primary_language
Description :
Primary language the participant speaks and prefers to communicate in
| Variable Name | Type |
|---|---|
| primary_language.demographics | character |
Age of participant at time of data collection
| Variable Name | Type |
|---|---|
| age_at_DCDate.general | numeric |
The difference in days between one instrument and the date of a participants neuropsych appointment
| Variable Name |
|---|
| date_diff.general |
Date instrument was administered
| Variable Name | Type |
|---|---|
| DCDate.general | Date |
| Variable Name |
|---|
| instr_type.general |
Participant ID
| Variable Name | Type |
|---|---|
| PIDN.general | numeric |
| Variable Name |
|---|
| source.general |
| Variable Name | Type |
|---|---|
| UnQID.general | numeric |
NIH-EXAMINER N-back task. The n-back paradigm is a widely used measure of working memory that requires flexible updating capabilities. NIH-EXAMINER includes spatial 1-back and 2-back tasks to assess spatial working memory. The 1-back requires maintaining and updating 1 location at a time, whereas the more difficult 2-back requires maintaining and updating 2 locations.
Discrimination (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb1dprime.1back | numeric | -Infinity | Infinity |
Number of false positive errors (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb1FalseAlarms.1back | numeric | 0 | Infinity |
Number of correct hits (raw)
| Variable Name | Type |
|---|---|
| nb1Hits.1back | numeric |
Total number of items completed?
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb1TotalNo.1back | numeric | 0 | Infinity |
Number of false positive errors (z-score)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb1ZFA.1back | numeric | -Infinity | Infinity |
Number of correct hits (z-score)
| Variable Name | Type |
|---|---|
| nb1ZHIT.1back | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| task.1back | 1-Back, AgingCog_1Back | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.1back | 1, 1.0.1, 1.0.2, 2 | character |
NIH-EXAMINER N-back task. The n-back paradigm is a widely used measure of working memory that requires flexible updating capabilities. NIH-EXAMINER includes spatial 1-back and 2-back tasks to assess spatial working memory. The 1-back requires maintaining and updating 1 location at a time, whereas the more difficult 2-back requires maintaining and updating 2 locations.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2bias.2back | numeric | 0.007 | -0.731 |
Discrimination (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2dprime.2back | numeric | 0.007 | -1.749 |
Number of false positive errors (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2FalseAlarms.2back | numeric | 0.025 | 0.992 |
Number of correct hits (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2Hits.2back | numeric | 0.177 | 0.984 |
Total number of items completed?
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2TotalNo.2back | numeric | 0 | 59 |
Number of false positive errors (z-score)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2ZFA.2back | numeric | 0.000 | -1.967 |
Number of correct hits (z-score)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2ZHIT.2back | numeric | 0.000 | -0.925 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| task.2back | 2-Back, AgingCog_2-Back, AgingCog_2Back | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.2back | 1, 1.0.1, 1.0.2, 2 | character |
Summary rating scores for parkinsonian motor symtpoms and PSP supranuclear ocular, limb, and gait function from ADRC research visit neurological exam
Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.
Movement Disorder Society Task Force on Rating Scales for Parkinson’s Disease. (2003). The unified Parkinson’s disease rating scale (UPDRS): status and recommendations. Movement Disorders, 18(7), 738-750.
PSP Gait Rating Scale
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| psp_gait.adrcneuroexam | numeric | 0 | 20 |
PSP Limb Rating Scale
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| psp_limb.adrcneuroexam | numeric | 0 | 16 |
PSP Supranuclear Ocular Motor Rating Scale
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| psp_oc.adrcneuroexam | numeric | 0 | 16 |
The Unified Parkinson’s Disease Rating Scale (UPDRS) Motor Score
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| updrs.adrcneuroexam | numeric | 0 | 77 |
ApneaLink records the following data: patient respiratory nasal airflow, snoring, blood oxygen saturation, pulse and respiratory effort during sleep.
Mean number of all apnea classes (unclassified, central, mixed, obstructive) and hypopneas per hour in the evaluation period, high AHI (>5) = high likelihood of OSA, low AHI (<5) = lower likelihood of OSA
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| apnea_hypopnea_index.apnea | numeric | 0.3 | 37.0 |
Mean value that shows the number of desaturations within the SpO2 evaluation period, high ODI (>5)= more desaturation events (more risk of OSA), low ODI (<5) = few desaturation events (lower risk of OSA)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| oxygen_desaturation_index.apnea | numeric | 0.0 | 34.5 |
The bedside cognitive screen was developed at the UCSF Memory & Aging Center (MAC). This battery of 21 measures has been designed to probe multiple cognitive domains (e.g., memory, executive function, language, visual-spatial function, and mood) in a time-limited fashion (typically 60 minutes). The specific tests utilized in the bedside have been developed to assist with the differential diagnosis of the most common referral questions at the MAC (e.g., Alzheimer’s Disease vs. Frontotemporal Dementia). The level of difficulty has been tailored to patients/research participants presenting with substantial cognitive deficits. Thus, the bedside screen may have low sensitivity to subtle cognitive deficits, especially for participants with high levels of education.
Animals is a verbal fluency/generativity task requiring the participant to generate as many words as they can think of that belong to the semantic category ‘Animals’ in one minute. This variable captures the number of correct responses.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| an_corr.bedside | numeric | 0 | Infinity |
Number of word repetitions on the semantic verbal fluency task (Animals)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| an_reps.bedside | numeric | 0 | Infinity |
Number of rule violations on the semantic verbal fluency task (Animals) e.g., words that do not belong to the correct semantic category
| Variable Name | Type |
|---|---|
| an_rule_v.bedside | numeric |
The Benson figure is a simplified version of the Rey-Osterrieth complex figure. The participant is asked to make a copy of the figure, which they are asked to draw again from memory after a 10 minute delay. The recalled figure is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total). The recall condition is viewed as a task of visual memory. However, it should be noted that recall performance can be impacted by difficulties with visuo-constructional ability and/or a poorly organised approach (executive dysfunction) on the initial copy condition of the task.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bensonrecall.bedside | numeric | 0 | 17 |
Z-score for Benson Figure recall condition performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bensonrecallz.bedside | numeric | Infinity | Infinity |
An alternative version of the Benson figure (version B) is used. In this condition, the participant is asked to make a copy of the figure. The figure copy is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total).
