Variable Name Type
del_dis.npi numeric

del_freq

Variable Name All Possible Values (Categorical) Type
del_freq.npi 1, 2, 3, 4 numeric

del_oth

Variable Name All Possible Values (Categorical) Type
del_oth.npi 1, 2 numeric

del_sev

Variable Name All Possible Values (Categorical) Type
del_sev.npi 1, 2, 3 numeric

del_totl

Variable Name Type
del_totl.npi numeric

delusn

Variable Name All Possible Values (Categorical) Type
delusn.npi 1, 2 numeric

dep_dis

Variable Name Type
dep_dis.npi numeric

dep_freq

Variable Name All Possible Values (Categorical) Type
dep_freq.npi 1, 2, 3, 4 numeric

dep_oth

Variable Name All Possible Values (Categorical) Type
dep_oth.npi 1, 2 numeric

dep_sev

Variable Name All Possible Values (Categorical) Type
dep_sev.npi 1, 2, 3 numeric

dep_totl

Variable Name Type
dep_totl.npi numeric

difficult

Variable Name All Possible Values (Categorical) Type
difficult.npi 1, 2 numeric

dis_dis

Variable Name Type
dis_dis.npi numeric

dis_freq

Variable Name All Possible Values (Categorical) Type
dis_freq.npi 1, 2, 3, 4 numeric

dis_oth

Variable Name All Possible Values (Categorical) Type
dis_oth.npi 1, 2 numeric

dis_sev

Variable Name All Possible Values (Categorical) Type
dis_sev.npi 1, 2, 3 numeric

dis_totl

Variable Name Type
dis_totl.npi numeric

disinhibition

Variable Name All Possible Values (Categorical) Type
disinhibition.npi 1, 2 numeric

dngr

Variable Name All Possible Values (Categorical) Type
dngr.npi 1, 2 numeric

dprssn

Variable Name All Possible Values (Categorical) Type
dprssn.npi 1, 2 numeric

dstrs_tot

Variable Name Type Min Possible Max Possible
dstrs_tot.npi numeric 0 46

early

Variable Name All Possible Values (Categorical) Type
early.npi 1, 2 numeric

eat_dis

Variable Name Type
eat_dis.npi numeric

eat_freq

Variable Name All Possible Values (Categorical) Type
eat_freq.npi 1, 2, 3, 4 numeric

eat_oth

Variable Name All Possible Values (Categorical) Type
eat_oth.npi 1, 2 numeric

eat_sev

Variable Name All Possible Values (Categorical) Type
eat_sev.npi 1, 2, 3 numeric

eat_totl

Variable Name Type
eat_totl.npi numeric

eat

Variable Name All Possible Values (Categorical) Type
eat.npi 1, 2 numeric

emotion

Variable Name All Possible Values (Categorical) Type
emotion.npi 1, 2 numeric

enthuse

Variable Name All Possible Values (Categorical) Type
enthuse.npi 1, 2 numeric

eup_dis

Variable Name Type
eup_dis.npi numeric

eup_freq

Variable Name All Possible Values (Categorical) Type
eup_freq.npi 1, 2, 3, 4 numeric

eup_oth

Variable Name All Possible Values (Categorical) Type
eup_oth.npi 1, 2 numeric

eup_sev

Variable Name All Possible Values (Categorical) Type
eup_sev.npi 1, 2, 3 numeric

eup_totl

Variable Name Type
eup_totl.npi numeric

euphoria

Variable Name All Possible Values (Categorical) Type
euphoria.npi 1, 2 numeric

failure

Variable Name All Possible Values (Categorical) Type
failure.npi 1, 2 numeric

fall_asleep

Variable Name All Possible Values (Categorical) Type
fall_asleep.npi 1, 2 numeric

fidget

Variable Name All Possible Values (Categorical) Type
fidget.npi 1, 2 numeric

food_type

Variable Name All Possible Values (Categorical) Type
food_type.npi 1, 2 numeric

food

Variable Name All Possible Values (Categorical) Type
food.npi 1, 2 numeric

friends

Variable Name All Possible Values (Categorical) Type
friends.npi 1, 2 numeric

future

Variable Name All Possible Values (Categorical) Type
future.npi 1, 2 numeric

giggle

Variable Name All Possible Values (Categorical) Type
giggle.npi 1, 2 numeric

habits

Variable Name All Possible Values (Categorical) Type
habits.npi 1, 2 numeric

hal_dis

Variable Name Type
hal_dis.npi numeric

hal_freq

Variable Name All Possible Values (Categorical) Type
hal_freq.npi 1, 2, 3, 4 numeric

hal_oth

Variable Name All Possible Values (Categorical) Type
hal_oth.npi 1, 2 numeric

hal_sev

Variable Name All Possible Values (Categorical) Type
hal_sev.npi 1, 2, 3 numeric

hal_totl

Variable Name Type
hal_totl.npi numeric

happy

Variable Name All Possible Values (Categorical) Type
happy.npi 1, 2 numeric

help

Variable Name All Possible Values (Categorical) Type
help.npi 1, 2 numeric

hit

Variable Name All Possible Values (Categorical) Type
hit.npi 1, 2 numeric

hlcntns

Variable Name All Possible Values (Categorical) Type
hlcntns.npi 1, 2 numeric

home

Variable Name All Possible Values (Categorical) Type
home.npi 1, 2 numeric

hug

Variable Name All Possible Values (Categorical) Type
hug.npi 1, 2 numeric

humor

Variable Name All Possible Values (Categorical) Type
humor.npi 1, 2 numeric

hurt

Variable Name All Possible Values (Categorical) Type
hurt.npi 1, 2 numeric

impulsiv

Variable Name All Possible Values (Categorical) Type
impulsiv.npi 1, 2 numeric

increase

Variable Name All Possible Values (Categorical) Type
increase.npi 1, 2 numeric

intrst

Variable Name All Possible Values (Categorical) Type
intrst.npi 1, 2 numeric

irr_dis

Variable Name Type
irr_dis.npi numeric

irr_freq

Variable Name All Possible Values (Categorical) Type
irr_freq.npi 1, 2, 3, 4 numeric

irr_oth

Variable Name All Possible Values (Categorical) Type
irr_oth.npi 1, 2 numeric

irr_sev

Variable Name All Possible Values (Categorical) Type
irr_sev.npi 1, 2, 3 numeric

irr_totl

Variable Name Type
irr_totl.npi numeric

irritble

Variable Name All Possible Values (Categorical) Type
irritble.npi 1, 2 numeric

jokes

Variable Name All Possible Values (Categorical) Type
jokes.npi 1, 2 numeric

mood

Variable Name All Possible Values (Categorical) Type
mood.npi 1, 2 numeric

mot_dis

Variable Name Type
mot_dis.npi numeric

mot_freq

Variable Name All Possible Values (Categorical) Type
mot_freq.npi 1, 2, 3, 4 numeric

mot_oth

Variable Name All Possible Values (Categorical) Type
mot_oth.npi 1, 2 numeric

mot_sev

Variable Name All Possible Values (Categorical) Type
mot_sev.npi 1, 2, 3 numeric

mot_totl

Variable Name Type
mot_totl.npi numeric

motor

Variable Name All Possible Values (Categorical) Type
motor.npi 1, 2 numeric

nervous

Variable Name All Possible Values (Categorical) Type
nervous.npi 1, 2 numeric

night

Variable Name All Possible Values (Categorical) Type
night.npi 1, 2 numeric

npi_q

Variable Name All Possible Values (Categorical) Type
npi_q.npi 0, 1 numeric

openly

Variable Name All Possible Values (Categorical) Type
openly.npi 1, 2 numeric

pace

Variable Name All Possible Values (Categorical) Type
pace.npi 1, 2 numeric

pranks

Variable Name All Possible Values (Categorical) Type
pranks.npi 1, 2 numeric

punish

Variable Name All Possible Values (Categorical) Type
punish.npi 1, 2 numeric

repetitive

Variable Name All Possible Values (Categorical) Type
repetitive.npi 1, 2 numeric

resist

Variable Name All Possible Values (Categorical) Type
resist.npi 1, 2 numeric

rummage

Variable Name All Possible Values (Categorical) Type
rummage.npi 1, 2 numeric

sad

Variable Name All Possible Values (Categorical) Type
sad.npi 1, 2 numeric

see

Variable Name All Possible Values (Categorical) Type
see.npi 1, 2 numeric

sighing

Variable Name All Possible Values (Categorical) Type
sighing.npi 1, 2 numeric

sle_dis

Variable Name Type
sle_dis.npi numeric

sle_frq

Variable Name All Possible Values (Categorical) Type
sle_frq.npi 1, 2, 3, 4 numeric

sle_sev

Variable Name All Possible Values (Categorical) Type
sle_sev.npi 1, 2, 3 numeric

sle_totl

Variable Name Type
sle_totl.npi numeric

sleep_oth

Variable Name All Possible Values (Categorical) Type
sleep_oth.npi 1, 2 numeric

sleep

Variable Name All Possible Values (Categorical) Type
sleep.npi 1, 2 numeric

smell

Variable Name All Possible Values (Categorical) Type
smell.npi 2 numeric

spntns

Variable Name All Possible Values (Categorical) Type
spntns.npi 1, 2 numeric

start

Variable Name All Possible Values (Categorical) Type
start.npi 1, 2 numeric

steal

Variable Name All Possible Values (Categorical) Type
steal.npi 1, 2 numeric

stranger

Variable Name All Possible Values (Categorical) Type
stranger.npi 1, 2 numeric

stubborn

Variable Name All Possible Values (Categorical) Type
stubborn.npi 1, 2 numeric

t_vfigs

Variable Name All Possible Values (Categorical) Type
t_vfigs.npi 1, 2 numeric

talk

Variable Name All Possible Values (Categorical) Type
talk.npi 1, 2 numeric

taste

Variable Name All Possible Values (Categorical) Type
taste.npi 2 numeric

tearful

Variable Name All Possible Values (Categorical) Type
tearful.npi 1, 2 numeric

temper

Variable Name All Possible Values (Categorical) Type
temper.npi 1, 2 numeric

tense

Variable Name All Possible Values (Categorical) Type
tense.npi 1, 2 numeric

throw

Variable Name All Possible Values (Categorical) Type
throw.npi 1, 2 numeric

total

Variable Name Type Min Possible Max Possible
total.npi numeric 0 123

touch

Variable Name All Possible Values (Categorical) Type
touch.npi 1, 2 numeric

truth

Variable Name All Possible Values (Categorical) Type
truth.npi 1, 2 numeric

uds_agit

Description :

Agitation or aggression in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_agit.npi 0, 1 categorical No, Yes

uds_agitsev

Description :

Agitation or aggression severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_agitsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_anx

Description :

Anxiety in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_anx.npi 0, 1 categorical No, Yes

uds_anxsev

Description :

Anxiety severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_anxsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_apa

Description :

Apathy or indifference in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_apa.npi 0, 1 categorical No, Yes

uds_apasev

Description :

Apathy or indifference severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_apasev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_app

Description :

Appetite and eating problems in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_app.npi 0, 1 categorical No, Yes

uds_appsev

Description :

appetite and eating severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_appsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_del

Description :

Delusions in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_del.npi 0, 1 categorical No, Yes

uds_delsev

Description :

Delusions severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_delsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_depd

Description :

Depression or dysphoria in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_depd.npi 0, 1 categorical No, Yes

uds_depdsev

Description :

Depression or dysphoria severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_depdsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_disn

Description :

Disinhibition in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_disn.npi 0, 1 categorical No, Yes

uds_disnsev

Description :

Disinhibition severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_disnsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_elat

Description :

Elation or euphoria in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_elat.npi 0, 1 categorical No, Yes

uds_elatsev

Description :

Elation or euphoria severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_elatsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_hall

Description :

Hallucinations in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_hall.npi 0, 1 categorical No, Yes

uds_hallsev

Description :

Hallucinations severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_hallsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_irr

Description :

Irritability or lability in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_irr.npi 0, 1 categorical No, Yes

uds_irrsev

Description :

Irritability or lability severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_irrsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_mot

Description :

Motor disturbance in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_mot.npi 0, 1 categorical No, Yes

uds_motsev

Description :

Motor severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_motsev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_nite

Description :

Nighttime behaviors in the last month

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
uds_nite.npi 0, 1 categorical No, Yes

uds_nitesev

Description :

Nighttime behaviors severity

Label Value
1 Mild
2 Moderate
3 Severe
Variable Name All Possible Values (Categorical) Type Value Labels
uds_nitesev.npi 1, 2, 3 categorical Mild, Moderate, Severe

uds_npiqinf

Description :

NPI-Q co-participant

Variable Name All Possible Values (Categorical) Type
uds_npiqinf.npi 1, 2, 3 character

uds_npiqinfx

Description :

NPI-Q co-participant, other specify

Variable Name Type
uds_npiqinfx.npi character

osu_tbi

Description :

The Ohio State University (OSU) Traumatic Brain Injury (TBI) Identification Method (OSU TBI-ID) is a standardized procedure for eliciting a person’s lifetime history of TBI via a 3-5 minute structured interview.

References :

  • Bogner, J.A., Corrigan, J.D. (2009). Reliability and validity of the OSU TBI Identification Method with Prisoners.  Journal of Head Trauma Rehabilitation, 24(6), 279-291

  • Corrigan, J.D., Bogner, J.A.  (2007). Initial reliability and validity of the OSU TBI Identification Method. Journal of Head Trauma Rehabilitation, 22(6), 318-329. 


osu_any_modsev_tbi

Description :

Worst? has there been one moderate or severe TBI (i.e., any TBI with 30 minutes or more loss of consciousness)

Variable Name All Possible Values (Categorical) Type
osu_any_modsev_tbi.osu_tbi 0, 1 categorical

osu_tbi_locpta_total

Description :

??

Variable Name All Possible Values (Categorical) Type
osu_tbi_locpta_total.osu_tbi 0, 1, 2, 3 numeric

osu_tbi1_locpta_age

Description :

Age of first TBI

Variable Name Type Min Possible Max Possible
osu_tbi1_locpta_age.osu_tbi numeric 1 76

osu_tbi2_locpta_age

Description :

Age of second TBI

Variable Name Type
osu_tbi2_locpta_age.osu_tbi numeric

osu_tbi3_locpta_age

Description :

TBI

Variable Name Type
osu_tbi3_locpta_age.osu_tbi numeric

osu_tbi7_locpta_age

Description :

??

Variable Name All Possible Values (Categorical) Type
osu_tbi7_locpta_age.osu_tbi 52 numeric

patternseparation

Description :

Mnemonic similarity task: During incidental encoding, participants viewed pictures of 80 common objects. In order to enhance encoding/attention, they were asked to judge whether the objects were most commonly found indoors or outdoors. Immediately following encoding, they were shown 40 of the studied objects, 40 novel foil objects, and 40 lure objects that were similar but not identical to studied objects. Participants were asked to classify items as “old,” “similar” or “new.” The critical metric of pattern separation is the ability to discriminate similar lure items from old items.

References :

  • Stark, S. M., Yassa, M. A., Lacy, J. W., & Stark, C. E. (2013). A task to assess behavioral pattern separation (BPS) in humans: Data from healthy aging and mild cognitive impairment. Neuropsychologia, 51(12), 2442–2449. https://doi.org/10.1016/j.neuropsychologia.2012.12.014.

  • Memel, M., Staffaroni, A. M., Cobigo, Y., Casaletto, K. B., Fonseca, C., Bettcher, B. M., … & Kramer, J. H. (2021). APOE moderates the effect of hippocampal blood flow on memory pattern separation in clinically normal older adults. Hippocampus, 31(8), 845-857.


LDI

Description :

Lure Discrimination Index: the difference between the probability of giving a “similar” response to lure items and the probability of giving a “similar” response to a new item

Variable Name Type Min Possible Max Possible
LDI.patternseparation numeric 0 120

p_sep_sim_foil

Description :

Number of foil tems classified as “similar”

Variable Name Type Min Possible Max Possible
p_sep_sim_foil.patternseparation numeric 0 120

p_sep_sim_lure

Description :

Number of lure items classified as “similar”

Variable Name Type Min Possible Max Possible
p_sep_sim_lure.patternseparation numeric 0 120

pet


PET_status_inferred

Variable Name All Possible Values (Categorical) Type
PET_status_inferred.pet DISCREPANT, NEGATIVE, POSITIVE character

PET_suvr_threshold_positive

Variable Name All Possible Values (Categorical) Type
PET_suvr_threshold_positive.pet 0, 1 numeric

PET_suvr_threshold

Variable Name All Possible Values (Categorical) Type
PET_suvr_threshold.pet 1.08, 1.11, 1.21 numeric

PETcentiloids

Variable Name Type Min Possible Max Possible
PETcentiloids.pet numeric 0.018685720 148.305259700

PETcompound

Variable Name All Possible Values (Categorical) Type
PETcompound.pet AV45, FBB, PIB character

PETlocation

Variable Name All Possible Values (Categorical) Type
PETlocation.pet CB, LBL, SFVA character

PETnotes

Variable Name Type
PETnotes.pet character

PETsuvr

Variable Name Type Min Possible Max Possible
PETsuvr.pet numeric 0.8470289 2.4323309

PETvisit

Variable Name All Possible Values (Categorical) Type
PETvisit.pet Amyloid PET CB, AV45 PET, LBL PET, PIB character

physical

Description :

Physical measurements and vital signs are collected during the neurological exam at each research visit.


bpdias

Description :

Diastolic blood pressure of participant; minimum blood pressure detected just prior to the next contraction

Variable Name Type Min Possible Max Possible
bpdias.physical numeric 30 170

bpsys

Description :

Systolic blood pressure of participant; maximum blood pressure detected during contraction of the ventricles

Variable Name Type Min Possible Max Possible
bpsys.physical numeric 86 220

height

Description :

Height of the participant measured in inches

Variable Name Type Min Possible Max Possible
height.physical numeric -6.0 79.0

hrate

Description :

Resting heart rate of the participant

Variable Name Type Min Possible Max Possible
hrate.physical numeric 19 120

weight

Description :

Weight of the participant measured in lbs

Variable Name Type Min Possible Max Possible
weight.physical numeric 80 320

physical_activity_scale

Description :

The Physical Activity Scale for the Elderly (PASE) is a widely validated measure of self-reported activity levels for older adults. Participants are ask to rate weekly frequency and daily duration for the following recreational activities: (1) walking; (2) light, moderate, and strenuous sports; (3) housework; (4) yardwork; and (5) strength training. Activity scores are computed by multiplying activity frequencies by the task-specific weights, according to the scoring manual. Activity scores are then summed to obtain a total score representing overall physical activity level, with higher values indicating greater activity.

References :

  • Washburn RA, Smith KW, Jette AM, Janney CA. The physical activity scale for the elderly (PASE): Development and evaluation. Journal of Clinical Epidemiology. 1993;46(2):153-162. doi:10.1016/0895-4356(93)90053-4

pase_pase_total

Description :

PASE scores are calculated from weights and frequency values for each type of activity. Range can be from 0 to 500 or more.

References :

  • Link to scoring manual: https://meetinstrumentenzorg.nl/wp-content/uploads/instrumenten/PASE-handl.pdf
Variable Name Type Min Possible Max Possible
pase_pase_total.physical_activity_scale numeric 0.00 infinity

psqi

Description :

The Pittsburgh Sleep Quality Index (PSQI) is a self-report questionnaire that assesses sleep quality over a 1-month time interval. Each of the questionnaire’s 19 self-reported items belongs to one of seven subcategories: subjective sleep quality, sleep latency, sleep duration, habitual sleep efficiency, sleep disturbances, use of sleeping medication, and daytime dysfunction. The 19 individual items, with 7 components, produce one global score. The PSQI takes 5–10 minutes to complete.

References :

  • Buysse, D. J., Reynolds, C. F., 3rd, Monk, T. H., Berman, S. R., & Kupfer, D. J. (1989). The Pittsburgh Sleep Quality Index: a new instrument for psychiatric practice and research. Psychiatry research, 28(2), 193–213. https://doi.org/10.1016/0165-1781(89)90047-4

psqi_PSQItot

Description :

Total score is the sum of the 7 components

Variable Name Type Min Possible Max Possible
psqi_PSQItot.psqi numeric 0.0 21

psqi_totBinary

Description :

Total less than or equal to 5 is associated with good sleep quality (0); Total greater than 5 associated with poor sleep quality (1)

Label Value
0 good
1 poor
Variable Name All Possible Values (Categorical) Type Value Labels
psqi_totBinary.psqi 0, 1 categorical good, poor

pss

Description :

The Perceived Stress Scale (PSS) measures the perception of stress. The PSS has 10-items assessing degree of life stress over the past month (e.g., how “unpredictable, uncontrollable, and overloaded” respondents find their lives). Likert scale answers range from “never” (zero points) to “very often” (four points). Score range: 0-40.

References :

  • Cohen, S., Kamarck, T., & Mermelstein, R. (1983). A global measure of perceived stress. Journal of Health and Social Behavior, 24(4), 385–396. https://doi.org/10.2307/2136404

  • Cohen, S. and Williamson, G. (1988) Perceived stress in a probability sample of the United States. The Social Psychology of Health, 13, 31-67.


PSSTotal

Description :

Total PSS score: sum of PSS1 – PSS10, each question max of 4 points

References :

  • Cohen, S., Kamarck, T., & Mermelstein, R. (1983). A global measure of perceived stress. Journal of Health and Social Behavior, 24(4), 385–396. https://doi.org/10.2307/2136404
Variable Name Type Min Possible Max Possible
PSSTotal.pss numeric 0 40

quanterix

Description :

Plasma biomarker assays performed in-house at UCSF MAC using the Quanterix SiMOA Neurology 4‐Plex E (amyloid-beta 40/42, NfL, GFAP), P-tau181, and total tau kits. Experiments were conducted on two non-overlapping study samples: 1) BrANCH participants, 2) Fitbit substudy participants.


ab40_analysis_date_branch

Variable Name All Possible Values (Categorical) Type
ab40_analysis_date_branch.quanterix 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 Date

ab40_analysis_date_fitbit

Variable Name All Possible Values (Categorical) Type
ab40_analysis_date_fitbit.quanterix 2023-04-24, 2023-04-25, 2023-04-26 Date

ab40_branch

Description :

Amyloid-beta40 concentration (pg/ml) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ab40_branch.quanterix numeric 0 249.0

ab40_cleaned_branch

Description :

Amyloid-beta40 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ab40_cleaned_branch.quanterix numeric 0 249.0

ab40_cleaned_fitbit

Description :

Amyloid-beta40 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ab40_cleaned_fitbit.quanterix numeric 0 194.0

ab40_cv_branch

Description :

Amyloid-beta40 coefficient of variation (cv) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ab40_cv_branch.quanterix numeric 0 0.365

ab40_cv_fitbit

Description :

Amyloid-beta40 coefficient of variation (cv) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ab40_cv_fitbit.quanterix numeric 0 1.139

ab40_fitbit

Description :

Amyloid-beta40 concentration (pg/ml) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ab40_fitbit.quanterix numeric 0 194.0

ab40_kit_lot_number_branch

Description :

Kit lot number BrANCH experiment

Variable Name All Possible Values (Categorical) Type
ab40_kit_lot_number_branch.quanterix 503819 numeric

ab40_kit_lot_number_fitbit

Description :

Kit lot number Fitbit experiment

Variable Name All Possible Values (Categorical) Type
ab40_kit_lot_number_fitbit.quanterix 503420 numeric

ab40_specimen_type_branch

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
ab40_specimen_type_branch.quanterix plasma character

ab40_specimen_type_fitbit

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
ab40_specimen_type_fitbit.quanterix plasma character

ab42_analysis_date_branch

Variable Name All Possible Values (Categorical) Type
ab42_analysis_date_branch.quanterix 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 Date

ab42_analysis_date_fitbit

Variable Name All Possible Values (Categorical) Type
ab42_analysis_date_fitbit.quanterix 2023-04-24, 2023-04-25, 2023-04-26 Date

ab42_branch

Description :

Amyloid-beta42 concentration (pg/ml) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ab42_branch.quanterix numeric 0 17.800

ab42_cleaned_branch

Description :

Amyloid-beta42 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ab42_cleaned_branch.quanterix numeric 0 17.800

ab42_cleaned_fitbit

Description :

Amyloid-beta42 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ab42_cleaned_fitbit.quanterix numeric 0 11.40

ab42_cv_branch

Description :

Amyloid-beta42 coefficient of variation (cv) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ab42_cv_branch.quanterix numeric 0 0.335

ab42_cv_fitbit

Description :

Amyloid-beta42 coefficient of variation (cv) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ab42_cv_fitbit.quanterix numeric 0 1.221

ab42_fitbit

Description :

Amyloid-beta42 concentration (pg/ml) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ab42_fitbit.quanterix numeric 0 11.40

ab42_kit_lot_number_branch

Description :

Kit lot number BrANCH experiment

Variable Name All Possible Values (Categorical) Type
ab42_kit_lot_number_branch.quanterix 503819 character

ab42_kit_lot_number_fitbit

Description :

Kit lot number Fitbit experiment

Variable Name All Possible Values (Categorical) Type
ab42_kit_lot_number_fitbit.quanterix 503420 character

ab42_specimen_type_branch

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
ab42_specimen_type_branch.quanterix plasma character

ab42_specimen_type_fitbit

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
ab42_specimen_type_fitbit.quanterix plasma character

gfap_analysis_date_branch

Variable Name All Possible Values (Categorical) Type
gfap_analysis_date_branch.quanterix 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 Date

gfap_analysis_date_fitbit

Variable Name All Possible Values (Categorical) Type
gfap_analysis_date_fitbit.quanterix 2023-04-24, 2023-04-25, 2023-04-26 Date

gfap_branch

Description :

GFAP concentration (pg/ml) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
gfap_branch.quanterix numeric 0 743.0

gfap_cleaned_branch

Description :

GFAP concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]

Variable Name Type Min Possible Max Possible
gfap_cleaned_branch.quanterix numeric 0 743.0

gfap_cleaned_fitbit

Description :

GFAP concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]

Variable Name Type Min Possible Max Possible
gfap_cleaned_fitbit.quanterix numeric 0 682.0

gfap_cv_branch

Description :

GFAP coefficient of variation (cv) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
gfap_cv_branch.quanterix numeric 0 0.458

gfap_cv_fitbit

Description :

GFAP coefficient of variation (cv) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
gfap_cv_fitbit.quanterix numeric 0 1.031

gfap_fitbit

Description :

GFAP concentration (pg/ml) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
gfap_fitbit.quanterix numeric 0 682.0

gfap_kit_lot_number_branch

Description :

Kit lot number BrANCH experiment

Variable Name All Possible Values (Categorical) Type
gfap_kit_lot_number_branch.quanterix 503819 character

gfap_kit_lot_number_fitbit

Description :

Kit lot number Fitbit experiment

Variable Name All Possible Values (Categorical) Type
gfap_kit_lot_number_fitbit.quanterix 503420 character

gfap_specimen_type_branch

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
gfap_specimen_type_branch.quanterix plasma character

gfap_specimen_type_fitbit

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
gfap_specimen_type_fitbit.quanterix plasma character

nfl_analysis_date_branch

Variable Name All Possible Values (Categorical) Type
nfl_analysis_date_branch.quanterix 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 Date

nfl_analysis_date_fitbit

Variable Name All Possible Values (Categorical) Type
nfl_analysis_date_fitbit.quanterix 2023-04-24, 2023-04-25, 2023-04-26 Date

nfl_branch

Description :

NfL concentration (pg/ml) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
nfl_branch.quanterix numeric 0 198.00

nfl_cleaned_branch

Description :

NfL concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]

Variable Name Type Min Possible Max Possible
nfl_cleaned_branch.quanterix numeric 0 198.00

nfl_cleaned_fitbit

Description :

NfL concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]

Variable Name Type Min Possible Max Possible
nfl_cleaned_fitbit.quanterix numeric 0 133.00

nfl_cv_branch

Description :

NfL coefficient of variation (cv) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
nfl_cv_branch.quanterix numeric 0 0.536

nfl_cv_fitbit

Description :

NfL coefficient of variation (cv) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
nfl_cv_fitbit.quanterix numeric 0 1.126

nfl_fitbit

Description :

NfL concentration (pg/ml) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
nfl_fitbit.quanterix numeric 0 133.00

nfl_kit_lot_number_branch

Description :

Kit lot number BrANCH experiment

Variable Name All Possible Values (Categorical) Type
nfl_kit_lot_number_branch.quanterix 503819 character

nfl_kit_lot_number_fitbit

Description :

Kit lot number Fitbit experiment

Variable Name All Possible Values (Categorical) Type
nfl_kit_lot_number_fitbit.quanterix 503420 character

nfl_specimen_type_branch

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
nfl_specimen_type_branch.quanterix plasma character

nfl_specimen_type_fitbit

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
nfl_specimen_type_fitbit.quanterix plasma character

ptau181_analysis_date_fitbit

Variable Name All Possible Values (Categorical) Type
ptau181_analysis_date_fitbit.quanterix 2023-04-03, 2023-04-04, 2023-04-05 Date

ptau181_branch

Description :

P-tau181 concentration (pg/ml) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ptau181_branch.quanterix numeric 0 15.500

ptau181_cleaned_branch

Description :

P-tau181 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ptau181_cleaned_branch.quanterix numeric 0 7.770

ptau181_cleaned_fitbit

Description :

P-tau181 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ptau181_cleaned_fitbit.quanterix numeric 0 35.800

ptau181_cv_branch

Description :

P-tau181 coefficient of variation (cv) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ptau181_cv_branch.quanterix numeric 0 0.787

ptau181_cv_fitbit

Description :

P-tau181 coefficient of variation (cv) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ptau181_cv_fitbit.quanterix numeric 0 1.134

ptau181_fitbit

Description :

P-tau181 concentration (pg/ml) [Fitbit experiment]

Variable Name Type Min Possible Max Possible
ptau181_fitbit.quanterix numeric 0 35.800

ptau181_kit_lot_number_fitbit

Description :

Kit lot number Fitbit experiment

Variable Name All Possible Values (Categorical) Type
ptau181_kit_lot_number_fitbit.quanterix 503545 character

ptau181_specimen_type_branch

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
ptau181_specimen_type_branch.quanterix plasma character

ptau181_specimen_type_fitbit

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
ptau181_specimen_type_fitbit.quanterix plasma character

ttau_branch

Description :

Total tau concentration (pg/ml) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ttau_branch.quanterix numeric 0 3.270

ttau_cleaned_branch

Description :

Total tau concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ttau_cleaned_branch.quanterix numeric 0 3.270

ttau_cv_branch

Description :

Total tau coefficient of variation (cv) [BrANCH experiment]

Variable Name Type Min Possible Max Possible
ttau_cv_branch.quanterix numeric 0 0.854

ttau_specimen_type_branch

Description :

Specimen type

Variable Name All Possible Values (Categorical) Type
ttau_specimen_type_branch.quanterix plasma character

sdoh


age

Variable Name Type Min Possible Max Possible
age.sdoh numeric 31 92

sdoh_date

Variable Name Type Min Possible Max Possible
sdoh_date.sdoh POSIXct 2022-01-02 2023-02-13

sex

Variable Name All Possible Values (Categorical) Type
sex.sdoh Female, Male character

setshifting

Description :

Set Shifting is an NIH-EXAMINER task in which participants match a stimulus on the top of the screen to one of two stimuli in the lower corners of the screen. The screen on each trial contains a red triangle in the bottom left corner and a blue rectangle in the bottom right corner. At the beginning of each trial, a cue that reads “shape” or “color” appears at the bottom of the screen followed by a blue triangle stimulus or a red rectangle stimulus in the top-center of the screen. The examinee is then instructed to match the stimulus presented with one of the reference objects based on the cue provided.