| Variable Name | Type |
|---|---|
| mod_rey_b.bedside | numeric |
The Benson figure is a simplified version of the Rey-Osterrieth complex figure. In this condition the participant is asked to make a copy of the figure. The figure copy is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mod_rey.bedside | numeric | 0 | 17 |
Participant is asked to recognize the original benson figure (version B) they were presented with from 4 options. This score indicates whether they were able to accurately recognise the figure
| Label | Value |
|---|---|
| 0 | Incorrect |
| 1 | correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| rey_b_recg.bedside | 0, 1 | numeric | Incorrect, correct |
Participant is asked to draw the benson figure (version B) from memory after a delay of 10-15 minutes. The drawing is scores for the accuracy (1 point) and placement (1 point) of 8 different elements, along with a bonus point given for a perfect copy (17 points total)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rey_b10m.bedside | numeric | 0 | 17 |
Participant is asked to recognize the original benson figure they were presented with from 4 options. This score indicates whether they were able to accurately recognise the figure
| Label | Value |
|---|---|
| 0 | Incorrect |
| 1 | correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| rey_recg.bedside | 0, 1 | numeric | Incorrect, correct |
Participant is asked to draw the benson figure from memory after a delay of 10-15 minutes. The drawing is scores for the accuracy (1 point) and placement (1 point) of 8 different elements, along with a bonus point given for a perfect copy (17 points total)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rey10m.bedside | numeric | 0 | 17 |
The 15-item version of the Boston Naiming Test (BNT) is a task which examines confrontational naming. The participant is required to name 15 different items presented as pictures, one at a time. This varibale represents the number of correct spontaneously named items (without any cueing).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bnt_corr.bedside | numeric | 0 | 15 |
Number of correct items named following a multiple choice cue (e.g., is it a bed, bell or bear?) on the 15-item version of the Boston Naming Test (BNT)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bnt_mult.bedside | numeric | 0 | 15 |
Number of semantic cues given (e.g., it’s a piece of furniture) on the 15-item version of the Boston Naming Test (BNT)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bnt_num_s.bedside | numeric | 0 | 15 |
Number of correct items named following a phonemic cue (e.g., it starts with “be”) on the 15-item version of the Boston Naming Test (BNT)
| Variable Name | Type |
|---|---|
| bnt_phon.bedside | numeric |
Number of correct items named following a semantic cue (e.g., it’s a piece of furniture) on the 15-item version of the Boston Naming Test (BNT)
| Variable Name | Type |
|---|---|
| bnt_stim.bedside | numeric |
The total score for the 15-item version of the Boston Naming Test (BNT) is the number of correct spontaneously named items (uncued) + the number of correctly named items with a semantic cue.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bnt_tot.bedside | numeric | 0 | 15 |
A composite z-score for executive functioning tasks in the bedside battery. This composite includes 1) total number of items recalled on the interference condition of the Stroop task (strp_cor.bedside), Digits Backwards span (digit_bw.bedside), Modified Trails total completion time (mt_time.bedside), total number of correct words generated in D Words (d_corr.bedside), and total correct designs generated in Design Fluency (df_corr.bedside).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bsexzscore.bedside | numeric | Infinity | Infinity |
A composite z-score for memory tasks in the bedside battery. This composite includes 1) Summed total of words recalled across all five learning trails of the CVLT-II, 2) words spontaneously recalled following a long delay on the CVLT-II (cv2lfrc.bedside), 3) CVLT-II recognition discriminability (cv2rd.bedside), 4) recall score for the Benson figure following a long delay (bensonrecall.bedside).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| memoryzscore.bedside | numeric | Infinity | Infinity |
An optional sub-measure indicating total correct words spontaeously recalled following a long (unspecified) delay. If administered, this is usually collected upon the completion of the testing session.
| Variable Name | Type |
|---|---|
| corr_long.bedside | numeric |
Total correct words spontaeously recalled following a 10-minute delay
| Variable Name | Type |
|---|---|
| corr10.bedside | numeric |
Total correct words spontaeously recalled following a 30 second delay (with distractor task)
| Variable Name | Type |
|---|---|
| corr30.bedside | numeric |
Total number of intrusion errors (incorrect words) recalled following a 10-minute delay with the provision of category cues (e.g., “tell me all of the words from the list that are fruits”)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cue_intr.bedside | numeric | 0 | Infinity |
Total number of correct words recalled following a 10-minute delay with the provision of category cues (e.g., “tell me all of the words from the list that are fruits”)
| Variable Name | Type |
|---|---|
| cued_cor.bedside | numeric |
An optional sub-measure indicating total number of intrusion errors (incorrect words) spontaeously recalled following a long (unspecified) delay. If administered, this is usually collected upon the completion of the testing session.
| Variable Name | Type |
|---|---|
| intr_long.bedside | numeric |
Total number of intrusion errors (incorrect words) spontaeously recalled following a 10-minute delay
| Variable Name | Type |
|---|---|
| intr10.bedside | numeric |
Total number of intrusion errors (incorrect words) spontaeously recalled following a 30-second delay (with distractor task).
| Variable Name | Type |
|---|---|
| intr30.bedside | numeric |
Total number of false positive errors (incorrect words recalled) when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| recog_fp.bedside | numeric | 0 | 18 |
Total number of ‘novel prototype’ words (e.g., novel words belonging to the same category) incorrectly recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.
| Variable Name | Type |
|---|---|
| recog_np.bedside | numeric |
Total number of ‘novel unrelated’ words (e.g., novel words unrelated to those on the original list) incorrectly recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.
| Variable Name | Type |
|---|---|
| recog_nu.bedside | numeric |
Total number of correct words recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.
| Variable Name | Type |
|---|---|
| recog.bedside | numeric |
The California Verbal Learning Test, Brief Form (CVLT-BF) is a 9-item list learning task. Four learning trails are first administered where the examiner reads the word list out loud and the participant is asked to recall as many words as they can from the list following each repetition. Following the learning trials, a distractor task requires the participant to count backwards from 100 for 30 seconds. Immediatley following the distractor task the participant is then asked to recall as many items from the list as they can. Then, following a 10-minute delay, the participant is again asked to recall as many words from the list as they can, following by a cued recall condition (i.e., “tell me all the owrds from the list that were fruits”) and a recognition (Yes/No) condition. The task also includes an optional long delay condition (timing unspecified) where the participant is again asked to recall as many words from the list as they can at the conclusion of the testing session. This variable represents the total correct words recalled on learning trial 1.
| Variable Name | Type |
|---|---|
| t1corr.bedside | numeric |
Total intrusions (incorrect words) incorrectly recalled on learning trial 1
| Variable Name | Type |
|---|---|
| t1intr.bedside | numeric |
Total correct words recalled on learning trial 2
| Variable Name | Type |
|---|---|
| t2corr.bedside | numeric |
Total intrusions (incorrect words) incorrectly recalled on learning trial 2
| Variable Name | Type |
|---|---|
| t2intr.bedside | numeric |
Total correct words recalled on learning trial 3
| Variable Name | Type |
|---|---|
| t3corr.bedside | numeric |
Total intrusions (incorrect words) incorrectly recalled on learning trial 3
| Variable Name | Type |
|---|---|
| t3intr.bedside | numeric |
Total correct words recalled on learning trial 4
| Variable Name | Type |
|---|---|
| t4corr.bedside | numeric |
Total intrusions (incorrect words) incorrectly recalled on learning trial 4
| Variable Name | Type |
|---|---|
| t4intr.bedside | numeric |
Sum of total correct words recalled across learning trails 1-4
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tr_co_tot.bedside | numeric | 0 | 36 |
Distractor list (list B) related false positives
| Variable Name | Type |
|---|---|
| cv2b_r.bedside | numeric |
Distractor list (list B) unrelated false positives
| Variable Name | Type |
|---|---|
| cv2b_u.bedside | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2bias.bedside | numeric | 0.000 | -1.863 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2dprime.bedside | numeric | 0.000 | -0.384 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2dprimez.bedside | numeric | 0.021 | -4.917 |
Indicates the form of the CVLT2 that was administered (Form A or B)
| Label | Value |
|---|---|
| A | A |
| B | B |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| cv2form.bedside | A, B | character | A, B |
Total false positive responses for List A when participant is presented with a recognition (Yes/No) format
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2fptot.bedside | numeric | 0 | 16 |
Total correct words recalled from List A when participant is presented with a recognition (Yes/No) format
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2hit.bedside | numeric | 0 | 16 |
Total correct words recalled from List A following a long delay (20 min) in cued condition i.e., “Tell me all the words from the list that are furniture”.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2lcc.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) recalled for List A following a long delay (20 min) in cued condition i.e., “Tell me all the words from the list that are furniture”.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2lci.bedside | numeric | 0 | Infinity |
Total correct words spontaneously recalled from List A following a long delay (20 min)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2lfrc.bedside | numeric | 0 | 16 |
Z-score for correct words spontaneously recalled from List A following a long delay (20 min)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2lfrcz.bedside | numeric | Infinity | Infinity |
Total intrusions (incorrect words) spontaneously recalled for List A following a long delay (20 min)
| Variable Name | Type |
|---|---|
| cv2lfri.bedside | numeric |
Total ‘novel prototype’ words (e.g., novel words belonging to the same category) incorrectly recalled when the participant is presented with a recognition (Yes/No) format for List A.
| Variable Name | Type |
|---|---|
| cv2np.bedside | numeric |
Total ‘novel unrelated’ words (e.g., novel words unrelated to those on List A) incorrectly recalled when the participant is presented with a recognition (Yes/No) format.
| Variable Name | Type |
|---|---|
| cv2nu.bedside | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2pfp.bedside | numeric | 0.016 | 0.969 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2phit.bedside | numeric | 0.031 | 0.969 |
Recognition discriminibility (d’) for List A = z(hits) - z(false positive errors).
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2rd.bedside | 0, 3, 4 | numeric |
Total correct words recalled from List A following a short delay (immediatley after distractor trial B) in cued condition i.e., “Tell me all the words from the list that are furniture”.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2sdcc.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) recalled for List A following a short delay (immedatley after distractor trial B) in cued condition i.e., “Tell me all the words from the list that are furniture”.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2sdci.bedside | numeric | 0 | Infinity |
Total correct words from List A recalled spontaneously following a short delay (immediatley after distractor trial B)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2sfrc.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) spontaeously recalled following a short delay (immediatley after distractor trial B)
| Variable Name | Type |
|---|---|
| cv2sfri.bedside | numeric |
The California Verbal Learning Test, second edition (CVLT-II) is a 16-item list learning task. Five learning trails are first administered where the examiner reads a word list (List A) out loud and the participant is asked to recall as many words as they can from the list following each repetition. Following the learning trials, a distractor list (List B) is read allowed by the examiner and the participant is asked to recall as many words as they can from List B only. Immediatley following this task (short delay), the participant is again required to recall as many words as they can from List A only. A cued condition following the short delay is also administered (i.e., “tell me all the words from the list that are furniture”). Then, following a 20-minute delay (long delay), the participant is again asked to recall as many words from List A as they can, following by the cued recall condition (i.e., “tell me all the words from the list that are furniture”) and a recognition (Yes/No) condition. This variable represents the total correct words recalled on learning trial 1 (List A).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t1c.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) recalled on learning trial 1 (List A)
| Variable Name | Type |
|---|---|
| cv2t1i.bedside | numeric |
Total correct words recalled on learning trial 2 (List A)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t2c.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) recalled on learning trial 2 (List A)
| Variable Name | Type |
|---|---|
| cv2t2i.bedside | numeric |
Total correct words recalled on learning trial 3 (List A)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t3c.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) recalled on learning trial 3 (List A)
| Variable Name | Type |
|---|---|
| cv2t3i.bedside | numeric |
Total correct words recalled on learning trial 4 (List A)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t4c.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) recalled on learning trial 4 (List A)
| Variable Name | Type |
|---|---|
| cv2t4i.bedside | numeric |
Total correct words recalled on learning trial 5 (List A)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t5c.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) recalled on learning trial 5 (List A)
| Variable Name | Type |
|---|---|
| cv2t5i.bedside | numeric |
Total correct words recalled from List B
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2tb_c.bedside | numeric | 0 | 16 |
Total intrusions (incorrect words) recalled from List B
| Variable Name | Type |
|---|---|
| cv2tb_i.bedside | numeric |
Z-score for total false positive responses for List A when participant is presented with a recognition (Yes/No) format
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2zfp.bedside | numeric | Infinity | Infinity |
Z-score for total correct words recalled for List A when participant is presented with a recognition (Yes/No) format
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2zhit.bedside | numeric | Infinity | Infinity |
A verbal fluency/generativity task requiring the participant to generate as many words as they can think of that begin with the letter ‘D’ (a phonemic category) in one minute. Participants are not permitted to give names of people or places, and must not give the same word with different endings (e.g., bake, baked, baking). This variable captures the number of correct responses generated.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| d_corr.bedside | numeric | 0 | Infinity |
Number of word repetitions on the phonemic verbal fluency task (d words)
| Variable Name | Type |
|---|---|
| d_reps.bedside | numeric |
Number of rule violations on the phonemic verbal fluency task (d words). Rule violations include giving words that do not start with the letter ‘D’, giving the names of people or places, or repeating a word with different endings (e.g., bake, baked, baking).
| Variable Name | Type |
|---|---|
| d_rule_v.bedside | numeric |
Z-score for D Words performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dcorrz.bedside | numeric | Infinity | Infinity |
Number of repeated correct designs
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| df_co_rep.bedside | numeric | 0 | 34 |
Design Fluency is the Filled Dots condition from the Delis-Kaplan Executive Function Scale (DKEFS), measuring visual generativity. Participants are asked to generate as many different designs as they can in one minute by connecting dots with four straight lines. This task involves the ability to generate novel designs, remember the rules, accurately monitor for repetitions, and perform necessary shifting. Decreased processing speed may also cause poor performance.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| df_corr.bedside | numeric | 0 | 35 |
Total number of unique rule violations
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| df_rule_v.bedside | numeric | 0 | 35 |
Z-score for Design Fluency performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| DFCorrz.bedside | numeric | Infinity | Infinity |
Number of repeated rule violations
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dfrv_rep.bedside | numeric | 0 | 34 |
Digits Backwards was adapted from the version present in the WAIS-III and is considered a task of working memory. The examiner reads a string of numbers and the participant is asked to repeat them in backwards order. The length of the number string increases until the participant can no longer complete the task correctly. The bedside version of this task is focused on recording span length (number of digits that can be reversed correctly), rather than total number of items correct. This task requires both the adequate short-term store of verbal information (i.e., representing the presented digits forward) and the ability to manipulate that information within working memory (i.e., the backwards transform).
| Variable Name | Type |
|---|---|
| digit_bw.bedside | numeric |
Digits Forwards was adapted from the version present in the WAIS-III and is considered a task of basic attention span. The examiner reads a string of numbers and the participant is asked to repeat them in the same order. The length of the number string increases until the participant can no longer complete the task correctly. The bedside version of this task is focused on recording span length (number of digits that can be recalled correctly), rather than total number of items correct. Patients with reduced levels of attention (e.g., delirium) or reduced short-term auditory store (e.g., logopenic PPA) will do poorly on this task. Patients with reduced forward span will likely due poorly on many other tasks due to an inability to effectively maintain auditorily-presented instructions and/or more general difficulties with attention.