References :

  • Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., Bostrom, A., Sinha, L., Berhel, A., & Widmeyer, M. (2014). NIH EXAMINER: conceptualization and development of an executive function battery. Journal of the International Neuropsychological Society : JINS, 20(1), 11–19. https://doi.org/10.1017/S1355617713001094

platform

Description :

Computer program that NIH-EXAMINER Set Shifting is run on (E-Prime)

Variable Name All Possible Values (Categorical) Type
platform.setshifting E-Prime character

shftlog

Description :

Log 10 of the mean response time of the correct shift block trials

Variable Name Type Min Possible Max Possible
shftlog.setshifting numeric 2.602 3.431

shftstem

Description :

Measure of reaction time after log transformations/calculations

Variable Name Type Min Possible Max Possible
shftstem.setshifting numeric 0.002 -0.093

shiftacc

Description :

Measure of accuracy calculated as # of correct trials / # of total trials in the shift block

Variable Name Type Min Possible Max Possible
shiftacc.setshifting numeric 0.313 1.000

shiftaccscore

Description :

Accuracy score = shiftacc.setshifting multiplied by 5

Variable Name Type Min Possible Max Possible
shiftaccscore.setshifting numeric 1.563 5.000

shiftrtscore

Description :

Reaction time score = 5 - (shftstem.setshifting multiplied by 5)

Variable Name Type Min Possible Max Possible
shiftrtscore.setshifting numeric 0.004 -2.055

shiftscore

Description :

A calcuated composite score that combines accuracy and reaction time scores

Variable Name Type Min Possible Max Possible
shiftscore.setshifting numeric 1.076 10.184

sex_and_reproductive_health


sexQ_ageatlastperiod

Variable Name Type Min Possible Max Possible
sexQ_ageatlastperiod.sex_and_reproductive_health numeric 32.0 70.0

sexQ_birthcontrol_currently_years

Variable Name All Possible Values (Categorical) Type
sexQ_birthcontrol_currently_years.sex_and_reproductive_health 34 numeric

sexQ_birthcontrol_currently

Variable Name All Possible Values (Categorical) Type
sexQ_birthcontrol_currently.sex_and_reproductive_health 1, 2 numeric

sexQ_children_ageatfirstchild

Variable Name Type
sexQ_children_ageatfirstchild.sex_and_reproductive_health character

sexQ_children_ageatlastchild

Variable Name Type
sexQ_children_ageatlastchild.sex_and_reproductive_health character

sexQ_children_number

Variable Name Type
sexQ_children_number.sex_and_reproductive_health numeric

sexQ_everpregnant

Variable Name All Possible Values (Categorical) Type
sexQ_everpregnant.sex_and_reproductive_health 1, 2 numeric

sexQ_facialhairgrowth

Variable Name All Possible Values (Categorical) Type
sexQ_facialhairgrowth.sex_and_reproductive_health 1, 2 numeric

sexQ_fertilitytreatments_type_other

Variable Name Type
sexQ_fertilitytreatments_type_other.sex_and_reproductive_health character

sexQ_fertilitytreatments_type

Variable Name All Possible Values (Categorical) Type
sexQ_fertilitytreatments_type.sex_and_reproductive_health 1, 2, 3 numeric

sexQ_fertilitytreatments

Variable Name All Possible Values (Categorical) Type
sexQ_fertilitytreatments.sex_and_reproductive_health 1, 2 numeric

sexQ_firstperiodage

Variable Name Type Min Possible Max Possible
sexQ_firstperiodage.sex_and_reproductive_health numeric 9.0 17.0

sexQ_gender

Variable Name All Possible Values (Categorical) Type
sexQ_gender.sex_and_reproductive_health 1, 2 numeric

sexQ_hormonalbirthcontrol_everused

Variable Name All Possible Values (Categorical) Type
sexQ_hormonalbirthcontrol_everused.sex_and_reproductive_health 1, 2 numeric

sexQ_hormonalbirthcontrol_yearsused

Variable Name Type
sexQ_hormonalbirthcontrol_yearsused.sex_and_reproductive_health character

sexQ_hormonetherapy_currently_length

Variable Name Type
sexQ_hormonetherapy_currently_length.sex_and_reproductive_health character

sexQ_hormonetherapy_length

Variable Name All Possible Values (Categorical) Type
sexQ_hormonetherapy_length.sex_and_reproductive_health 1, 3, 4, 5 numeric

sexQ_hormonetherapy_why_other

Variable Name Type
sexQ_hormonetherapy_why_other.sex_and_reproductive_health character

sexQ_hormonetherapy_why

Variable Name Type
sexQ_hormonetherapy_why.sex_and_reproductive_health numeric

sexQ_hormonetherapy

Variable Name All Possible Values (Categorical) Type
sexQ_hormonetherapy.sex_and_reproductive_health 1, 2, 4 numeric

sexQ_hysterectomyremoval_age

Variable Name Type Min Possible Max Possible
sexQ_hysterectomyremoval_age.sex_and_reproductive_health numeric 32.0 77.0

sexQ_hysterectomyremoval

Variable Name All Possible Values (Categorical) Type
sexQ_hysterectomyremoval.sex_and_reproductive_health 1, 2 numeric

sexQ_menstrualpattern

Variable Name All Possible Values (Categorical) Type
sexQ_menstrualpattern.sex_and_reproductive_health 1, 2, 3 numeric

sexQ_ovaryremoval_age

Variable Name Type Min Possible Max Possible
sexQ_ovaryremoval_age.sex_and_reproductive_health numeric 21.0 77.0

sexQ_ovaryremoval

Variable Name All Possible Values (Categorical) Type
sexQ_ovaryremoval.sex_and_reproductive_health 1, 2, 3, 4 numeric

sexQ_PCOS_endometriosis_infertility

Variable Name All Possible Values (Categorical) Type
sexQ_PCOS_endometriosis_infertility.sex_and_reproductive_health 1, 2, 3, 13, 23 numeric

sexQ_periodregular

Variable Name All Possible Values (Categorical) Type
sexQ_periodregular.sex_and_reproductive_health 1, 2 numeric

sexQ_pregnancies_firsttrimester

Variable Name Type
sexQ_pregnancies_firsttrimester.sex_and_reproductive_health numeric

sexQ_pregnancies_secondtrimester

Variable Name All Possible Values (Categorical) Type
sexQ_pregnancies_secondtrimester.sex_and_reproductive_health 0, 1, 2, 10 numeric

sexQ_pregnancies_thirdtrimester

Variable Name Type
sexQ_pregnancies_thirdtrimester.sex_and_reproductive_health numeric

sexQ_sex

Variable Name All Possible Values (Categorical) Type
sexQ_sex.sex_and_reproductive_health 1, 2 numeric

sexQ_sexorientation_other

Variable Name All Possible Values (Categorical) Type
sexQ_sexorientation_other.sex_and_reproductive_health Pansexual character

sexQ_sexorientation

Variable Name All Possible Values (Categorical) Type
sexQ_sexorientation.sex_and_reproductive_health 1, 2, 3, 4 numeric

sexQ_stillmenstruating_lastmenses

Variable Name All Possible Values (Categorical) Type
sexQ_stillmenstruating_lastmenses.sex_and_reproductive_health 1/1/2020, 4/6/2020, 8/23/1984 character

sexQ_stillmenstruating_periodfreq

Variable Name All Possible Values (Categorical) Type
sexQ_stillmenstruating_periodfreq.sex_and_reproductive_health 2 numeric

sexQ_stillmenstruating_regularperiods

Variable Name All Possible Values (Categorical) Type
sexQ_stillmenstruating_regularperiods.sex_and_reproductive_health 2 numeric

sexQ_stillmenstruating

Variable Name All Possible Values (Categorical) Type
sexQ_stillmenstruating.sex_and_reproductive_health 4, 5 numeric

sleep_instruments

Description :

Sleep Intruments include different questionnaires that participants enrolled in the Sleep Project at UCSF asnwer during the 7 day study. These questionnaires include the Circadian Type Inventory, Functional Outcomes of Sleep Questionnaire, Morningness Evening Type, and the Sleep Preoccupation Scale.


bmi

Description :

BMI captured from the Berlin Sleep Questionnaire

Variable Name Type Min Possible Max Possible
bmi.sleep_instruments numeric 17.00000 41.00000

cti_fr

Description :

Circadian type inventory - high scores = fluidity/ low scores = rigidity

Variable Name Type Min Possible Max Possible
cti_fr.sleep_instruments numeric 5 21

cti_lv

Description :

Circadian type inventory - high scores = languid/ low scores = vigorous

Variable Name Type Min Possible Max Possible
cti_lv.sleep_instruments numeric 6 24

fosq_activity_level

Description :

functional outcomes of sleep: affect on activity levels

Variable Name Type Min Possible Max Possible
fosq_activity_level.sleep_instruments numeric 1.166667 4.000000

fosq_general_productivity

Description :

functional outcomes of sleep: affect on productivity levels

Variable Name Type Min Possible Max Possible
fosq_general_productivity.sleep_instruments numeric 1.125000 4.000000

fosq_intimate_rels_sexual_activity

Description :

functional outcomes of sleep: affect on sexual relationships

Variable Name Type Min Possible Max Possible
fosq_intimate_rels_sexual_activity.sleep_instruments numeric 0.000000 5.333333

fosq_social_outcome

Description :

functional outcomes of sleep: affect on socializing

Variable Name Type
fosq_social_outcome.sleep_instruments numeric

fosq_total

Description :

functional outcomes of sleep total score (high score= better function, low scores = worse function)

Variable Name Type Min Possible Max Possible
fosq_total.sleep_instruments numeric 8.646825 26.000000

fosq_vigilance

Description :

functional outcomes of sleep: affect on vigilance

Variable Name Type Min Possible Max Possible
fosq_vigilance.sleep_instruments numeric 1.000000 10.000000

meq_morn_total

Description :

morningness eveningness questionnaire total score

Variable Name Type Min Possible Max Possible
meq_morn_total.sleep_instruments numeric 22.00 81.00

meq_score

Description :

morningness eveningness type ( 0 = neither type, 1 = morning type, 3 = evening type)

Variable Name All Possible Values (Categorical) Type
meq_score.sleep_instruments 0, 1, 2 numeric

sps_ac

Description :

sleep preoccupation scale - affective consequences

Variable Name Type Min Possible Max Possible
sps_ac.sleep_instruments numeric 7 39

sps_cbc

Description :

sleep preoccupation scale - cognitive and behavioral consequences

Variable Name Type Min Possible Max Possible
sps_cbc.sleep_instruments numeric 14 62

sps_total

Description :

sleep preoccupation scale total (high scores = more preoccupation, low scores = low preoccupation)

Variable Name Type Min Possible Max Possible
sps_total.sleep_instruments numeric 33 127

sleep_profiler

Description :

The Sleep Profiler provides detailed information on rapid eye movement, the percentage of sleep you get overall and other aspects of sleep quality.

References :

  • Levendowski, D., Walsh, C., Boeve, B., Lee-Iannotti, J., Salat, D., Hamilton, J., … & Louis, E. S. (2022). 0269 Non-REM sleep Hypertonia in Parkinsonian-Spectrum Disorders. Sleep, 45(Supplement_1), A121-A122.

actual_sleep_time_hrs_night_1

Description :

Total time spent in sleep stages across the first night

Variable Name Type Min Possible Max Possible
actual_sleep_time_hrs_night_1.sleep_profiler numeric 3.541667 8.775000

actual_sleep_time_hrs_night_2

Description :

Total time spent in sleep stages across the second night

Variable Name Type Min Possible Max Possible
actual_sleep_time_hrs_night_2.sleep_profiler numeric 3.541667 9.008333

actual_sleep_time_hrs_night_3

Description :

Total time spent in sleep stages across the third night

Variable Name Type Min Possible Max Possible
actual_sleep_time_hrs_night_3.sleep_profiler numeric 2.975000 8.316667

actual_sleep_time_hrs_night_4

Description :

Total time spent in sleep stages across the fourth night

Variable Name All Possible Values (Categorical) Type
actual_sleep_time_hrs_night_4.sleep_profiler 4.066667, 6.166667, 6.291667, 6.600000, 7.516667 numeric

actual_sleep_time_hrs_night_5

Description :

Total time spent in sleep stages across the fifth night

Variable Name All Possible Values (Categorical) Type
actual_sleep_time_hrs_night_5.sleep_profiler 3.966667, 4.333333, 9.616667 numeric

actual_sleep_time_hrs_night_6

Description :

Total time spent in sleep stages across the sixth night

Variable Name All Possible Values (Categorical) Type
actual_sleep_time_hrs_night_6.sleep_profiler 6.016667 numeric

invalid_time_hrs_night_1

Description :

Invalid sleep time during night 1(not used to calculate summary variables)

Variable Name Type Min Possible Max Possible
invalid_time_hrs_night_1.sleep_profiler numeric 0.000000000 3.408333000

invalid_time_hrs_night_2

Description :

Invalid sleep time during night 2(not used to calculate summary variables)

Variable Name Type Min Possible Max Possible
invalid_time_hrs_night_2.sleep_profiler numeric 0.000000000 4.491667000

invalid_time_hrs_night_3

Description :

Invalid sleep time during night 3(not used to calculate summary variables)

Variable Name Type Min Possible Max Possible
invalid_time_hrs_night_3.sleep_profiler numeric 0.000000000 4.666667000

invalid_time_hrs_night_4

Description :

Invalid sleep time during night 4(not used to calculate summary variables)

Variable Name All Possible Values (Categorical) Type
invalid_time_hrs_night_4.sleep_profiler 0.00000000, 0.03333334, 0.16666670 numeric

invalid_time_hrs_night_5

Description :

Invalid sleep time during night 5(not used to calculate summary variables)

Variable Name All Possible Values (Categorical) Type
invalid_time_hrs_night_5.sleep_profiler 0.000000, 2.841667 numeric

invalid_time_hrs_night_6

Description :

Invalid sleep time during night 6(not used to calculate summary variables)

Variable Name All Possible Values (Categorical) Type
invalid_time_hrs_night_6.sleep_profiler 0.01666667 numeric

n1_delta_night_1

Description :

Average delta power duing N1 epochs on night 1

Variable Name Type Min Possible Max Possible
n1_delta_night_1.sleep_profiler numeric 0.08240977 0.99258361

n1_delta_night_2

Description :

Average delta power duing N1 epochs on night 2

Variable Name Type Min Possible Max Possible
n1_delta_night_2.sleep_profiler numeric 0.09493082 0.66833355

n1_delta_night_3

Description :

Average delta power duing N1 epochs on night 3

Variable Name Type Min Possible Max Possible
n1_delta_night_3.sleep_profiler numeric 0.08832198 0.85857893

n1_delta_night_4

Description :

Average delta power duing N1 epochs on night 4

Variable Name All Possible Values (Categorical) Type
n1_delta_night_4.sleep_profiler 0.1049325, 0.1298847, 0.1374232, 0.1520938, 0.1643450 numeric

n1_delta_night_5

Description :

Average delta power duing N1 epochs on night 5

Variable Name All Possible Values (Categorical) Type
n1_delta_night_5.sleep_profiler 0.1550275, 0.1909848, 0.2064550 numeric

n1_delta_night_6

Description :

Average delta power duing N1 epochs on night 6

Variable Name All Possible Values (Categorical) Type
n1_delta_night_6.sleep_profiler 0.1335652 numeric

n1_time_hrs_night_1

Description :

Time spent in N1 sleep (light sleep) across the night during night 1

Variable Name Type Min Possible Max Possible
n1_time_hrs_night_1.sleep_profiler numeric 0.05833333 0.70833330

n1_time_hrs_night_2

Description :

Time spent in N1 sleep (light sleep) across the night during night 2

Variable Name Type Min Possible Max Possible
n1_time_hrs_night_2.sleep_profiler numeric 0.05833333 1.20833300

n1_time_hrs_night_3

Description :

Time spent in N1 sleep (light sleep) across the night during night 3

Variable Name Type Min Possible Max Possible
n1_time_hrs_night_3.sleep_profiler numeric 0.05000000 1.35000000

n1_time_hrs_night_4

Description :

Time spent in N1 sleep (light sleep) across the night during night 4

Variable Name All Possible Values (Categorical) Type
n1_time_hrs_night_4.sleep_profiler 0.1583333, 0.1750000, 0.2083333, 0.5250000 numeric

n1_time_hrs_night_5

Description :

Time spent in N1 sleep (light sleep) across the night during night 5

Variable Name All Possible Values (Categorical) Type
n1_time_hrs_night_5.sleep_profiler 0.1833333, 0.1916667, 0.3750000 numeric

n1_time_hrs_night_6

Description :

Time spent in N1 sleep (light sleep) across the night during night 6

Variable Name All Possible Values (Categorical) Type
n1_time_hrs_night_6.sleep_profiler 0.1416667 numeric

n2_delta_night_1

Description :