| Variable Name | Type |
|---|---|
| digit_fw.bedside | numeric |
Z-score for Digits Backwards performance
| Variable Name | Type |
|---|---|
| DigitBWz.bedside | numeric |
Sum of scores for all 30 items of the GDS
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gds_tot.bedside | numeric | 0 | 30 |
The GDS is a self-reported scale of current depressive symptoms. Participants are asked to rate a series of 30 statements as ‘Yes’ or ‘No’ regarding how they have been feeling in the previous two weeks. GDS item 1: “Are you basically satisfied with your life?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds1.bedside | 0, 1 | numeric | Yes, No |
GDS item 10: “Do you often feel helpless?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds10.bedside | 0, 1 | numeric | Yes, No |
GDS item 11: “Do you often get restless and fidgety?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds11.bedside | 0, 1 | numeric | Yes, No |
GDS item 12: “Do you prefer to stay at home rather than go out and do things?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds12.bedside | 0, 1 | numeric | Yes, No |
GDS item 13: “Do you frequently worry about the future?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds13.bedside | 0, 1 | numeric | Yes, No |
GDS item 14: “Do you feel you have problems with memory more than most?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds14.bedside | 0, 1 | numeric | Yes, No |
GDS item 15: “Do you think it is wonderful to be alive now?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds15.bedside | 0, 1 | numeric | Yes, No |
Sum of scores for the 15 items included in the Geriatric Depression Scale, short form (15-items)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gds15to.bedside | numeric | 0 | 15 |
GDS item 16: “Do you feel downhearted and blue?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds16.bedside | 0, 1 | numeric | Yes, No |
GDS item 17: “Do you feel pretty worthless the way you are now?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds17.bedside | 0, 1 | numeric | Yes, No |
GDS item 18: “Do you worry a lot about the past?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds18.bedside | 0, 1 | numeric | Yes, No |
GDS item 19: “Do you find life very exciting?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds19.bedside | 0, 1 | numeric | Yes, No |
GDS item 2: “Have you dropped many of your activities and interests?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds2.bedside | 0, 1 | numeric | Yes, No |
GDS item 20: “Is it hard for you to get started on new projects?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds20.bedside | 0, 1 | numeric | Yes, No |
GDS item 21: “Do you feel full of energy?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds21.bedside | 0, 1 | numeric | Yes, No |
GDS item 22: “Do you feel that your situation is hopeless?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds22.bedside | 0, 1 | numeric | Yes, No |
GDS item 23: “Do you think that most people are better off than you are?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds23.bedside | 0, 1 | numeric | Yes, No |
GDS item 24: “Do you frequently get upset over little things?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds24.bedside | 0, 1 | numeric | Yes, No |
GDS item 25: “Do you frequently feel like crying?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds25.bedside | 0, 1 | numeric | Yes, No |
GDS item 26: “Do you have trouble concentrating?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds26.bedside | 0, 1 | numeric | Yes, No |
GDS item 27: “Do you enjoy getting up in the morning?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds27.bedside | 0, 1 | numeric | Yes, No |
GDS item 28: “Do you prefer to avoid social occasions?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds28.bedside | 0, 1 | numeric | Yes, No |
GDS item 29: “Is it easy for you to make decisions?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds29.bedside | 0, 1 | numeric | Yes, No |
GDS item 3: “Do you feel that your life is empty?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds3.bedside | 0, 1 | numeric | Yes, No |
GDS item 30: “Is your mind as clear as it used to be?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds30.bedside | 0, 1 | numeric | Yes, No |
GDS item 4: “Do you often get bored?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds4.bedside | 0, 1 | numeric | Yes, No |
GDS item 5: “Are you hopeful about the future?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds5.bedside | 0, 1 | numeric | Yes, No |
GDS item 6: “Are you bothered by thoughts you can’t get out of your head?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds6.bedside | 0, 1 | numeric | Yes, No |
GDS item 7: “Are you in good spirits most of the time?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds7.bedside | 0, 1 | numeric | Yes, No |
GDS item 8: “Are you afraid that something bad is going to happen to you?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds8.bedside | 0, 1 | numeric | Yes, No |
GDS item 9: “Do you feel happy most of the time?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds9.bedside | 0, 1 | numeric | Yes, No |
The Mini Mental State Exam is a brief screening measure of global cognitive functioning (orientation, memory, language, executive function, visuospatial skills). Performance is scored out of a possible total of 30 points. The widely accepted cut off score to screening for cognitive impairment on the MMSE is <26.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mmse_tot.bedside | numeric | 0 | 30 |
Total number of correct switches made on the Modified Trail Making Task
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mt_corr.bedside | numeric | 0 | 14 |
Total number of switching errors made on the Modified Trail Making Test
| Variable Name | Type |
|---|---|
| mt_error.bedside | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mt_ln.bedside | numeric | Inf | 4.796 |
A ratio measure representing number of correct lines per minute
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mt_ratio.bedside | numeric | Infinity | Infinity |
The Modified Trail Making Test (MTT) is an adapted version of the traditional Trail Making Test (e.g., from the Delis-Kaplan Executive Function Scale), and is designed to be sensitive to problems with mentally manipulating information, including sequencing and cognitive flexibility. Numbers and days of the week are presented in an random pattern on an A4 sheet of paper and participants are asked to draw a line alternating between numbers and days of the week in order, as quickly as they can (maximum of 120 seconds allowed). Although classically thought of as a task of executive function, the MTT task requires multiple cognitive processes, including visual scanning, speed of processing, and set-shifting abilities. Thus, impairment on this task can be due to a variety of causes. This variable represents the total time (in seconds) taken to complete the task.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mt_time.bedside | numeric | 0 | 120 |
Z-score for Modified Trails performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| MTTimez.bedside | numeric | Infinity | Infinity |
The Number Location test is a subtest on the Visual-Object Spatial Perception Test (VOSP). A box with the numbers 1-9 scattered in random positions is located above another box with a single dot that matches the location (within the box) of one on the numbers above. The participant is asked to identify the number that matches the position of the dot. A total of 10 trials are administered. This task is considered a measure of visuo-perception (dorsal visual stream function), however, patients can frequently demonstrate difficulties on this task due to an inability to understand the abstract nature of the task instructions and/or impulsivity regarding their decision-making.