Average delta power duing N2 epochs during night 1

Variable Name Type Min Possible Max Possible
n2_delta_night_1.sleep_profiler numeric 0.1048906 0.8912354

n2_delta_night_2

Description :

Average delta power duing N2 epochs during night 2

Variable Name Type Min Possible Max Possible
n2_delta_night_2.sleep_profiler numeric 0.1041672 0.3071150

n2_delta_night_3

Description :

Average delta power duing N2 epochs during night 3

Variable Name Type Min Possible Max Possible
n2_delta_night_3.sleep_profiler numeric 0.1107100 0.9062055

n2_delta_night_4

Variable Name All Possible Values (Categorical) Type
n2_delta_night_4.sleep_profiler 0.1314645, 0.1476429, 0.1476847, 0.1533604, 0.3593146 numeric

n2_delta_night_5

Variable Name All Possible Values (Categorical) Type
n2_delta_night_5.sleep_profiler 0.1352762, 0.1682801, 0.1762796 numeric

n2_delta_night_6

Variable Name All Possible Values (Categorical) Type
n2_delta_night_6.sleep_profiler 0.1431319 numeric

n2_time_hrs_night_1

Description :

Time spent in N2 sleep across the night during night 1

Variable Name Type Min Possible Max Possible
n2_time_hrs_night_1.sleep_profiler numeric 1.208333 5.550000

n2_time_hrs_night_2

Description :

Time spent in N2 sleep across the night during night 2

Variable Name Type Min Possible Max Possible
n2_time_hrs_night_2.sleep_profiler numeric 1.166667 5.516667

n2_time_hrs_night_3

Description :

Time spent in N2 sleep across the night during night 3

Variable Name Type Min Possible Max Possible
n2_time_hrs_night_3.sleep_profiler numeric 0.625000 5.291667

n2_time_hrs_night_4

Variable Name All Possible Values (Categorical) Type
n2_time_hrs_night_4.sleep_profiler 1.550000, 3.000000, 3.508333, 3.516667, 4.641667 numeric

n2_time_hrs_night_5

Variable Name All Possible Values (Categorical) Type
n2_time_hrs_night_5.sleep_profiler 1.350000, 3.666667, 5.375000 numeric

n2_time_hrs_night_6

Variable Name All Possible Values (Categorical) Type
n2_time_hrs_night_6.sleep_profiler 3.466667 numeric

n3_delta_night_1

Description :

Average delta power duing N3 epochs during night 1

Variable Name Type Min Possible Max Possible
n3_delta_night_1.sleep_profiler numeric 0.1546968 0.9048144

n3_delta_night_2

Description :

Average delta power duing N3 epochs during night 2

Variable Name Type Min Possible Max Possible
n3_delta_night_2.sleep_profiler numeric 0.1271705 0.3579841

n3_delta_night_3

Description :

Average delta power duing N3 epochs during night 3

Variable Name Type Min Possible Max Possible
n3_delta_night_3.sleep_profiler numeric 0.1503306 0.4133622

n3_delta_night_4

Variable Name All Possible Values (Categorical) Type
n3_delta_night_4.sleep_profiler 0.1748096, 0.2030818, 0.2121810, 0.2125902, 0.2272466 numeric

n3_delta_night_5

Variable Name All Possible Values (Categorical) Type
n3_delta_night_5.sleep_profiler 0.1595341, 0.2050501, 0.2423254 numeric

n3_delta_night_6

Variable Name All Possible Values (Categorical) Type
n3_delta_night_6.sleep_profiler 0.1834426 numeric

n3_time_hrs_night_1

Description :

Time spent in N3 sleep (SWS sleep) across the night during night 1

Variable Name Type Min Possible Max Possible
n3_time_hrs_night_1.sleep_profiler numeric 0.000000000 3.025000000

n3_time_hrs_night_2

Description :

Time spent in N3 sleep (SWS sleep) across the night during night 2

Variable Name Type Min Possible Max Possible
n3_time_hrs_night_2.sleep_profiler numeric 0.00000000 4.21666700

n3_time_hrs_night_3

Description :

Time spent in N3 sleep (SWS sleep) across the night during night 3

Variable Name Type Min Possible Max Possible
n3_time_hrs_night_3.sleep_profiler numeric 0.000000000 3.500000000

n3_time_hrs_night_4

Variable Name All Possible Values (Categorical) Type
n3_time_hrs_night_4.sleep_profiler 0.4583333, 0.4750000, 0.9250000, 1.4250000, 1.9583330 numeric

n3_time_hrs_night_5

Variable Name All Possible Values (Categorical) Type
n3_time_hrs_night_5.sleep_profiler 0.008333334, 0.358333300, 1.200000000 numeric

n3_time_hrs_night_6

Variable Name All Possible Values (Categorical) Type
n3_time_hrs_night_6.sleep_profiler 0.25 numeric

percent_night_in_n1_night_1

Description :

Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 1)

Variable Name Type Min Possible Max Possible
percent_night_in_n1_night_1.sleep_profiler numeric 1.136364 20.000000

percent_night_in_n1_night_2

Description :

Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 2)

Variable Name Type Min Possible Max Possible
percent_night_in_n1_night_2.sleep_profiler numeric 0.7667032 29.7741300

percent_night_in_n1_night_3

Description :

Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 3)

Variable Name Type Min Possible Max Possible
percent_night_in_n1_night_3.sleep_profiler numeric 0.6993007 25.1141500

percent_night_in_n1_night_4

Variable Name All Possible Values (Categorical) Type
percent_night_in_n1_night_4.sleep_profiler 2.328160, 3.156566, 3.378378, 3.893443, 8.344371 numeric

percent_night_in_n1_night_5

Variable Name All Possible Values (Categorical) Type
percent_night_in_n1_night_5.sleep_profiler 3.899480, 4.423077, 4.621849 numeric

percent_night_in_n1_night_6

Variable Name All Possible Values (Categorical) Type
percent_night_in_n1_night_6.sleep_profiler 2.354571 numeric

percent_night_in_n2_night_1

Description :

Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 1)

Variable Name Type Min Possible Max Possible
percent_night_in_n2_night_1.sleep_profiler numeric 25.43860 81.27208

percent_night_in_n2_night_2

Description :

Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 2)

Variable Name Type Min Possible Max Possible
percent_night_in_n2_night_2.sleep_profiler numeric 19.70398 75.33113

percent_night_in_n2_night_3

Description :

Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 3)

Variable Name Type Min Possible Max Possible
percent_night_in_n2_night_3.sleep_profiler numeric 15.36885 76.76399

percent_night_in_n2_night_4

Variable Name All Possible Values (Categorical) Type
percent_night_in_n2_night_4.sleep_profiler 38.11475, 48.64865, 53.28283, 55.76159, 61.75166 numeric

percent_night_in_n2_night_5

Variable Name All Possible Values (Categorical) Type
percent_night_in_n2_night_5.sleep_profiler 34.03362, 55.89255, 84.61539 numeric

percent_night_in_n2_night_6

Variable Name All Possible Values (Categorical) Type
percent_night_in_n2_night_6.sleep_profiler 57.61773 numeric

percent_night_in_n3_night_1

Description :

Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 1)

Variable Name Type Min Possible Max Possible
percent_night_in_n3_night_1.sleep_profiler numeric 0.0000000 50.0000000

percent_night_in_n3_night_2

Description :

Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 2)

Variable Name Type Min Possible Max Possible
percent_night_in_n3_night_2.sleep_profiler numeric 0.0000000 55.6742300

percent_night_in_n3_night_3

Description :

Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 3)

Variable Name Type Min Possible Max Possible
percent_night_in_n3_night_3.sleep_profiler numeric 0.0000000 67.6229600

percent_night_in_n3_night_4

Variable Name All Possible Values (Categorical) Type
percent_night_in_n3_night_4.sleep_profiler 6.097561, 7.549669, 14.015150, 31.756760, 35.040980 numeric

percent_night_in_n3_night_5

Variable Name All Possible Values (Categorical) Type
percent_night_in_n3_night_5.sleep_profiler 0.1923077, 3.7261700, 30.2521000 numeric

percent_night_in_n3_night_6

Variable Name All Possible Values (Categorical) Type
percent_night_in_n3_night_6.sleep_profiler 4.155125 numeric

percent_night_in_rem_night_1

Description :

Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 1)

Variable Name Type Min Possible Max Possible
percent_night_in_rem_night_1.sleep_profiler numeric 12.59398 39.68254

percent_night_in_rem_night_2

Description :

Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 2)

Variable Name Type Min Possible Max Possible
percent_night_in_rem_night_2.sleep_profiler numeric 6.361829 42.214530

percent_night_in_rem_night_3

Description :

Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 3)

Variable Name Type Min Possible Max Possible
percent_night_in_rem_night_3.sleep_profiler numeric 13.44538 45.89041

percent_night_in_rem_night_4

Variable Name All Possible Values (Categorical) Type
percent_night_in_rem_night_4.sleep_profiler 16.21622, 22.95082, 28.34437, 29.41919, 29.82261 numeric

percent_night_in_rem_night_5

Variable Name All Possible Values (Categorical) Type
percent_night_in_rem_night_5.sleep_profiler 10.76923, 31.09244, 36.48180 numeric

percent_night_in_rem_night_6

Variable Name All Possible Values (Categorical) Type
percent_night_in_rem_night_6.sleep_profiler 35.87257 numeric

rem_delta_night_1

Description :

Average delta power duing REM epochs (Night 1)

Variable Name Type Min Possible Max Possible
rem_delta_night_1.sleep_profiler numeric 0.08191241 0.67787162

rem_delta_night_2

Description :

Average delta power duing REM epochs (Night 2)

Variable Name Type Min Possible Max Possible
rem_delta_night_2.sleep_profiler numeric 0.08790630 0.30564024

rem_delta_night_3

Description :

Average delta power duing REM epochs (Night 3)

Variable Name Type Min Possible Max Possible
rem_delta_night_3.sleep_profiler numeric 0.07753680 0.89780582

rem_delta_night_4

Variable Name All Possible Values (Categorical) Type
rem_delta_night_4.sleep_profiler 0.1151842, 0.1241935, 0.1433784, 0.1553233, 0.5109914 numeric

rem_delta_night_5

Variable Name All Possible Values (Categorical) Type
rem_delta_night_5.sleep_profiler 0.1142421, 0.1540582, 0.1652997 numeric

rem_delta_night_6

Variable Name All Possible Values (Categorical) Type
rem_delta_night_6.sleep_profiler 0.1398343 numeric

rem_time_hrs_night_1

Description :

Time spent in REM sleep across the night (Night 1)

Variable Name Type Min Possible Max Possible
rem_time_hrs_night_1.sleep_profiler numeric 0.5583333 2.5000000

rem_time_hrs_night_2

Description :

Time spent in REM sleep across the night (Night 2)

Variable Name Type Min Possible Max Possible
rem_time_hrs_night_2.sleep_profiler numeric 0.2666667 2.7833330

rem_time_hrs_night_3

Description :

Time spent in REM sleep across the night (Night 3)

Variable Name Type Min Possible Max Possible
rem_time_hrs_night_3.sleep_profiler numeric 0.4000000 2.5583330

rem_time_hrs_night_4

Variable Name All Possible Values (Categorical) Type
rem_time_hrs_night_4.sleep_profiler 0.9333333, 1.0000000, 1.7833330, 1.9416670, 2.2416670 numeric

rem_time_hrs_night_5

Variable Name All Possible Values (Categorical) Type
rem_time_hrs_night_5.sleep_profiler 0.4666667, 1.2333330, 3.5083330 numeric

rem_time_hrs_night_6

Variable Name All Possible Values (Categorical) Type
rem_time_hrs_night_6.sleep_profiler 2.158333 numeric

sleep_efficiency_percent_night_1

Description :

Actual sleep time divided by Time In Bed X 100 (Night 1)

Variable Name Type Min Possible Max Possible
sleep_efficiency_percent_night_1.sleep_profiler numeric 33.65004 96.04366

sleep_efficiency_percent_night_2

Description :

Actual sleep time divided by Time In Bed X 100 (Night 2)

Variable Name Type Min Possible Max Possible
sleep_efficiency_percent_night_2.sleep_profiler numeric 42.01898 97.86781

sleep_efficiency_percent_night_3

Description :

Actual sleep time divided by Time In Bed X 100 (Night 3)

Variable Name Type Min Possible Max Possible
sleep_efficiency_percent_night_3.sleep_profiler numeric 41.91388 96.90844

sleep_efficiency_percent_night_4

Variable Name All Possible Values (Categorical) Type
sleep_efficiency_percent_night_4.sleep_profiler 54.16204, 66.51982, 71.98444, 82.75862, 85.25520 numeric

sleep_efficiency_percent_night_5

Variable Name All Possible Values (Categorical) Type
sleep_efficiency_percent_night_5.sleep_profiler 63.29787, 77.38096, 80.19458 numeric

sleep_efficiency_percent_night_6

Variable Name All Possible Values (Categorical) Type
sleep_efficiency_percent_night_6.sleep_profiler 76.89031 numeric

sleep_latency_mins_night_1

Description :

Minutes required to fall asleep (Night 1)

Variable Name Type Min Possible Max Possible
sleep_latency_mins_night_1.sleep_profiler numeric 1 175

sleep_latency_mins_night_2

Description :

Minutes required to fall asleep (Night 2)

Variable Name Type Min Possible Max Possible
sleep_latency_mins_night_2.sleep_profiler numeric 2 69

sleep_latency_mins_night_3

Description :

Minutes required to fall asleep (Night 3)

Variable Name Type Min Possible Max Possible
sleep_latency_mins_night_3.sleep_profiler numeric 1 115

sleep_latency_mins_night_4

Variable Name All Possible Values (Categorical) Type
sleep_latency_mins_night_4.sleep_profiler 7, 9, 11, 19, 23 numeric

sleep_latency_mins_night_5

Variable Name All Possible Values (Categorical) Type
sleep_latency_mins_night_5.sleep_profiler 9, 16 numeric

sleep_latency_mins_night_6

Variable Name All Possible Values (Categorical) Type
sleep_latency_mins_night_6.sleep_profiler 34 numeric

startdate

Variable Name Type Min Possible Max Possible
startdate.sleep_profiler Date 2018-08-28 2022-11-14

time_in_bed_hrs_night_1

Description :

Time spent in bed from start of recording to end of recording (Night 1)

Variable Name Type Min Possible Max Possible
time_in_bed_hrs_night_1.sleep_profiler numeric 5.200000 11.025000

time_in_bed_hrs_night_2

Description :

Time spent in bed from start of recording to end of recording (Night 2)

Variable Name Type Min Possible Max Possible
time_in_bed_hrs_night_2.sleep_profiler numeric 6.075000 11.996390

time_in_bed_hrs_night_3

Description :

Time spent in bed from start of recording to end of recording (Night 3)

Variable Name Type Min Possible Max Possible
time_in_bed_hrs_night_3.sleep_profiler numeric 4.675000 11.996390

time_in_bed_hrs_night_4

Description :

Time spent in bed from start of recording to end of recording (Night 4)

Variable Name All Possible Values (Categorical) Type
time_in_bed_hrs_night_4.sleep_profiler 7.508333, 7.975000, 8.566667, 8.816667, 9.460834 numeric

time_in_bed_hrs_night_5

Description :

Time spent in bed from start of recording to end of recording (Night 5)

Variable Name All Possible Values (Categorical) Type
time_in_bed_hrs_night_5.sleep_profiler 5.600000, 6.266667, 11.991670 numeric

time_in_bed_hrs_night_6

Description :

Time spent in bed from start of recording to end of recording (Night 6)

Variable Name All Possible Values (Categorical) Type
time_in_bed_hrs_night_6.sleep_profiler 7.825 numeric

wake_after_sleep_onset_mins_night_1

Description :

Total minutes the participant was awake after sleep onset until the end of the recording (Night 1)

Variable Name Type Min Possible Max Possible
wake_after_sleep_onset_mins_night_1.sleep_profiler numeric 11 320

wake_after_sleep_onset_mins_night_2

Description :

Total minutes the participant was awake after sleep onset until the end of the recording (Night 2)

Variable Name Type Min Possible Max Possible
wake_after_sleep_onset_mins_night_2.sleep_profiler numeric 8 291

wake_after_sleep_onset_mins_night_3

Description :

Total minutes the participant was awake after sleep onset until the end of the recording (Night 3)

Variable Name Type Min Possible Max Possible
wake_after_sleep_onset_mins_night_3.sleep_profiler numeric 10 258

wake_after_sleep_onset_mins_night_4

Description :

Total minutes the participant was awake after sleep onset until the end of the recording (Night 4)

Variable Name All Possible Values (Categorical) Type
wake_after_sleep_onset_mins_night_4.sleep_profiler 59, 69, 136, 167, 199 numeric

wake_after_sleep_onset_mins_night_5

Description :

Total minutes the participant was awake after sleep onset until the end of the recording (Night 5)

Variable Name All Possible Values (Categorical) Type
wake_after_sleep_onset_mins_night_5.sleep_profiler 66, 121, 128 numeric

wake_after_sleep_onset_mins_night_6

Description :

Total minutes the participant was awake after sleep onset until the end of the recording (Night 6)

Variable Name All Possible Values (Categorical) Type
wake_after_sleep_onset_mins_night_6.sleep_profiler 72 numeric

wake_delta_night_1

Description :

Average delta power during wake epochs (Night 1)

Variable Name Type Min Possible Max Possible
wake_delta_night_1.sleep_profiler numeric 0.09730534 0.68893232

wake_delta_night_2

Description :

Average delta power during wake epochs (Night 2)

Variable Name Type Min Possible Max Possible
wake_delta_night_2.sleep_profiler numeric 0.1234879 0.4058309

wake_delta_night_3

Description :

Average delta power during wake epochs (Night 3)

Variable Name Type Min Possible Max Possible
wake_delta_night_3.sleep_profiler numeric 0.1280672 0.5426953

wake_delta_night_4

Description :

Average delta power during wake epochs (Night 4)

Variable Name All Possible Values (Categorical) Type
wake_delta_night_4.sleep_profiler 0.1583221, 0.1711860, 0.1944113, 0.1977259, 0.2189980 numeric

wake_delta_night_5

Description :

Average delta power during wake epochs (Night 5)

Variable Name All Possible Values (Categorical) Type
wake_delta_night_5.sleep_profiler 0.1749399, 0.1808890, 0.2453625 numeric

wake_delta_night_6

Description :

Average delta power during wake epochs (Night 6)

Variable Name All Possible Values (Categorical) Type
wake_delta_night_6.sleep_profiler 0.2022863 numeric

wake_time_hrs_night_1

Description :

Time spent awake during the night (Night 1)

Variable Name Type Min Possible Max Possible
wake_time_hrs_night_1.sleep_profiler numeric 0.2416667 7.2416670

wake_time_hrs_night_2

Description :

Time spent awake during the night (Night 2)

Variable Name Type Min Possible Max Possible
wake_time_hrs_night_2.sleep_profiler numeric 0.1666667 5.6000000

wake_time_hrs_night_3

Description :

Time spent awake during the night (Night 3)

Variable Name Type Min Possible Max Possible
wake_time_hrs_night_3.sleep_profiler numeric 0.2166667 5.0583330

wake_time_hrs_night_4

Description :

Time spent awake during the night (Night 4)

Variable Name All Possible Values (Categorical) Type
wake_time_hrs_night_4.sleep_profiler 1.300000, 1.375000, 2.400000, 3.166667, 3.441667 numeric

wake_time_hrs_night_5

Description :

Time spent awake during the night (Night 5)

Variable Name All Possible Values (Categorical) Type
wake_time_hrs_night_5.sleep_profiler 1.266667, 2.300000, 2.375000 numeric

wake_time_hrs_night_6

Description :

Time spent awake during the night (Night 6)

Variable Name All Possible Values (Categorical) Type
wake_time_hrs_night_6.sleep_profiler 1.808333 numeric

social_network_index


ExerciseFreq

Variable Name Type
ExerciseFreq.social_network_index numeric

ExerciseYN

Variable Name All Possible Values (Categorical) Type
ExerciseYN.social_network_index 1, 2 numeric

SNI_HighContact

Variable Name Type
SNI_HighContact.social_network_index numeric

SNI_NumberPeople_socialmedia

Variable Name Type Min Possible Max Possible
SNI_NumberPeople_socialmedia.social_network_index numeric 1 174

SNI_NumberPeople

Variable Name Type Min Possible Max Possible
SNI_NumberPeople.social_network_index numeric 1 143

specimens


sample_id

Variable Name Type Min Possible Max Possible
sample_id.specimens numeric 329777 4077971

tabcat_animal_fluency

Description :

Animal Fluency is a widely used test of language generation. Examinees are asked to generate as many animals as possible in 1 minute, and the total correct is recorded.

References :

  • Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.

animal_fluency_task_language

Description :

Language of administration

Label Value
English English
Mandarin Mandarin
Spanish-MEX Spanish-MEX
Variable Name All Possible Values (Categorical) Type Value Labels
animal_fluency_task_language.tabcat_animal_fluency English, Mandarin, Spanish-MEX character English, Mandarin, Spanish-MEX

animal_fluency_task_version

Description :

TabCAT version

Label Value
1.0.0 1.0.0
3.0.0 3.0.0
Variable Name All Possible Values (Categorical) Type Value Labels
animal_fluency_task_version.tabcat_animal_fluency 1.0.0, 3.0.0 character 1.0.0, 3.0.0

animal_fluency_total_correct_z

Description :

Z-score adjusted for age, sex, education

Variable Name All Possible Values (Categorical) Type
animal_fluency_total_correct_z.tabcat_animal_fluency 22 numeric

animal_fluency_total_correct

Description :

Number of animals generated in 60-seconds

Variable Name All Possible Values (Categorical) Type
animal_fluency_total_correct.tabcat_animal_fluency 10, 18, 22, 23, 24 numeric

animal_fluency_total_repetitions

Description :

Number of repetition errors

Variable Name All Possible Values (Categorical) Type
animal_fluency_total_repetitions.tabcat_animal_fluency 0, 1, 2, 3, 4 numeric

animal_fluency_total_rule_violations

Description :

Number of rule violation errors

Variable Name All Possible Values (Categorical) Type
animal_fluency_total_rule_violations.tabcat_animal_fluency 0, 1 numeric

tabcat_bha

Description :

The Brain Health Assessment (BHA) battery includes two required tests (Favorites, Match), two optional tests (Line Orientation, Animal Fluency), and an optional informant survey (Brain Health Survey [BHS]). The battery is optimized for the accurate detection of MCI and mild dementia, reliably measures change over time, and provides a performance sample from each major cognitive domain.

References :

  • Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.

  • Tsoy E, Erlhoff SJ, Goode CA, Dorsman KA, Kanjanapong S, Lindbergh CA, La Joie R, Strom A, Rabinovici GD, Lanata SC, Miller BL, Tomaszewski Farias SE, Kramer JH, Rankin KP, Possin KL. BHA-CS: A novel cognitive composite for Alzheimer’s disease and related disorders. Alzheimers Dement (Amst). 2020 Jun 21;12(1):e12042. doi: 10.1002/dad2.12042. PMID: 32582835; PMCID: PMC7306517.

dont_worry_abt_col_names:

  • Moskowitz, T., Rabinowitz, N., Johnson, E., Huey, E., Kaufer, D., Small, G., … & Possin, K. (2016). The TabCAT brain health assessment: a highly efficient and sensitive approach to detecting very mild cognitive impairment (P5. 197). Neurology, 86(16_supplement), P5-197.

composite_bha_cs_short

Description :

a composite score combining results of only the two TabCAT required tests (Favorites, Match), calulated as: BHA CS-Short = ((1.753 + 0.946FavRegZ + 0.995MatRegZ) - 1.751)/1.509, where FavRegZ is the demographically adjusted regression-based z-score for Favorites Total Recall and MatRegZ is the demographically adjusted regression-based z-score for Match Total Correct

Variable Name Type
composite_bha_cs_short.tabcat_bha numeric

tabcat_fav

Description :

Favorites is a test of multimodal associative memory for visual and verbal information in which examinees are asked to remember faces paired with a food and animal word. The task consists of 2 Learning Trials, each followed by an Immediate Recall Trial, and a 10-minute Delayed Recall and Delayed Recognition trials.

References :

  • Thompson, L. I., Kunicki, Z. J., Emrani, S., Strenger, J., De Vito, A. N., Britton, K. J., … & Jones, R. N. (2023). Remote and in‐clinic digital cognitive screening tools outperform the MoCA to distinguish cerebral amyloid status among cognitively healthy older adults. Alzheimer’s & Dementia: Diagnosis, Assessment & Disease Monitoring, 15(4), e12500.

fav_delay_total_correct_z

Description :

Z-score of the total number of correct responses

Variable Name Type
fav_delay_total_correct_z.tabcat_fav numeric

fav_delay_total_correct

Description :

total number of correct responses given

Variable Name Type
fav_delay_total_correct.tabcat_fav numeric

fav_delay_total_dk

Description :

total number of “DK”: don’t know, where the examinee did not give a response

Variable Name Type
fav_delay_total_dk.tabcat_fav numeric

fav_delay_total_intrusions

Description :

total number of “INT”: intrusion, where the response given was not presented during the trial

Variable Name Type
fav_delay_total_intrusions.tabcat_fav numeric

fav_delay_total_sme

Description :

total number of “SME”: source memory error, where the response given was incorrectly matched

Variable Name Type
fav_delay_total_sme.tabcat_fav numeric

fav_learn_r1_animal1score

Description :

Recall 1 Animal 1 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r1_animal1score.tabcat_fav correct, DK, INT, SME character

fav_learn_r1_animal2score

Description :

Recall 1 Animal 2 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r1_animal2score.tabcat_fav correct, DK, INT, SME character

fav_learn_r1_animal3score

Description :

Recall 1 Animal 3 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r1_animal3score.tabcat_fav correct, DK, INT, SME character

fav_learn_r1_animal4score

Description :

Recall 1 Animal 4 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r1_animal4score.tabcat_fav correct, DK, INT, SME character

fav_learn_r1_food1score

Description :

Recall 1 Food 1 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r1_food1score.tabcat_fav correct, DK, INT, SME character

fav_learn_r1_food2score

Description :

Recall 1 Food 2 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r1_food2score.tabcat_fav correct, DK, INT, SME character

fav_learn_r1_food3score

Description :

Recall 1 Food 3 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r1_food3score.tabcat_fav correct, DK, INT, SME character

fav_learn_r1_food4score

Description :

Recall 1 Food 4 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r1_food4score.tabcat_fav correct, DK, INT, SME character

fav_learn_r1_total_correct_z

Description :

Z-score of total number of correct responses across Recall 1

Variable Name Type
fav_learn_r1_total_correct_z.tabcat_fav numeric

fav_learn_r1_total_correct

Description :

Total number of correct responses across Recall 1

Variable Name Type
fav_learn_r1_total_correct.tabcat_fav numeric

fav_learn_r1_total_dk

Description :

Total number of Don’t Know responses across Recall 1, i.e., giving no response

Variable Name Type
fav_learn_r1_total_dk.tabcat_fav numeric

fav_learn_r1_total_intrusions

Description :

Total number of Intrusion responses across Recall 1, i.e., giving a food/animal that was not presented during the trial

Variable Name Type
fav_learn_r1_total_intrusions.tabcat_fav numeric

fav_learn_r1_total_sme

Description :

Total number of SME responses across Recall 1, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face

Variable Name Type
fav_learn_r1_total_sme.tabcat_fav numeric

fav_learn_r2_animal1score

Description :

Recall 2 Animal 1 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r2_animal1score.tabcat_fav correct, DK, INT, SME character

fav_learn_r2_animal2score

Description :

Recall 2 Animal 2 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r2_animal2score.tabcat_fav correct, DK, INT, SME character

fav_learn_r2_animal3score

Description :

Recall 2 Animal 3 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r2_animal3score.tabcat_fav correct, DK, INT, SME character

fav_learn_r2_animal4score

Description :

Recall 2 Animal 4 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r2_animal4score.tabcat_fav correct, DK, INT, SME character

fav_learn_r2_food1score

Description :

Recall 2 Food 1 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r2_food1score.tabcat_fav correct, DK, INT, SME character

fav_learn_r2_food2score

Description :

Recall 2 Food 2 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r2_food2score.tabcat_fav correct, DK, INT, SME character

fav_learn_r2_food3score

Description :

Recall 2 Food 3 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r2_food3score.tabcat_fav correct, DK, INT, SME character

fav_learn_r2_food4score

Description :

Recall 2 Food 4 score

Variable Name All Possible Values (Categorical) Type
fav_learn_r2_food4score.tabcat_fav correct, DK, INT, SME character

fav_learn_r2_total_correct_z

Description :

Z-score of total number of correct responses across Recall 2

Variable Name Type
fav_learn_r2_total_correct_z.tabcat_fav numeric

fav_learn_r2_total_correct

Description :

Total number of correct responses across Recall 2

Variable Name Type
fav_learn_r2_total_correct.tabcat_fav numeric

fav_learn_r2_total_dk

Description :

Total number of Don’t Know responses across Recall 2, i.e., giving no response

Variable Name Type
fav_learn_r2_total_dk.tabcat_fav numeric

fav_learn_r2_total_intrusions

Description :

Total number of Intrusion responses across Recall 2, i.e., giving a food/animal that was not presented during the trial

Variable Name Type
fav_learn_r2_total_intrusions.tabcat_fav numeric

fav_learn_r2_total_sme

Description :

Total number of SME responses across Recall 2, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face

Variable Name Type
fav_learn_r2_total_sme.tabcat_fav numeric

fav_learn_task_duration

Description :

Total amount of time spent on the learning tasks, in minutes

Variable Name Type Min Possible Max Possible
fav_learn_task_duration.tabcat_fav numeric 0 Infinity

fav_learn_task_form

Description :

The task form chosen

Variable Name All Possible Values (Categorical) Type
fav_learn_task_form.tabcat_fav A, B, C, D character

fav_learn_task_language

Description :

Testing language used during the task

Variable Name Type
fav_learn_task_language.tabcat_fav character

fav_learn_task_version

Description :

Task version of the assessment, different versions have major revisions to the task

Variable Name All Possible Values (Categorical) Type
fav_learn_task_version.tabcat_fav 1.0.0, 3.0.0 character

fav_rec_bias

Description :

Score that reflects the response bias across all Favorites Recognition trials. Higher scores reflect worse performance

Variable Name Type Min Possible Max Possible
fav_rec_bias.tabcat_fav numeric (-) Infinity Infinity

fav_rec_d_prime

Description :

Score that reflects the recognition discriminability accuracy across all Favorites Recognition trials. Higher scores reflect better performance

Variable Name Type Min Possible Max Possible
fav_rec_d_prime.tabcat_fav numeric (-) Infinity Infinity

fav_rec_task_duration

Description :

Total amount of time spent on the task, in minutes

Variable Name Type Min Possible Max Possible
fav_rec_task_duration.tabcat_fav numeric 0 Infinity

fav_rec_task_form

Description :

The task form chosen

Variable Name All Possible Values (Categorical) Type
fav_rec_task_form.tabcat_fav A, B, C, D character

fav_rec_task_language

Description :

Testing language used during the task

Variable Name Type
fav_rec_task_language.tabcat_fav character

fav_rec_task_version

Description :

Task version of the assessment, different versions have major revisions to the task

Variable Name All Possible Values (Categorical) Type
fav_rec_task_version.tabcat_fav 1.0.0, 3.0.0 character

fav_rec_total_false_negative

Description :

Total number of false negative scores across all 24 trials

Variable Name Type
fav_rec_total_false_negative.tabcat_fav numeric

fav_rec_total_false_positive

Description :

Total number of false positive scores across all 24 trials

Variable Name Type Min Possible Max Possible
fav_rec_total_false_positive.tabcat_fav numeric 0 16

fav_rec_total_true_negative

Description :

Total number of true negative scores across all 24 trials

Variable Name Type Min Possible Max Possible
fav_rec_total_true_negative.tabcat_fav numeric 0 16

fav_rec_total_true_positive

Description :

Total number of true positive scores across all 24 trials

Variable Name Type
fav_rec_total_true_positive.tabcat_fav numeric

favorites_all_trials_total_correct_z

Description :

Z-score of the total number of correct responses across all three trials: Recall 1, Recall 2, and Delayed Recall