| Variable Name | Type |
|---|---|
| numb_loc.bedside | numeric |
The Stroop task requires participants to state the colour of ink in which blocks of letters are printed in as quickly as they can. In the color naming condition, blocks of X’s are presented in either blue, green or red across a page. The participant is asked to state the color of the ink the blocks of letters are printed in as quickly as they can without making mistakes. A total of 60 seconds is allowed. This score represents the number of correctly named colors within 60 seconds. This task is considered a measure of information processing speed.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cn_cor.bedside | numeric | 0 | 126 |
Total number of errors made on Stroop (color naming condition)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cn_err.bedside | numeric | 0 | 126 |
The Stroop task requires participants to state the colour of ink in which blocks of letters are printed in as quickly as they can. In the interference condition, the blocks of letters spell the word of a colour that is different to the colour of the ink the word is printed in. This task is viewed as a measure of executive functioning because the patient has to inhibit the overlearned/automatic reading response, and instead focus on the perceptual attributes of the stimuli (i.e., name the color of the ink). Deficits in response inhibition can be subtle, reflected in disproportionate slowing in color naming on the interference condition relative to the color naming condition, or as frank errors (i.e., reading the words). Thus, comparative analysis of speed between the color naming condition and interference condition are helpful.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cor.bedside | numeric | 0 | 77 |
Total number of uncorrected errors made on Stroop (interference condition)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_err.bedside | numeric | 0 | 77 |
Total number of self-corrected errors made on Stroop (interference condition)
| Variable Name | Type |
|---|---|
| strp_sce.bedside | numeric |
Z-score for Stroop (interference condition) performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| StrpCorz.bedside | numeric | Infinity | Infinity |
Date of the particpant’s baseline WRAT performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_baseline_date.bedside | Date | N/A | N/A |
This task is adapted from the Wide Range Achievement Test-Fourth Edition (WRAT-4) and provides an estimate of premorbid verbal skills and reading level. 55 words of increasing length/difficulty are presented on a page and the participant is asked to pronounce each one. The task is discontinued if the participant makes 10 consecutive errors. If the participant can not pronounce at least 5 words on the task, they are asked to identify 15 single letters (when administration of letters is not required, 15 points is added to the total score). The total possible score on this task is therefore 70 (55 + 15). This variable represents the participants WRAT score at their baseline research visit.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_baseline.bedside | numeric | 0 | 70 |
Stating whether current visit is on or before the baseline WRAT
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wrat_on_or_before_current_date.bedside | FALSE, TRUE | logical |
Total WRAT score on the current research assessment
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_tot.bedside | numeric | 0 | 70 |
Date of the particpant’s baseline WRAT performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_baseline_date.bedside | Date | N/A | N/A |
This task is adapted from the Wide Range Achievement Test-Fourth Edition (WRAT-4) and provides an estimate of premorbid verbal skills and reading level. 55 words of increasing length/difficulty are presented on a page and the participant is asked to pronounce each one. The task is discontinued if the participant makes 10 consecutive errors. If the participant can not pronounce at least 5 words on the task, they are asked to identify 15 single letters (when administration of letters is not required, 15 points is added to the total score). The total possible score on this task is therefore 70 (55 + 15). This variable represents the participants WRAT score at their baseline research visit.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_baseline.bedside | numeric | 0 | 70 |
Stating whether current visit is on or before the baseline WRAT
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wrat_on_or_before_current_date.bedside | FALSE, TRUE | logical |
Total WRAT score on the current research assessment
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_tot.bedside | numeric | 0 | 70 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Berlin_apneaRisk.berlin_sleep | high risk, low risk | character |
The Brain Health Assessment (BHA) battery is part of the Tablet-based Cognitive Assessment Tool (TabCAT). This battery includes two required tests (Favorites, Match), two optional tests (Line Orientation, Animal Fluency), and an optional informant survey (Brain Health Survey [BHS]).
Total correct score for Match, which follows a digit-symbol test paradigm. This task requires multiple cognitive processes, including processing speed, working memory, and visual scanning, and thus is sensitive to executive dysfunction.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digitsymbol_corr.brainhealthassessment | numeric | 0 | 200 |
Total errors made during Match
| Variable Name | Type |
|---|---|
| digitsymbol_err.brainhealthassessment | numeric |
Favorites is an associative memory test. This is the total correct at a 10-minute delay.
| Variable Name | Type |
|---|---|
| favorites_delay.brainhealthassessment | numeric |
Favorites is an associative memory test. This is the total correct at the first immediate recall trial.
| Variable Name | Type |
|---|---|
| favorites_recall1.brainhealthassessment | numeric |
Favorites is an associative memory test. This is the total correct at the second immediate recall trial.
| Variable Name | Type |
|---|---|
| favorites_recall2.brainhealthassessment | numeric |
Favorites is an associative memory test. This is the total correct at the 10-minute delay recognition trial.
| Variable Name | Type |
|---|---|
| favorites_recog_corr.brainhealthassessment | numeric |
Favorites is an associative memory test. This is the number of intrusion errors at the 10-minute delay recognition trial (i.e., a previously learned face incorrectly paired with a novel food or animal).
| Variable Name | Type |
|---|---|
| favorites_recog_err.brainhealthassessment | numeric |
Favorites is an associative memory test. This is the number of source memory errors at the 10-minute delay recognition trial (i.e., a previously learned food or animal incorrectly paired with a difference face).
| Variable Name | Type |
|---|---|
| favorites_recog_sme.brainhealthassessment | numeric |
Favorites is an associative memory test. This is the Total Recall score, which is the total number correct summed across the two immediate recall and one 10-minute delayed recall trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_total.brainhealthassessment | numeric | 0 | 24 |
TabCAT BHA Line Orientation is modeled after the Benton Judgment of Line Orientation Task. 10 easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicate that the Threshold Score may not be valid.
| Variable Name | Type |
|---|---|
| lo_catchtrial.brainhealthassessment | numeric |
TabCAT BHA Line Orientation is modeled after the Benton Judgment of Line Orientation Task. This is the Threshold Score, which represents the average angle difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_score.brainhealthassessment | numeric | 1 | 90 |
TabCAT BHA Line Length is a visuospatial test in which examinees have to select the longer of two parallel lines. 10 very easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicates that the Threshold Score may not be valid.
| Variable Name | Type |
|---|---|
| par_line_catchtrial.brainhealthassessment | numeric |
TabCAT BHA Line Length is a visuospatial test in which examinees have to select the longer of two parallel lines. This is the Threshold Score, which represents the average length difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| par_line_score.brainhealthassessment | numeric | Anything > 0 | Infinity |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| v_type.brainhealthassessment | on-site | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_amfball_yn.bu_tbi | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| bu_amfball_yrs_ages.bu_tbi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_boxing_yn.bu_tbi | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_boxing_yrs_selfreport.bu_tbi | 1 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bu_concussion_agelast.bu_tbi | numeric | 0 | -99 |
| Variable Name | Type |
|---|---|
| bu_concussiontotal_maxest.bu_tbi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_icehockey_yn.bu_tbi | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_icehockey_yrs_ages_all.bu_tbi | 0, 12 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_military_blast100_total.bu_tbi | 0, 1, 2, 16, 44 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_military_highrisk_yn.bu_tbi | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_military_yn.bu_tbi | 0, 1 | numeric |
| Variable Name | Type |
|---|---|
| bu_military_yrs.bu_tbi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_soccer_yn.bu_tbi | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| bu_soccer_yrs_selfreport.bu_tbi | numeric |
The Clinical Dementia Rating is a 5-point scale used to characterize six domains of cognitive and functional performance applicable to Alzheimer disease and related dementias: Memory, Orientation, Judgment & Problem Solving, Community Affairs, Home & Hobbies, and Personal Care.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cdr_box.cdr | numeric | 0.0 | 18.0 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cdr_global.cdr | 0.0, 0.5, 1.0, 2.0, 3.0 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ftld_cdr_box.cdr | numeric | 0.0 | 24.0 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ftld_cdr_global.cdr | 0.0, 0.5, 1.0, 2.0, 3.0 | numeric |