Variable Name Type
favorites_all_trials_total_correct_z.tabcat_fav numeric

favorites_all_trials_total_correct

Description :

Total number of correct responses across all three trials: Recall 1, Recall 2, and Delayed Recall

Variable Name Type Min Possible Max Possible
favorites_all_trials_total_correct.tabcat_fav numeric 0 24

favorites_all_trials_total_dk

Description :

Number of Don’t Know responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving no response

Variable Name Type Min Possible Max Possible
favorites_all_trials_total_dk.tabcat_fav numeric 0 24

favorites_all_trials_total_intrusions

Description :

Number of Intrusion responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving a food/animal that was not presented during the trial

Variable Name Type Min Possible Max Possible
favorites_all_trials_total_intrusions.tabcat_fav numeric 0 24

favorites_all_trials_total_sme

Description :

Number of SME responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face

Variable Name Type Min Possible Max Possible
favorites_all_trials_total_sme.tabcat_fav numeric 0 24

tabcat_flanker


flanker_congr_correct_median_rt

Variable Name Type Min Possible Max Possible
flanker_congr_correct_median_rt.tabcat_flanker numeric 0.5671260 2.3457495

flanker_congr_correct_total

Variable Name Type
flanker_congr_correct_total.tabcat_flanker numeric

flanker_correct_median_rt

Variable Name Type Min Possible Max Possible
flanker_correct_median_rt.tabcat_flanker numeric 0.6335810 2.3457495

flanker_correct_st_dev_rt

Variable Name Type Min Possible Max Possible
flanker_correct_st_dev_rt.tabcat_flanker numeric 0.06286568 0.78552673

flanker_correct_total

Variable Name Type
flanker_correct_total.tabcat_flanker numeric

flanker_incongr_correct_median_rt

Variable Name Type Min Possible Max Possible
flanker_incongr_correct_median_rt.tabcat_flanker numeric 0.5144560 3.5945000

flanker_incongr_correct_total

Variable Name Type Min Possible Max Possible
flanker_incongr_correct_total.tabcat_flanker numeric 0 16

flanker_practice_trial_success

Variable Name All Possible Values (Categorical) Type
flanker_practice_trial_success.tabcat_flanker FALSE, TRUE logical

flanker_pt_set1_total_correct

Variable Name Type
flanker_pt_set1_total_correct.tabcat_flanker numeric

flanker_pt_set2_total_correct

Variable Name Type
flanker_pt_set2_total_correct.tabcat_flanker numeric

flanker_task_duration

Variable Name Type Min Possible Max Possible
flanker_task_duration.tabcat_flanker numeric 0 291

flanker_task_language

Variable Name All Possible Values (Categorical) Type
flanker_task_language.tabcat_flanker English, Spanish (Argentina, Uruguay), Spanish (MEX, ESP, Central America), Spanish-MEX character

flanker_task_version

Variable Name All Possible Values (Categorical) Type
flanker_task_version.tabcat_flanker 1.0.0, 1.1.0, 3.0.0 character

flanker_total_score_z

Variable Name Type Min Possible Max Possible
flanker_total_score_z.tabcat_flanker numeric 0.924528 -5.415094

flanker_total_score

Variable Name Type Min Possible Max Possible
flanker_total_score.tabcat_flanker numeric 0.313000 9.822000

tabcat_ll

Description :

Line Length is a test of visuospatial skills. Examinees are shown two parallel white lines of differing lengths on a navy background and asked to tap the longer line of the two lines. The difference in length between the two lines shortens with response accuracy and lengthens when an incorrect response is made. There are ten easy catch trials interspersed throughout the task to indicate task validity.


ll_avg_time_per_trial

Description :

Mean reaction time across all task trials

Variable Name Type Min Possible Max Possible
ll_avg_time_per_trial.tabcat_ll numeric 0 Infinity

ll_catch_trial_score

Description :

Percent of total correct catch trials, a Catch Trials score < 80 indicates that the Threshold Score may not be valid

Variable Name Type
ll_catch_trial_score.tabcat_ll numeric

ll_catch_trial1

Description :

Catch Trial 1: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial1.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial10

Description :

Catch Trial 10: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial10.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial2

Description :

Catch Trial 2: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial2.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial3

Description :

Catch Trial 3: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial3.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial4

Description :

Catch Trial 4: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial4.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial5

Description :

Catch Trial 5: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial5.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial6

Description :

Catch Trial 6: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial6.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial7

Description :

Catch Trial 7: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial7.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial8

Description :

Catch Trial 8: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial8.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_catch_trial9

Description :

Catch Trial 9: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_catch_trial9.tabcat_ll FALSE, TRUE character Incorrect, Correct

ll_highest_consecutive_timed_out

Description :

Highest consecutive number of trials in which the examinee ran out of time before giving a response

Variable Name All Possible Values (Categorical) Type
ll_highest_consecutive_timed_out.tabcat_ll 0, 3 numeric

ll_median_time_per_trial

Description :

Median reaction time across all task trials

Variable Name Type Min Possible Max Possible
ll_median_time_per_trial.tabcat_ll numeric 0 Infinity

ll_practice_trials_success

Description :

Indication of whether the examinee completed the practice trial set successfully

Label Value
0 Incorrect
1 Correct
Variable Name All Possible Values (Categorical) Type Value Labels
ll_practice_trials_success.tabcat_ll 0,1 categorical Incorrect, Correct

ll_r1

Description :

Reversal 1: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r1.tabcat_ll numeric 1 50

ll_r10

Description :

Reversal 10: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r10.tabcat_ll numeric 1 50

ll_r2

Description :

Reversal 2: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r2.tabcat_ll numeric 1 50

ll_r3

Description :

Reversal 3: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r3.tabcat_ll numeric 1 50

ll_r4

Description :

Reversal 4: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r4.tabcat_ll numeric 1 50

ll_r5

Description :

Reversal 5: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r5.tabcat_ll numeric 1 50

ll_r6

Description :

Reversal 6: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r6.tabcat_ll numeric 1 50

ll_r7

Description :

Reversal 7: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r7.tabcat_ll numeric 1 50

ll_r8

Description :

Reversal 8: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r8.tabcat_ll numeric 1 50

ll_r9

Description :

Reversal 9: The intensity of the difference in line lengths at the time of reversal

Variable Name Type Min Possible Max Possible
ll_r9.tabcat_ll numeric 1 50

ll_task_duration

Description :

Total amount of time spent on the task, in minutes

Variable Name Type Min Possible Max Possible
ll_task_duration.tabcat_ll numeric 0 Infinity

ll_task_language

Description :

Testing language used during the task

Variable Name Type
ll_task_language.tabcat_ll character

ll_task_version

Description :

Task version of the assessment, different versions have major revisions to the task

Variable Name All Possible Values (Categorical) Type
ll_task_version.tabcat_ll 1.0.0, 1.1.0, 3.0.0 character

ll_threshold_score_3_10_z

Description :

Z-score of the threshold score across reversals 3:10

Variable Name All Possible Values (Categorical) Type
ll_threshold_score_3_10_z.tabcat_ll 0.480469, 0.921875 numeric

ll_threshold_score_3_10

Description :

Primary performance metric: Average intensity of the difference in line lengths at the time of reversal across reversals 3:10, i.e., mean of LL_R3:LL_R10. Otherwise explained as: the average length difference between the two lines at which the probability of the examinee responding accurately is 75%. Scores are reported on a continuous scale with higher scores indicating worse performance

Variable Name Type Min Possible Max Possible
ll_threshold_score_3_10.tabcat_ll numeric 1 Infinity

ll_total_catch_trials_timed_out

Description :

Total number of catch trials in which the examinee ran out of time before giving a response

Variable Name All Possible Values (Categorical) Type
ll_total_catch_trials_timed_out.tabcat_ll 0, 1 numeric

ll_total_practice_trials_correct

Description :

Total number of correct responses given during practice trials

Variable Name All Possible Values (Categorical) Type
ll_total_practice_trials_correct.tabcat_ll 4 numeric

ll_total_practice_trials_timed_out

Description :

Total number of practice trials in which the examinee ran out of time before giving a response

Variable Name All Possible Values (Categorical) Type
ll_total_practice_trials_timed_out.tabcat_ll 0 numeric

ll_total_practice_trials

Description :

Total number of practice trials completed

Variable Name All Possible Values (Categorical) Type
ll_total_practice_trials.tabcat_ll 4 numeric

ll_total_task_trials_timed_out

Description :

Total number of task trials in which the examinee ran out of time before giving a response

Variable Name All Possible Values (Categorical) Type
ll_total_task_trials_timed_out.tabcat_ll 0, 5 numeric

ll_total_trials

Description :

Total number of task trials completed

Variable Name Type Min Possible Max Possible
ll_total_trials.tabcat_ll numeric 0 Infinity

tabcat_lo

Description :

TabCAT BHA Line Orientation is a test of visuospatial skills modeled after the Benton Judgment of Line Orientation. Examinees are shown 3 lines on a dark background: 1 white line and 2 shorter orange lines. One orange line is parallel to the white line and the other orange line is presented at a different angle. Examinees are asked to tap the orange line that is parallel to the target white line. Trial difficulty is manipulated by varying the angle difference between the non-match orange line and the white line. Difficulty is staircased based on response accuracy.

References :

  • Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.

lo_avg_time_per_trial

Description :

Mean reaction time across all task trials. In March 2022, the task was modified such that trials were cutoff at a limit of 8 seconds.

Variable Name Type Min Possible Max Possible
lo_avg_time_per_trial.tabcat_lo numeric 0 Infinity

lo_catch_trial_score

Description :

10 easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicate that the Threshold Score may not be valid.

Variable Name Type
lo_catch_trial_score.tabcat_lo numeric

lo_catch_trial1

Description :

Catch Trial 1: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial1.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial10

Description :

Catch Trial 10: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial10.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial2

Description :

Catch Trial 2: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial2.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial3

Description :

Catch Trial 3: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial3.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial4

Description :

Catch Trial 4: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial4.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial5

Description :

Catch Trial 5: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial5.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial6

Description :

Catch Trial 6: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial6.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial7

Description :

Catch Trial 7: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial7.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial8

Description :

Catch Trial 8: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial8.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_catch_trial9

Description :

Catch Trial 9: Examinee’s score

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_catch_trial9.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_highest_consecutive_timed_out

Description :

Highest consecutive number of trials in which the examinee ran out of time before giving a response

Variable Name All Possible Values (Categorical) Type
lo_highest_consecutive_timed_out.tabcat_lo 0, 1, 2, 3 numeric

lo_median_time_per_trial

Description :

Median reaction time across all task trials. In March 2022, the task was modified such that trials were cutoff at a limit of 8 seconds.

Variable Name Type Min Possible Max Possible
lo_median_time_per_trial.tabcat_lo numeric 0.833000 12.417000

lo_practice_trials_success

Description :

Indication of whether the examinee completed the practice trial set successfully

Label Value
FALSE Incorrect
TRUE Correct
Variable Name All Possible Values (Categorical) Type Value Labels
lo_practice_trials_success.tabcat_lo FALSE, TRUE logical Incorrect, Correct

lo_r1

Description :

Reversal 1: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r1.tabcat_lo numeric 1 60

lo_r10

Description :

Reversal 10: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r10.tabcat_lo numeric 1 60

lo_r2

Description :

Reversal 2: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r2.tabcat_lo numeric 1 60

lo_r3

Description :

Reversal 3: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r3.tabcat_lo numeric 1 60

lo_r4

Description :

Reversal 4: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r4.tabcat_lo numeric 1 60

lo_r5

Description :

Reversal 5: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r5.tabcat_lo numeric 1 60

lo_r6

Description :

Reversal 6: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r6.tabcat_lo numeric 1 60

lo_r7

Description :

Reversal 7: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r7.tabcat_lo numeric 1 60

lo_r8

Description :

Reversal 8: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r8.tabcat_lo numeric 1 60

lo_r9

Description :

Reversal 9: The intensity of the difference in the angle between lines at the time of reversal

Variable Name Type Min Possible Max Possible
lo_r9.tabcat_lo numeric 1 60

lo_task_duration

Description :

Total amount of time spent on the task, in seconds.

Variable Name Type Min Possible Max Possible
lo_task_duration.tabcat_lo numeric 0 Infinity

lo_task_language

Description :

Testing language used during the task

Variable Name Type
lo_task_language.tabcat_lo character

lo_task_version

Description :

Task version of the assessment, different versions have major revisions to the task

Variable Name All Possible Values (Categorical) Type
lo_task_version.tabcat_lo 1.0.0, 1.1.0, 3.0.0 character

lo_threshold_score_3_10_z

Description :

Z-score of the threshold score across reversals 3:10

Variable Name Type
lo_threshold_score_3_10_z.tabcat_lo numeric

lo_threshold_score_3_10

Description :

Primary performance metric: Average angle between lines at the time of reversal across reversals 3:10, i.e., mean of LO_R3:LO_R10. Otherwise explained as: the average angle difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.. Scores are reported on a continuous scale with higher scores indicating worse performance

Variable Name Type Min Possible Max Possible
lo_threshold_score_3_10.tabcat_lo numeric 1 90

lo_total_catch_trials_timed_out

Description :

Total number of catch trials in which the examinee ran out of time before giving a response

Variable Name All Possible Values (Categorical) Type
lo_total_catch_trials_timed_out.tabcat_lo 0, 1, 3, 4 numeric

lo_total_practice_trials_correct

Description :

Total number of correct responses given during practice trials

Variable Name All Possible Values (Categorical) Type
lo_total_practice_trials_correct.tabcat_lo 4, 6, 7 numeric

lo_total_practice_trials_timed_out

Description :

Total number of practice trials in which the examinee ran out of time before giving a response

Variable Name All Possible Values (Categorical) Type
lo_total_practice_trials_timed_out.tabcat_lo 0, 1, 3, 6 numeric

lo_total_practice_trials

Description :

Total number of practice trials completed

Variable Name All Possible Values (Categorical) Type
lo_total_practice_trials.tabcat_lo 4, 5, 8, 9, 13 numeric

lo_total_task_trials_timed_out

Description :

Total number of task trials in which the examinee ran out of time before giving a response

Variable Name All Possible Values (Categorical) Type
lo_total_task_trials_timed_out.tabcat_lo 0, 1, 2, 5 numeric

lo_total_trials

Description :

Total number of task trials completed

Variable Name Type Min Possible Max Possible
lo_total_trials.tabcat_lo numeric 0 Infinity

tabcat_match

Description :

Match is a test of processing speed and executive functions modeled after the WAIS-III Digit Symbol Coding paradigm. The examinee is shown a fixed legend of numbers 1 through 7 with corresponding simple, abstract pictures. Each time a number appears in the middle of the screen, the examinee must tap the corresponding picture at the bottom of the screen as quickly as possible. The task lasts for two minutes and the primary performance metrics are total correct and total errors.