The Community Healthy Activities Model Program for Seniors physical activity questionnaire (CHAMPS) assesses the variety of physical activity that older adult participants may engage in, from less intensive forms such as walking or stretching to more vigorous exercise routine. The questionnaire includes 41 items to evaluate the frequency and duration of light, moderate, and vigorous activities that were performed weekly over the last four weeks. Individuals will select whether they participated in an activity during the four-week period and then select the hours per week spent participating in the activity, rating the duration on a 6-point scale from less than 1 hour to 9 or more hours. Each activity corresponds to a metabolic weight or MET value. Estimated caloric expenditure is then calculated by multiplying the estimated duration of each activity by the corresponding MET value.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| DCDate_physical.champs | Date | 2015-05-21 | 2023-04-26 |
| Variable Name | Type |
|---|---|
| METWeightcompleted.champs | numeric |
MET weighted score for ch11 (Errands). Score is creating by taking the estimated duration of running errands (0.5 - 9.75)*met value of 2.5
| Variable Name | Type |
|---|---|
| METWeighted_Q13.champs | numeric |
MET weighted score for ch13 (golf). Score is creating by taking the estimated duration of time playing golf (0.5 - 9.75)*met value of 2.5
| Variable Name | Type |
|---|---|
| METWeighted_Q15.champs | numeric |
MET weighted score for ch18 (tennis). Score is creating by taking the estimated duration of time playing tennis (0.5 - 9.75)*met value of 5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q20.champs | 2.50, 8.75, 18.75, 28.75, 48.75 | numeric |
MET weighted score for ch19 (skateboarding). Score is creating by taking the estimated duration of time skateboarding (0.5 - 9.75)*met value of 4.5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q21.champs | 4 | numeric |
MET weighted score for ch22 (chores). Score is creating by taking the estimated duration of time doing chores (0.5 - 9.75)*met value of 2.75
| Variable Name | Type |
|---|---|
| METWeighted_Q24.champs | numeric |
MET weighted score for ch23 (gardening). Score is creating by taking the estimated duration of time gardening (0.5 - 9.75)*met value of 3.125
| Variable Name | Type |
|---|---|
| METWeighted_Q25.champs | numeric |
MET weighted score for ch24 (car). Score is creating by taking the estimated duration of time working on car/lawn/machinery (0.5 - 9.75)*met value of 3
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q26.champs | 1.50, 5.25, 11.25, 29.25 | numeric |
MET weighted score for ch25 (jogrun). Score is creating by taking the estimated duration of time jogging or running (0.5 - 9.75)*met value of 7
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q27.champs | 3.50, 12.25, 26.25, 40.25, 68.25 | numeric |
MET weighted score for ch26 (briskwalk). Score is creating by taking the estimated duration of time brisk walking (0.5 - 9.75)*met value of 3.5
| Variable Name | Type |
|---|---|
| METWeighted_Q28.champs | numeric |
MET weighted score for ch27 (leisure walk). Score is creating by taking the estimated duration of time leisurely walking (0.5 - 9.75)*met value of 2.5
| Variable Name | Type |
|---|---|
| METWeighted_Q29.champs | numeric |
MET weighted score for ch28 (bike ). Score is creating by taking the estimated duration of time riding a bike (0.5 - 9.75)*met value of 4
| Variable Name | Type |
|---|---|
| METWeighted_Q30.champs | numeric |
MET weighted score for ch29 (aero). Score is creating by taking the estimated duration of time doing aerobics, rowing, step machines (not treadmill or stationary bike)!! (0.5 - 9.75)*met value of 5
| Variable Name | Type |
|---|---|
| METWeighted_Q31.champs | numeric |
MET weighted score for ch30 (swim). Score is creating by taking the estimated duration of time swimming (not treadmill or stationary bike)!! (0.5 - 9.75)*met value of 3.66
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q32.champs | 1.8330, 6.4155, 13.7475, 21.0795 | numeric |
MET weighted score for ch31 (flexb). Score is creating by taking the estimated duration of time doing stretching or flexibility exercises (not yoga or tai chi)!! (0.5 - 9.75)*met value of 2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q33.champs | 1.0, 3.5, 7.5, 11.5, 15.5 | numeric |
MET weighted score for ch32 (yoga). Score is creating by taking the estimated duration of time doing yoga, barre, tai chi, pilates (0.5 - 9.75)*met value of 2
| Variable Name | Type |
|---|---|
| METWeighted_Q34.champs | numeric |
MET weighted score for ch33 (danceb). Score is creating by taking the estimated duration of time doing dance (such as square, folk, line, ballroom), not aerobic dance (0.5 - 9.75)*met value of 4.5
| Variable Name | Type |
|---|---|
| METWeighted_Q35.champs | numeric |
MET weighted score for ch34 (danceb). Score is creating by taking the estimated duration of time doing aerobics or aerobic dance (0.5 - 9.75)*met value of 3.5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q36.champs | 1.750, 6.125, 13.125, 20.125, 27.125 | numeric |
MET weighted score for ch35 (strength). Score is creating by taking the estimated duration of time doing strength training (0.5 - 9.75)*met value of 3.33
| Variable Name | Type |
|---|---|
| METWeighted_Q37.champs | numeric |
MET weighted score for ch36 (sport). Score is creating by taking the estimated duration of time playing sports (0.5 - 9.75)*met value of 5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q38.champs | 2.50, 8.75, 18.75, 48.75 | numeric |
Number of new activities that were began in the past year (irrespective of activity type). Value is calculated by summing the total number of new cognitive, physical, and social activities. **Not 36 because movies is not included in these categories
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| New_ALL.champs | numeric | 0 | 35 |
Number of new cognitive activities that were began in the past year (“ch6emailc”,“ch7financc”,“ch8workc”,“ch9cookc”,“ch10medicc”,“ch12craftc”,“ch14attendc”,“ch20instrumc”,“ch21readc”,“ch24carc”)
| Variable Name | Type |
|---|---|
| New_Cog.champs | numeric |
Number of new physical activities that were began in the past year (ch11errandc”,“ch13golfc”,“ch18tennisc”,“ch19skatec”,“ch22chorec”,“ch23gardenc”,“ch25jogrunc”,“ch26briskwalkc”,“ch27leiswalkc”,“ch28bikec”,“ch29aerobothc”,“ch30swimc”,“ch31flexc”,“ch32yogac”,“ch33dancec”,“ch34aerobc”,“ch35strengthc”,“ch36sportc”)
| Variable Name | Type |
|---|---|
| New_Phys.champs | numeric |
Number of new social activities that were began in the past year (“ch1friendsc”,“ch2srcenterc”,“ch3volunc”,“ch4worshc”,“ch5clubc”,“ch15gamec”,“ch17billiardc”)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| New_Soc.champs | 0, 1, 2, 3, 4 | numeric |
Sum of all METweighted variables (19) * (weight*0.4539)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| TotalCaloricExpenditure.champs | numeric | 0 | 12528.99 |
Total # of activities completed in the last 4 weeks, on a typical week (irrespective of activity type). Value is calculated by summing the total number of cognitive, physical, and social activities.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| TotalNum_ALL.champs | numeric | 0 | 35 |
Total # of cognitive activities completed in the last 4 weeks, on a typical week (“ch6emailc”,“ch7financc”,“ch8workc”,“ch9cookc”,“ch10medicc”,“ch12craftc”,“ch14attendc”,“ch20instrumc”,“ch21readc”,“ch24carc”)
| Variable Name | Type |
|---|---|
| TotalNum_Cog.champs | numeric |
Total # of physical activities completed in the last 4 weeks, on a typical week (ch11errandc”,“ch13golfc”,“ch18tennisc”,“ch19skatec”,“ch22chorec”,“ch23gardenc”,“ch25jogrunc”,“ch26briskwalkc”,“ch27leiswalkc”,“ch28bikec”,“ch29aerobothc”,“ch30swimc”,“ch31flexc”,“ch32yogac”,“ch33dancec”,“ch34aerobc”,“ch35strengthc”,“ch36sportc”)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| TotalNum_Phys.champs | numeric | 0 | 18 |
Total # of social activities completed in the last 4 weeks, on a typical week (“ch1friendsc”,“ch2srcenterc”,“ch3volunc”,“ch4worshc”,“ch5clubc”,“ch15gamec”,“ch17billiardc”)
| Variable Name | Type |
|---|---|
| TotalNum_Soc.champs | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.champs | 2 | numeric |
Participants weight. Max and min values are to provide very broad possible range
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| weight.champs | numeric | 98 | 400 |
Sum of the count for the times/week the participant completes a given activity (sum of cognitive, physical and social weekly hours variables)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyCount_ALL.champs | numeric | 0 | 2123.00 |
Sum of the count for the times/week the participant completes all cognitive activites
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyCount_Cog.champs | numeric | 0 | 2098.00 |
Sum of the count for the times/week the participant completes all physical activites
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyCount_Phys.champs | numeric | 0 | 68.00 |
Sum of the count for the times/week the participant completes all social activites
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyCount_Soc.champs | numeric | 0 | 35.00 |
Sum of the hours spent on all activities per week (cognitive + physical + social weekly hours)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyHrs_ALL.champs | numeric | 0 | 341.25 |
Sum of the hours spent on cognitive activities per week
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyHrs_Cog.champs | numeric | 0 | 97.5 |
Sum of the hours spent on physical activities per week
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyHrs_Phys.champs | numeric | 0 | 175.5 |
Sum of the hours spent on social activities per week
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyHrs_Soc.champs | numeric | 0 | 68.25 |
Our clinical labs capture routine labs. (Glucose, Hemoglobin, Insulin, Total Cholesterol, triglyceride, HDL, LDL, Choleterol HDL Ratio, NonHDL Cholesterol, hsCRP, and HOMA-IR).
Cholesterol HDL Ratio (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cholesterol_hdl_ratio.clinical_labs | numeric | 0.3 | 17.3 |
Glucose (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| glucose_mg_d_l.clinical_labs | numeric | 37 | 222 |
High density lipoprotein (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hdl_mg_d_l.clinical_labs | numeric | 10 | 131 |
Hemoglobin A1C (%)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hemoglobin_a1c_percent.clinical_labs | numeric | 4.1 | 9.1 |
Homeostatic Model Assessment of insulin resistance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| homa_ir.clinical_labs | numeric | 0.28 | 79.90 |
High sensitivity C reactive protein test in mg/l
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hs_crp_mg_l.clinical_labs | numeric | 0.1 | 97.0 |
Insulin levels (uU/ml)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| insulin_u_u_ml.clinical_labs | numeric | 1.5 | 70.6 |
LDL (low density lipoprotein) levels (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ldl_mg_d_l.clinical_labs | numeric | 10 | 349 |
Non HDL(high density lipoprotein) cholesterol
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| non_hdl_cholesterol.clinical_labs | numeric | 25 | 277 |
Total cholesterol (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total_cholesterol_mg_dl.clinical_labs | numeric | 52 | 345 |
Triglyceride levels
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| triglycerides.clinical_labs | numeric | 16 | 411 |
The Cognitive Activity Scale (CAS) assesses the frequency of cognitive stimulation throughout life. The CAS is a 25-item interview in which participants are asked to report how often they engaged in common cognitively demanding activities that depend minimally on socioeconomic status, such as reading books or newspapers, writing letters or e-mails, going to the library, and playing games, at 5 age epochs: 6, 12, 18, and 40 years and the current age. Responses for each item were made using a 5-point frequency scale: 5, every day or almost every day; 4, several times a week; 3, several times a month; 2, several times a year; and 1, once a year or less.
Wilson, R., Barnes, L., & Bennett, D. (2003). Assessment of lifetime participation in cognitively stimulating activities. Journal of clinical and experimental neuropsychology, 25(5), 634–642. https://doi.org/10.1076/jcen.25.5.634.14572
Landau, S. M., Marks, S. M., Mormino, E. C., Rabinovici, G. D., Oh, H., O’Neil, J. P., Wilson, R. S., & Jagust, W. J. (2012). Association of lifetime cognitive engagement and low β-amyloid deposition. Archives of neurology, 69(5), 623–629. https://doi.org/10.1001/archneurol.2011.2748
Final score: Total points/# of questions, not including value “9” which indicates don’t know
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| cas_score.cogntive_activity_scale | 1, 2, 3, 4, 5, 9 | categorical | 9= I don’t know, the rest of the values represent the total points/# of questions, where higher scores indicate greater cognitive activity |
Total points for questions 1 through 25, inverse scoring
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cas_tot_pts.cogntive_activity_scale | numeric | 25 | 125 |
Reading total score (sum) from lifetime cognitive activities questions that ask about how many hours per day are spent reading newspapers (#3), magazines (#4), and books (#5), higher scores = more hours spent reading
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lca_reading.cogntive_activity_scale | numeric | 0 | 12 |
Total score (sum) of lifetime cognitive activities questions (1, 1a, 2, 2a, 3, 4, 5, 5a, 6, 7, 8)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lca_total.cogntive_activity_scale | numeric | 2 | 51 |
The Continuous Performance Test (CPT) is an NIH-EXAMINER response inhibition task, which requires subjects to respond to a certain type of stimulus and withhold a response to another. The examinee is presented with different images and instructed to press a key for only the target image, responding as quickly and accurately as possible. The task consists of 100 experimental trials, 80% of which were the target image. The five non-target images that were presented were of a similar shape and size to the target.
Total number of trials where the subject response/non-response was correct
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total_corr.cpt | numeric | 67 | 250 |
Total number of trials where the subject response/non-response was incorrect
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total_errors.cpt | numeric | 0 | 33 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab1_40_pg_m_l.csf | numeric | 4445 | 20511 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab1_42_pg_m_l.csf | numeric | 214 | 1942 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf_spec_id.csf | numeric | 775239 | 3452428 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gap43_156_10000_pg_ml_csf.csf | numeric | 1301.7 | 6394.2 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ng36_pg_m_l.csf | numeric | 82.610 | 460.390 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| p_tau_pg_m_l.csf | numeric | 15.5 | 226.9 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| snap25long_p_m.csf | numeric | 6.4 | 33.1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| snap25tot_p_m.csf | numeric | 16.8 | 88.0 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| syt1_p_m.csf | numeric | 9.0 | 64.4 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| t_tau_pg_m_l.csf | numeric | 104 | 1140 |
The demeographic information collected on each participant comes as a self reported measure collected at their first visit, and updated thereafter with any changes that might occur.
Variable marking if participant is deceased or alive
| Label | Value |
|---|---|
| 0 | Alive |
| 1 | Deceased |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| deceased.demographics | 0, 1 | categorical | Alive, Deceased |
Years of education a participant has
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| educ.demographics | numeric | 0 | 35 |
Self-reported gender of the participant. 1 = Male, 2=Female
| Label | Value |
|---|---|
| 1 | Male |
| 2 | Female |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gender.demographics | 1, 2 | categorical | Male, Female |
Self-reported handiness of participant
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hand.demographics | AMBIDEXTROUS, LEFT, RIGHT | categorical |
Plain text version of which country themselves or their family report as their ethnicity if they are Hispanic/Latino
| Variable Name | Type |
|---|---|
| if_span_or_country_text.demographics | character |
If a participant is Hispanic/Latino, which country themselves or their family report as their ethnicity
| Variable Name | Type |
|---|---|
| if_span_or_ctry.demographics | categorical |
Plain text version of Geographical region of Hispanic/Latin descent - automatically population from Spanish Origin: Country Variable
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| if_span_or_reg_text.demographics | North American, South American, Central American, Carribbean, Spain, Other Region, Unknown/Refused to Answer | character |
Geographical region of Hispanic/Latin descent - automatically population from Spanish Origin: Country Variable
| Label | Value |
|---|---|
| 1 | North American |
| 2 | South American |
| 3 | Central American |
| 4 | Carribbean |
| 5 | Spain |
| 6 | Other Region |
| 99 | Unknown/Refused to Answer |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| if_span_or_reg.demographics | 1, 2, 3, 4, 5, 6, 99 | categorical | North American, South American, Central American, Carribbean, Spain, Other Region, Unknown/Refused to Answer |
Plain text version of older version of how Spanish origin was collected: General regions in which the participant may be from
| Variable Name | Type |
|---|---|
| if_span_or_text.demographics | character |
Older version of how Spanish origin was collected: General regions in which the participant may be from
| Variable Name | Type |
|---|---|
| if_span_or.demographics | categorical |
Self-reported measure of whether the participant identifies as multi-racial
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| mult_rac.demographics | 1, 2 | categorical | Yes, No |
Primary language the participant speaks and prefers to communicate in
| Variable Name | Type |
|---|---|
| primary_language.demographics | character |
Plain text version of participant’s self reported race
| Variable Name | Type |
|---|---|
| race_simple_text.demographics | character |
Self-reported race of participant
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| race_simple.demographics | categorical | 1 | 99 |
Whether the participant reports being of Hispanic/Latino descent
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| span_or_text.demographics | No, Yes | character |
Whether the participant reports being of Hispanic/Latino descent
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 9 | Unknown |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| span_or.demographics | 1, 2, 9 | categorical | Yes, No, Unknown |
Language the participant is tested in
| Variable Name | Type |
|---|---|
| testing_language.demographics | character |
Clinical syndrome and research diagnoses assigned during case consensus conference review of all available data collected (e.g., history, neurologic exam, cognitive performance, neuroimaging) by a multidisciplinary team including neurologists and neuropsychologists.