References :

  • Tsoy E, Erlhoff SJ, Goode CA, et al. BHA-CS: A novel cognitive composite for Alzheimer’s disease and related disorders. Alzheimers Dement (Amst). 2020;12(1):e12042. Published 2020 Jun 21. doi:10.1002/dad2.12042 [2] Possin KL, Moskowitz T, Erlhoff SJ, et al. The Brain Health Assessment for Detecting and Diagnosing Neurocognitive Disorders. J Am Geriatr Soc. 2018;66(1):150-156. doi:10.1111/jgs.15208 [3] Rodríguez-Salgado AM, Llibre-Guerra JJ, Tsoy E, et al. A Brief Digital Cognitive Assessment for Detection of Cognitive Impairment in Cuban Older Adults. J Alzheimers Dis. 2021;79(1):85-94. doi:10.3233/JAD-200985 [4] Alioto AG, Mumford P, Wolf A, et al. White Matter Correlates of Cognitive Performance on the UCSF Brain Health Assessment. J Int Neuropsychol Soc. 2019;25(6):654-658. doi:10.1017/S1355617719000225 [5] Tsoy E, Strom A, Iaccarino L, et al. Detecting Alzheimer’s disease biomarkers with a brief tablet-based cognitive battery: sensitivity to Aβ and tau PET. Alzheimers Res Ther. 2021;13(1):36. Published 2021 Feb 8. doi:10.1186/s13195-021-00776-w

match_practice_trial_success

Description :

Overall success of the total practice trial sets

Label Value
TRUE Pass
FALSE Fail
Variable Name All Possible Values (Categorical) Type Value Labels
match_practice_trial_success.tabcat_match TRUE, FALSE character Pass, Fail

match_pt_set1_success

Description :

Success of the first practice trial set, 2 consecutive correct trials accomplished

Label Value
0 Fail
1 Pass
Variable Name All Possible Values (Categorical) Type Value Labels
match_pt_set1_success.tabcat_match 0,1 categorical Fail, Pass

match_pt_set1_total_trials

Description :

Total number of trials completed in the first practice trial set

Variable Name All Possible Values (Categorical) Type
match_pt_set1_total_trials.tabcat_match 2, 3, 4, 6 numeric

match_pt_set2_success

Description :

Success of the second practice trial set, 2 consecutive correct trials accomplished

Label Value
0 Fail
1 Pass
Variable Name All Possible Values (Categorical) Type Value Labels
match_pt_set2_success.tabcat_match 0, 1 categorical Fail, Pass

match_pt_set2_total_trials

Description :

Total number of trials completed in the second practice trial set

Variable Name All Possible Values (Categorical) Type
match_pt_set2_total_trials.tabcat_match 0 numeric

match_pt_set3_success

Description :

Success of the third practice trial set, 2 consecutive correct trials accomplished

Label Value
0 Fail
1 Pass
Variable Name All Possible Values (Categorical) Type Value Labels
match_pt_set3_success.tabcat_match 0, 1 categorical Fail, Pass

match_pt_set3_total_trials

Description :

Total number of trials completed in the third practice trial set

Variable Name All Possible Values (Categorical) Type
match_pt_set3_total_trials.tabcat_match 0 numeric

match_task_duration

Description :

Total amount of time spent on the task, in minutes

Variable Name Type Min Possible Max Possible
match_task_duration.tabcat_match numeric 0 Infinity

match_task_form

Description :

The task form chosen

Variable Name All Possible Values (Categorical) Type
match_task_form.tabcat_match A, B, C, D character

match_task_language

Description :

Testing language used during the task

Variable Name Type
match_task_language.tabcat_match character

match_task_version

Description :

Task version of the assessment, different versions have major revisions to the task

Variable Name All Possible Values (Categorical) Type
match_task_version.tabcat_match 1.0.0, 3.0.0 character

match_total_correct_z

Description :

Z-score of the total number of correct responses given during the full 2 minute duration of the task

Variable Name Type
match_total_correct_z.tabcat_match numeric

match_total_correct

Description :

Total number of correct responses given during the full task duration, 2 minutes

Variable Name Type Min Possible Max Possible
match_total_correct.tabcat_match numeric 0 Infinity

match_total_incorrect

Description :

Total number of incorrect responses given during the full task duration, 2 minutes

Variable Name Type
match_total_incorrect.tabcat_match numeric

tabcat_rapid_naming

Description :

Rapid Naming is a computerized, one-minute speeded visual naming test aimed at measuring subtle age-related word-finding decline.

References :

  • Stiver, J., Staffaroni, A. M., Walters, S. M., You, M. Y., Casaletto, K. B., Erlhoff, S. J., Possin, K. L., Lukic, S., La Joie, R., Rabinovici, G. D., Zimmerman, M. E., Gorno-Tempini, M. L., & Kramer, J. H. (2022). The Rapid Naming Test: Development and initial validation in typically aging adults. The Clinical neuropsychologist, 36(7), 1822–1843. https://doi.org/10.1080/13854046.2021.1900399

rapid_naming_avg_reaction_time

Description :

Mean reaction time across all correct trials

Variable Name Type Min Possible Max Possible
rapid_naming_avg_reaction_time.tabcat_rapid_naming numeric ? ?

rapid_naming_median_reaction_time

Description :

Median reaction time across all correct trials

Variable Name Type Min Possible Max Possible
rapid_naming_median_reaction_time.tabcat_rapid_naming numeric ? ?

rapid_naming_st_dev_reaction_time

Description :

Standard deviation of reaction time across all correct trials

Variable Name Type Min Possible Max Possible
rapid_naming_st_dev_reaction_time.tabcat_rapid_naming numeric ? ?

rapid_naming_task_language

Description :

Language the task was administered in

Variable Name All Possible Values (Categorical) Type
rapid_naming_task_language.tabcat_rapid_naming English, Portuguese (Brazil), Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain) character

rapid_naming_task_version

Description :

Indicates which verison of the TabCAT app was used during administration. Version revisions include task experience, scoring, mechanism, or format that may impact comparison with older data.

Variable Name All Possible Values (Categorical) Type
rapid_naming_task_version.tabcat_rapid_naming 1.0.0, 3.0.0 character

rapid_naming_total_correct

Description :

Total number of correct responses given across all trials (initial and self-corrected)

Variable Name Type Min Possible Max Possible
rapid_naming_total_correct.tabcat_rapid_naming numeric 0 60

rapid_naming_total_incorrect

Description :

Total number of incorrect responoses given across all trials

Variable Name Type
rapid_naming_total_incorrect.tabcat_rapid_naming numeric

rapid_naming_total_initial_correct

Description :

Total number of initial correct responses given across all trials

Variable Name Type Min Possible Max Possible
rapid_naming_total_initial_correct.tabcat_rapid_naming numeric 0 60

rapid_naming_total_not_seen

Description :

Total number of unseen trials

Variable Name Type Min Possible Max Possible
rapid_naming_total_not_seen.tabcat_rapid_naming numeric 0 60

rapid_naming_total_seen

Description :

Total number of seen trials

Variable Name Type Min Possible Max Possible
rapid_naming_total_seen.tabcat_rapid_naming numeric 0 60

rapid_naming_total_self_corrected

Description :

Total number of self corrected responses given across all trials

Variable Name All Possible Values (Categorical) Type
rapid_naming_total_self_corrected.tabcat_rapid_naming 0, 1, 2 numeric

rapid_naming_total_skipped

Description :

Total number of skipped trials

Variable Name Type
rapid_naming_total_skipped.tabcat_rapid_naming numeric

tabcat_running_dots

Description :

Running dots is an executive functioning/visuospatial working memory task where participants must watch a dot move across a grid and remember the pattern it moved in. As the trials continue, the number of dot placements the participant must remember in the sequence increases from 2 dot spaces to 3, 4, and 5 dot spaces.

References :

  • Lindbergh, C. A., & Kramer, J. H. (2023). Measures of Executive Functions. The SAGE Handbook of Clinical Neuropsychology: Clinical Neuropsychological Assessment and Diagnosis, 179.

  • Tsoy E, Erlhoff SJ, Goode CA, et al. BHA-CS: A novel cognitive composite for Alzheimer’s disease and related disorders. Alzheimers Dement (Amst). 2020;12(1):e12042. Published 2020 Jun 21. doi:10.1002/dad2.12042


running_dots_2dot_percent_correct

Description :

Percent of correct responses given across all trials in the 2 dot condition, regardless of order

Variable Name Type
running_dots_2dot_percent_correct.tabcat_running_dots numeric

running_dots_2dot_total_correct

Description :

Total number of correct responses given across all trials in the 2 dot condition, regardless of order

Variable Name Type
running_dots_2dot_total_correct.tabcat_running_dots numeric

running_dots_2dot_trial_score

Description :

For each trial in the 2 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials

Variable Name Type Min Possible Max Possible
running_dots_2dot_trial_score.tabcat_running_dots numeric 0 6

running_dots_3dot_percent_correct

Description :

Percent of correct responses given across all trials in the 3 dot condition, regardless of order

Variable Name Type Min Possible Max Possible
running_dots_3dot_percent_correct.tabcat_running_dots numeric 0 100

running_dots_3dot_total_correct

Description :

Total number of correct responses given across all trials in the 3 dot condition, regardless of order

Variable Name Type
running_dots_3dot_total_correct.tabcat_running_dots numeric

running_dots_3dot_trial_score

Description :

For each trial in the 3 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials

Variable Name Type
running_dots_3dot_trial_score.tabcat_running_dots character

running_dots_4dot_percent_correct

Description :

Percent of correct responses given across all trials in the 4 dot condition, regardless of order

Variable Name Type Min Possible Max Possible
running_dots_4dot_percent_correct.tabcat_running_dots numeric 0 100

running_dots_4dot_total_correct

Description :

Total number of correct responses given across all trials in the 4 dot condition, regardless of order

Variable Name Type
running_dots_4dot_total_correct.tabcat_running_dots numeric

running_dots_4dot_trial_score

Description :

For each trial in the 4 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials

Variable Name Type Min Possible Max Possible
running_dots_4dot_trial_score.tabcat_running_dots numeric 0 12

running_dots_5dot_percent_correct

Description :

Percent of correct responses given across all trials in the 5 dot condition, regardless of order

Variable Name Type Min Possible Max Possible
running_dots_5dot_percent_correct.tabcat_running_dots numeric 0 100

running_dots_5dot_total_correct

Description :

Total number of correct responses given across all trials in the 5 dot condition, regardless of order

Variable Name Type Min Possible Max Possible
running_dots_5dot_total_correct.tabcat_running_dots numeric 0 15

running_dots_5dot_trial_score

Description :

For each trial in the 5 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials

Variable Name Type Min Possible Max Possible
running_dots_5dot_trial_score.tabcat_running_dots numeric 0 15

running_dots_percent_correct

Description :

Percent of correct responses given across all trials, regardless of order

Variable Name Type Min Possible Max Possible
running_dots_percent_correct.tabcat_running_dots numeric 0 100

running_dots_task_duration

Description :

Total amount of time spent on the task, in minutes

Variable Name Type Min Possible Max Possible
running_dots_task_duration.tabcat_running_dots numeric 0 (Infinity)

running_dots_task_language

Description :

Testing language used during the task

Variable Name All Possible Values (Categorical) Type
running_dots_task_language.tabcat_running_dots Arabic, Cantonese (Traditional), English, Filipino, Greek, Igbo, Mandarin (Simplified), Mandarin (Traditional), Portuguese (Brazil), Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain), Thai character

running_dots_task_version

Description :

Task version of the assessment, different versions have major revisions to the task

Variable Name All Possible Values (Categorical) Type
running_dots_task_version.tabcat_running_dots 1.0.0, 1.1.0, 1.2.0, 1.2.1, 3.0.0 character

running_dots_total_correct

Description :

Total number of correct responses given across all trials, regardless of order

Variable Name Type Min Possible Max Possible
running_dots_total_correct.tabcat_running_dots numeric 0 42

running_dots_trial_score

Description :

For each trial: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials and all dot number conditions

Variable Name Type Min Possible Max Possible
running_dots_trial_score.tabcat_running_dots numeric 0 42

tabcat_set_shifting

Description :

Set Shifting is a test of executive functioning and is modeled after the NIH EXAMINER Set Shifting task. Examinees are required to match a stimulus on the top of the screen to one of two stimuli in the lower corners of the screen, classifying shapes or classifying colors.

References :

  • Lindbergh, C. A., & Kramer, J. H. (2023). Measures of Executive Functions. The SAGE Handbook of Clinical Neuropsychology: Clinical Neuropsychological Assessment and Diagnosis, 179.

set_shifting_color_correct_median_rt

Description :

Median reaction time of all correct color block task trials

Variable Name Type Min Possible Max Possible
set_shifting_color_correct_median_rt.tabcat_set_shifting numeric 0 5

set_shifting_color_correct_total

Description :

Total number of correct responses given across all color block task trials

Variable Name All Possible Values (Categorical) Type
set_shifting_color_correct_total.tabcat_set_shifting 11, 13, 14, 15, 16 numeric

set_shifting_nonshifted_correct_median_rt

Description :

Median reaction time of all correct nonshifted shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_nonshifted_correct_median_rt.tabcat_set_shifting numeric 0 5

set_shifting_nonshifted_correct_total

Description :

Total number of correct responses given across all nonshifted shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_nonshifted_correct_total.tabcat_set_shifting numeric 0 16

set_shifting_shape_correct_median_rt

Description :

Median reaction time of all correct shape block task trials

Variable Name Type Min Possible Max Possible
set_shifting_shape_correct_median_rt.tabcat_set_shifting numeric 0 5

set_shifting_shape_correct_total

Description :

Total number of correct responses given across all shape block task trials

Variable Name All Possible Values (Categorical) Type
set_shifting_shape_correct_total.tabcat_set_shifting 7, 13, 14, 15, 16 numeric

set_shifting_shift_correct_median_rt

Description :

Median reaction time of all correct shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_shift_correct_median_rt.tabcat_set_shifting numeric 0 5

set_shifting_shift_correct_total

Description :

Total number of correct responses given across all shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_shift_correct_total.tabcat_set_shifting numeric 0 32

set_shifting_shifted_correct_median_rt

Description :

Median reaction time of all correct shifted shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_shifted_correct_median_rt.tabcat_set_shifting numeric 0 5

set_shifting_shifted_correct_st_dev_rt

Description :

Standard deviation of reaction time of all correct shifted shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_shifted_correct_st_dev_rt.tabcat_set_shifting numeric (-) Infinity Infinity

set_shifting_shifted_correct_total

Description :

Total number of correct responses given across all shifted shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_shifted_correct_total.tabcat_set_shifting numeric 0 16

set_shifting_task_duration

Description :

Total amount of time spent on the task, in minutes

Variable Name Type Min Possible Max Possible
set_shifting_task_duration.tabcat_set_shifting numeric 0 Infinity

set_shifting_task_language

Description :

Testing language used during the task

Variable Name All Possible Values (Categorical) Type
set_shifting_task_language.tabcat_set_shifting Amharic, Arabic, Cantonese (Traditional), English, Filipino, French, Greek, Hebrew, Igbo, Italian, Mandarin (Simplified), Mandarin (Traditional), Portuguese (Brazil), Setswana, Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain), Swahili, Thai character

set_shifting_task_version

Description :

Task version of the assessment, different versions have major revisions to the task

Variable Name All Possible Values (Categorical) Type
set_shifting_task_version.tabcat_set_shifting 1.0.0, 1.1.0, 3.0.0 character

set_shifting_total_score_z

Description :

Z-score of the global score that combines accuracy and reaction time scores across all correct shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_total_score_z.tabcat_set_shifting numeric (-) Infinity Infinity

set_shifting_total_score

Description :

Global score that combines accuracy and reaction time scores across all correct shift block task trials

Variable Name Type Min Possible Max Possible
set_shifting_total_score.tabcat_set_shifting numeric 0 10

tech_familiarity

Description :

Participant self reported familiarity interacting with technology. Questionnaire developed in house as part of Fitbit study.

References :

  • Paolillo, E. W., Lee, S. Y., VandeBunte, A., Djukic, N., Fonseca, C., Kramer, J. H., & Casaletto, K. B. (2022). Wearable use in an observational study among older adults: adherence, feasibility, and effects of clinicodemographic factors. Frontiers in Digital Health, 4, 884208.

access

Description :

Do you have access to a computer or tablet at home?

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
access.tech_familiarity 0, 1 categorical No, Yes

computer_difficulty

Description :

How much difficulty do you have using computers?

Label Value
0 No difficulty
1 Some difficulty
2 Moderate difficulty
3 Quite a bit of difficulty
4 Extreme difficulty
Variable Name All Possible Values (Categorical) Type Value Labels
computer_difficulty.tech_familiarity 0, 1, 2, 3, 4 categorical No difficulty, Some difficulty, Moderate difficulty, Quite a bit of difficulty, Extreme difficulty

hours_internet_per_day

Description :

On average, how many hours PER DAY do you spend on the internet?

Label Value
0 0-1
1 2-4
2 5-8
3 9-15
4 15+
Variable Name All Possible Values (Categorical) Type Value Labels
hours_internet_per_day.tech_familiarity 0, 1, 2, 3, 4 categorical 0-1, 2-4, 5-8, 9-15, 15+

nervous_anxious_technology

Description :

How anxious (or nervous) do you typically feel when using a computer, tablet, or

Variable Name All Possible Values (Categorical) Type Value Labels
nervous_anxious_technology.tech_familiarity 1, 2, 3, 4 categorical Not anxious, Somewhat anxious, Moderately anxious, Quite a bit anxious, Extremely anxious

smartphone

Description :

smartphone?

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
smartphone.tech_familiarity 0, 1 categorical No, Yes

wearable

Description :

Have you ever used a wearable tracking device

Label Value
0 No
1 Yes
Variable Name All Possible Values (Categorical) Type Value Labels
wearable.tech_familiarity 0, 1 categorical No, Yes

uds_neuropsych

Description :

The neuropsychological testing battery from the Uniform Data Set (UDS) of the Alzheimer’s Disease Centers (ADC) program of the National Institute on Aging (NIA). This testing battery includes measures to test domains such as episodic memory, attention, processing speed, executive function, and language.

References :

  • Weintraub, S., Salmon, D., Mercaldo, N., Ferris, S., Graff-Radford, N. R., Chui, H., Cummings, J., DeCarli, C., Foster, N. L., Galasko, D., Peskind, E., Dietrich, W., Beekly, D. L., Kukull, W. A., & Morris, J. C. (2009). The Alzheimer’s Disease Centers’ Uniform Data Set (UDS): the neuropsychologic test battery. Alzheimer disease and associated disorders, 23(2), 91–101. https://doi.org/10.1097/WAD.0b013e318191c7dd

animals_zscore

Variable Name Type Min Possible Max Possible
animals_zscore.uds_neuropsych numeric 0.018 -3.981

animals

Variable Name Type Min Possible Max Possible
animals.uds_neuropsych numeric 0 52

boston_zscore

Variable Name Type Min Possible Max Possible
boston_zscore.uds_neuropsych numeric 0.000 -11.667

boston

Variable Name Type Min Possible Max Possible
boston.uds_neuropsych numeric 0 30

cogstat

Variable Name All Possible Values (Categorical) Type
cogstat.uds_neuropsych 0, 1, 2, 3, 4 numeric

craftdre

Variable Name Type Min Possible Max Possible
craftdre.uds_neuropsych numeric 0 25

craftdvr

Variable Name Type Min Possible Max Possible
craftdvr.uds_neuropsych numeric 0 39

crafturs

Variable Name Type Min Possible Max Possible
crafturs.uds_neuropsych numeric 0 25

craftvrs

Variable Name Type Min Possible Max Possible
craftvrs.uds_neuropsych numeric 0 41

digbacct

Variable Name Type Min Possible Max Possible
digbacct.uds_neuropsych integer 0 14

digforct

Variable Name Type Min Possible Max Possible
digforct.uds_neuropsych numeric 0 14

digib_zscore

Variable Name Type Min Possible Max Possible
digib_zscore.uds_neuropsych numeric 0.045 -3.364

digib

Variable Name Type Min Possible Max Possible
digib.uds_neuropsych numeric 0 12

digiblen_zscore

Variable Name Type Min Possible Max Possible
digiblen_zscore.uds_neuropsych numeric 0.000 -4.333

digiblen

Variable Name Type
digiblen.uds_neuropsych numeric

digif_zscore

Variable Name Type Min Possible Max Possible
digif_zscore.uds_neuropsych numeric 0.095 -4.550

digif

Variable Name Type Min Possible Max Possible
digif.uds_neuropsych numeric 0 12

digiflen_zscore

Variable Name Type Min Possible Max Possible
digiflen_zscore.uds_neuropsych numeric 0.091 -6.273

digiflen

Variable Name Type
digiflen.uds_neuropsych numeric

logi_mem_zscore

Variable Name Type Min Possible Max Possible
logi_mem_zscore.uds_neuropsych numeric 0.000 -4.086

logimem

Variable Name Type Min Possible Max Possible
logimem.uds_neuropsych numeric 0 23

mem_units_zscore

Variable Name Type Min Possible Max Possible
mem_units_zscore.uds_neuropsych numeric 0.000 -3.500

memtime

Variable Name Type Min Possible Max Possible
memtime.uds_neuropsych numeric 0 35

memunits

Variable Name Type Min Possible Max Possible
memunits.uds_neuropsych numeric 0 23

minttots

Variable Name Type Min Possible Max Possible
minttots.uds_neuropsych numeric 0 32

mmse_zscore

Variable Name Type Min Possible Max Possible
mmse_zscore.uds_neuropsych numeric 0.000 -29.300

mocatots

Variable Name Type Min Possible Max Possible
mocatots.uds_neuropsych numeric 0 30

pentagon

Variable Name All Possible Values (Categorical) Type
pentagon.uds_neuropsych 0, 1 numeric

SE_uds3_ef

Variable Name Type Min Possible Max Possible
SE_uds3_ef.uds_neuropsych numeric 0.3202755 0.9562837

trail_a_zscore

Variable Name Type Min Possible Max Possible
trail_a_zscore.uds_neuropsych numeric 0.021 -11.207

trail_b_zscore

Variable Name Type Min Possible Max Possible
trail_b_zscore.uds_neuropsych numeric 0.003 -6.803

trailA_ratio

Variable Name Type Min Possible Max Possible
trailA_ratio.uds_neuropsych numeric 0.000000 160.000000

traila

Variable Name Type Min Possible Max Possible
traila.uds_neuropsych numeric 9 150

trailali

Variable Name Type Min Possible Max Possible
trailali.uds_neuropsych numeric 0 24

trailarr

Variable Name Type Min Possible Max Possible
trailarr.uds_neuropsych numeric 0 40

trailB_ratio

Variable Name Type Min Possible Max Possible
trailB_ratio.uds_neuropsych numeric 0.200000 72.000000

trailb

Variable Name Type Min Possible Max Possible
trailb.uds_neuropsych numeric 17 300

trailbli

Variable Name Type Min Possible Max Possible
trailbli.uds_neuropsych numeric 0 24

trailbrr

Variable Name Type Min Possible Max Possible
trailbrr.uds_neuropsych numeric 0 40

uds3_ef_mean.adj

Variable Name Type Min Possible Max Possible
uds3_ef_mean.adj.uds_neuropsych numeric 0.000092800 -1.026420414

uds3_ef_sd.adj

Variable Name Type Min Possible Max Possible
uds3_ef_sd.adj.uds_neuropsych numeric 0.7280313 0.7615333

uds3_ef_Z

Variable Name Type Min Possible Max Possible
uds3_ef_Z.uds_neuropsych numeric 0.0002432193 -5.2101374529

uds3_ef

Variable Name Type Min Possible Max Possible
uds3_ef.uds_neuropsych numeric 0.0002508328 -3.2307936664

udsbenrs

Variable Name All Possible Values (Categorical) Type
udsbenrs.uds_neuropsych 0, 1 numeric

udsbentc

Variable Name Type Min Possible Max Possible
udsbentc.uds_neuropsych numeric 0 17

udsbentd

Variable Name Type Min Possible Max Possible
udsbentd.uds_neuropsych numeric 0 17

udsverfc

Variable Name Type Min Possible Max Possible
udsverfc.uds_neuropsych numeric 0 33

udsverlc

Variable Name Type Min Possible Max Possible
udsverlc.uds_neuropsych numeric 0 34

udsvertn

Variable Name Type Min Possible Max Possible
udsvertn.uds_neuropsych numeric 0 62

v_type

Variable Name Type
v_type.uds_neuropsych character

veg_zscore

Variable Name Type Min Possible Max Possible
veg_zscore.uds_neuropsych numeric 0.043 -3.585

veg

Variable Name Type Min Possible Max Possible
veg.uds_neuropsych numeric 0 37

wais_zscore

Variable Name Type Min Possible Max Possible
wais_zscore.uds_neuropsych numeric 0.009 -4.975

wais

Variable Name Type Min Possible Max Possible
wais.uds_neuropsych numeric 0 98

vasc_burden

Description :

The Vascular Burden Score (VBS) includes the sum of four possible Vascular Risk Factors (e.g., hypertension, diabetes, hyperlipidemia, sleep apnea) and four possible Vascular Diseases (cardiac arrythmias [atrial fibrillation, pacemaker and/or defibrillator], coronary artery disease [angina, angioplasty/endarterectomy/stent, cardiac bypass procedure, heart attack/cardiac arrest], congestive heart failure, and cerebrovascular disease [TIA, stroke]). Range is 0-8.

References :

  • Takahashi, P. Y., Caldwell, C. R., & Targonski, P. V. (2012). Effect of vascular burden as measured by vascular indexes upon vascular dementia: a matched case-control study. Clinical interventions in aging, 7, 27–33. https://doi.org/10.2147/CIA.S28143

  • DeCarli, C., Villeneuve, S., Maillard, P., Harvey, D., Singh, B., Carmichael, O., Fletcher, E., Olichney, J., Farias, S., Jagust, W., Reed, B., & Mungas, D. (2019). Vascular Burden Score Impacts Cognition Independent of Amyloid PET and MRI Measures of Alzheimer’s Disease and Vascular Brain Injury. Journal of Alzheimer’s disease : JAD, 68(1), 187–196. https://doi.org/10.3233/JAD-180965


VBS

Description :

Sum of VDS + VRS

Variable Name Type
VBS.vasc_burden numeric

VDS

Description :

Sum of 4 possible vascular diseases: 1) cardiac arrythmias [atrial fibrillation, pacemaker and/or defibrillator], 2) coronary artery disease [angina, angioplasty/endarterectomy/stent, cardiac bypass procedure, heart attack/cardiac arrest], 3) congestive heart failure and 4) cerebrovascular disease [TIA, stroke])

Variable Name All Possible Values (Categorical) Type
VDS.vasc_burden 0, 1, 2, 3, 4 numeric

VRS

Description :

Sum of 4 possible vascular risk factors: hypertension, sleep apnea, diabetes, hyperlipidemia

Variable Name All Possible Values (Categorical) Type
VRS.vasc_burden 0, 1, 2, 3, 4 numeric

virtual_bedside


behav1

Variable Name All Possible Values (Categorical) Type
behav1.virtual_bedside 0 numeric

behav10

Variable Name All Possible Values (Categorical) Type
behav10.virtual_bedside 0 numeric

behav2

Variable Name All Possible Values (Categorical) Type
behav2.virtual_bedside 0 numeric

behav3

Variable Name All Possible Values (Categorical) Type
behav3.virtual_bedside 0 numeric

behav4

Variable Name All Possible Values (Categorical) Type
behav4.virtual_bedside 0 numeric

behav5

Variable Name All Possible Values (Categorical) Type
behav5.virtual_bedside 0 numeric

behav6

Variable Name All Possible Values (Categorical) Type
behav6.virtual_bedside 0 numeric

behav7

Variable Name All Possible Values (Categorical) Type
behav7.virtual_bedside 0 numeric

behav8

Variable Name All Possible Values (Categorical) Type
behav8.virtual_bedside 0 numeric

behav9

Variable Name All Possible Values (Categorical) Type
behav9.virtual_bedside 0 numeric

cv2b_r

Variable Name Type
cv2b_r.virtual_bedside numeric

cv2b_u

Variable Name All Possible Values (Categorical) Type
cv2b_u.virtual_bedside 0, 1, 8 numeric

cv2hit

Variable Name All Possible Values (Categorical) Type
cv2hit.virtual_bedside 12, 13, 14, 15, 16 numeric

cv2ldcc

Variable Name Type
cv2ldcc.virtual_bedside numeric

cv2ldci

Variable Name All Possible Values (Categorical) Type
cv2ldci.virtual_bedside 0, 1, 2, 3, 4 numeric

cv2lfrc

Variable Name Type
cv2lfrc.virtual_bedside numeric

cv2lfri

Variable Name All Possible Values (Categorical) Type
cv2lfri.virtual_bedside 0, 1, 2, 3, 20 numeric

cv2np

Variable Name All Possible Values (Categorical) Type
cv2np.virtual_bedside 0, 2, 6 numeric

cv2nu

Variable Name All Possible Values (Categorical) Type
cv2nu.virtual_bedside 0, 1 numeric

cv2sdcc

Variable Name Type
cv2sdcc.virtual_bedside numeric

cv2sdci

Variable Name Type
cv2sdci.virtual_bedside numeric

cv2sfrc

Variable Name Type Min Possible Max Possible
cv2sfrc.virtual_bedside numeric 5 16

cv2sfri

Variable Name All Possible Values (Categorical) Type
cv2sfri.virtual_bedside 0, 1, 2, 4 numeric

cv2t1c

Variable Name Type
cv2t1c.virtual_bedside numeric

cv2t1i

Variable Name All Possible Values (Categorical) Type
cv2t1i.virtual_bedside 0, 1, 2 numeric

cv2t2c

Variable Name Type
cv2t2c.virtual_bedside numeric

cv2t2i

Variable Name All Possible Values (Categorical) Type
cv2t2i.virtual_bedside 0, 1, 3, 4, 9 numeric

cv2t3c

Variable Name Type
cv2t3c.virtual_bedside numeric

cv2t3i

Variable Name All Possible Values (Categorical) Type
cv2t3i.virtual_bedside 0, 1, 2, 3 numeric

cv2t4c

Variable Name Type
cv2t4c.virtual_bedside numeric

cv2t4i

Variable Name All Possible Values (Categorical) Type
cv2t4i.virtual_bedside 0, 1, 2 numeric

cv2t5c

Variable Name Type
cv2t5c.virtual_bedside numeric

cv2t5i

Variable Name All Possible Values (Categorical) Type
cv2t5i.virtual_bedside 0, 1, 2, 3 numeric

cv2tb_c

Variable Name Type
cv2tb_c.virtual_bedside numeric

cv2tb_i

Variable Name All Possible Values (Categorical) Type
cv2tb_i.virtual_bedside 0, 1, 2, 8 numeric

d_rule_v

Variable Name All Possible Values (Categorical) Type
d_rule_v.virtual_bedside 0, 1, 2 numeric

dcorr

Variable Name Type Min Possible Max Possible
dcorr.virtual_bedside numeric 6 30

dreps

Variable Name All Possible Values (Categorical) Type
dreps.virtual_bedside 0, 1, 2, 4 numeric

mintpcnc

Variable Name Type
mintpcnc.virtual_bedside numeric

mintpcng

Variable Name All Possible Values (Categorical) Type
mintpcng.virtual_bedside 0, 1, 2, 8 numeric

mintscnc

Variable Name Type
mintscnc.virtual_bedside numeric

mintscng

Variable Name All Possible Values (Categorical) Type
mintscng.virtual_bedside 0, 1, 2 numeric

minttots

Variable Name All Possible Values (Categorical) Type
minttots.virtual_bedside 24, 29, 30, 31, 32 numeric

minttotw

Variable Name All Possible Values (Categorical) Type
minttotw.virtual_bedside 24, 29, 30, 31, 32 numeric

mocaclock

Variable Name All Possible Values (Categorical) Type
mocaclock.virtual_bedside 3 numeric

mocacube

Variable Name All Possible Values (Categorical) Type
mocacube.virtual_bedside 0, 1 numeric

mocalanguage

Variable Name All Possible Values (Categorical) Type
mocalanguage.virtual_bedside 0, 2, 3 numeric

mod_rey

Variable Name All Possible Values (Categorical) Type
mod_rey.virtual_bedside 13, 14, 15, 16 numeric

numb_loc

Variable Name All Possible Values (Categorical) Type
numb_loc.virtual_bedside 8, 9, 10 numeric

repeat

Variable Name All Possible Values (Categorical) Type
repeat.virtual_bedside 3 numeric

repeat5

Variable Name All Possible Values (Categorical) Type
repeat5.virtual_bedside 4, 5 numeric

research_status

Variable Name All Possible Values (Categorical) Type
research_status.virtual_bedside 1 numeric

rey_recg

Variable Name All Possible Values (Categorical) Type
rey_recg.virtual_bedside 0, 1 numeric

rey10m

Variable Name Type
rey10m.virtual_bedside numeric

strp_cn_cor

Variable Name Type Min Possible Max Possible
strp_cn_cor.virtual_bedside numeric 63 114

strp_cn_err

Variable Name All Possible Values (Categorical) Type
strp_cn_err.virtual_bedside 0 numeric

strp_cor

Variable Name Type Min Possible Max Possible
strp_cor.virtual_bedside numeric 1 71

strp_err

Variable Name All Possible Values (Categorical) Type
strp_err.virtual_bedside 0, 1, 7, 50 numeric

strp_sce

Variable Name All Possible Values (Categorical) Type
strp_sce.virtual_bedside 0, 1, 2, 3 numeric