Best estimate of clinical syndrome based on case consensus conference
| Variable Name | Type |
|---|---|
| clin_syn_best_est.diagnosis | character |
Second best estimate of clinical syndrome based on case consensus conference
| Variable Name | Type |
|---|---|
| clin_syn_sec_est.diagnosis | character |
Primary diagnosis per published research diagnostic criteria discussed based on case consensus conference review
| Variable Name | Type |
|---|---|
| res_dx_a.diagnosis | character |
Secondary diagnosis per published research diagnostic criteria based on case consensus conference review
| Variable Name | Type |
|---|---|
| res_dx_b.diagnosis | character |
All participants are given a diagnosis at each time point. These diagnoses are classified through a case consensus conference with board-certified neurologists and neuropsychologists, after a review of cognitive testing, informant interviews, and a thorough neurological exam. Participants are given a clinical syndrome, a research diagnosis, and an estimated predicted neuropathology given the data available at the time of the consensus conference. The diagnosis_latest variable is defined as the diagnosis most recent to a specified date.
Based on clinical features, the clinicians best estimate of the syndrome that best characterizes the patient’s CURRENT presentation.
| Variable Name | Type |
|---|---|
| clin_syn_best_est.diagnosis_latest | character |
Based on clinical features, the clinicians secondary (optional) estimate of the syndrome that best characterizes the patient’s CURRENT presentation.
| Variable Name | Type |
|---|---|
| clin_syn_sec_est.diagnosis_latest | character |
The subject meets established research criteria for this diagnosis [no priority of diagnosis implied by A,B,C,D,E]
| Variable Name | Type |
|---|---|
| res_dx_a.diagnosis_latest | character |
The subject meets established research criteria for this diagnosis [no priority of diagnosis implied by A,B,C,D,E]
| Variable Name | Type |
|---|---|
| res_dx_b.diagnosis_latest | character |
The diet score comes from the Mediterranean-DASH Diet Intervention for Neurodegenerative Delay (MIND) Diet: MIND Diet Score. The MIND diet score is based on a combination of 10 healthy food groups (leafy green vegetables, other vegetables, nuts, berries, beans, whole grains, fish, poultry, olive oil, and wine) and 5 unhealthy food groups (red meats, butter and stick margarine, cheese, pastries and sweets, fried food, and fast food). The frequency of consumption of each food item for a given score component is summed and then given a concordance score of 0, 0.5, or 1, where 1 represented the highest concordance. The final MIND diet score is the sum of the 15 component scores.
Morris, M. C., Tangney, C. C., Wang, Y., Sacks, F. M., Barnes, L. L., Bennett, D. A., & Aggarwal, N. T. (2015). MIND diet slows cognitive decline with aging. Alzheimer’s & dementia : the journal of the Alzheimer’s Association, 11(9), 1015–1022. https://doi.org/10.1016/j.jalz.2015.04.011
Panagiotakos, D. B., Pitsavos, C., Arvaniti, F., & Stefanadis, C. (2007). Adherence to the Mediterranean food pattern predicts the prevalence of hypertension, hypercholesterolemia, diabetes and obesity, among healthy adults; the accuracy of the MedDietScore. Preventive medicine, 44(4), 335–340. https://doi.org/10.1016/j.ypmed.2006.12.009
Total MIND Diet Score (Sum of Q1 - Q15); higher scores indicate greater diet concordance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dietq_mindscore.diet | numeric | 0 | 15 |
Dot Counting is a working memory task where participants are presented with a series of screens with an array of blue and green circles and squares. The participant is instructed to count the number of blue circles out loud, remembering the total for later recall. The task gets progressively more challenging as more screens are shown.
Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., … Widmeyer, M. (2014). NIH EXAMINER: Conceptualization and Development of an Executive Function Battery. Journal of the International Neuropsychological Society, 20(1), 11–19. doi:10.1017/S1355617713001094
Bettcher, B. M., Mungas, D., Patel, N., Elofson, J., Dutt, S., Wynn, M., Watson, C. L., Stephens, M., Walsh, C. M., & Kramer, J. H. (2016). Neuroanatomical substrates of executive functions: Beyond prefrontal structures (-1st ed.). Neuropsychologia. https://www.sciencedirect.com/science/article/pii/S0028393216300665
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dot_counting_lava.dot_counting | numeric | 0 | 27 |
trial 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_t1.dot_counting | 0, 1, 2 | numeric |
trial 2 scpre
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_t2.dot_counting | 0, 1, 2, 3 | numeric |
trial 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_t3.dot_counting | 0, 1, 2, 3, 4 | numeric |
trial 4 score
| Variable Name | Type |
|---|---|
| dot_counting_t4.dot_counting | numeric |
trial 5 score
| Variable Name | Type |
|---|---|
| dot_counting_t5.dot_counting | numeric |
trial 6 score
| Variable Name | Type |
|---|---|
| dot_counting_t6.dot_counting | numeric |
time duration
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dot_counting_task_duration.dot_counting | numeric | 0 | 748 |
Form Version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_task_form.dot_counting | A, B, C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_task_language.dot_counting | English, Spanish (Argentina, Uruguay), Spanish (MEX, ESP, Central America), Spanish-MEX | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_task_version.dot_counting | 1.0.0, 3.0.0 | character |
Z-score
| Variable Name | Type |
|---|---|
| dot_counting_total_score_z.dot_counting | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dot_counting_total_tabcat.dot_counting | numeric | 0 | 27 |
The Early Developmental History Screening Questionnaire is a comprehensive survey of early-childhood behavioral and cognitive performance. Individuals were asked to select Likert scale responses (never, sometimes, often, or always) to questions regarding early childhood development and scholastic performance across multiple cognitive domains.
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_anti.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_anx.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_art.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_att.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_dep.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_dys.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_f_lan.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_hyp.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_imp.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_lan.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_math.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_mech.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_mot.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_music.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_obs.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_oth.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_read.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_shy.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_spell.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_sport.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
The Edinburgh Handedness Inventory is a questionnaire used to assess the handedness of a subject in activities of daily living (ADLs). The participant is asked to indicate their preference for using their left or right hand for a variety of daily tasks, on a scale of “Only use left hand”, “Prefer left hand”, “Indifferent”, “Prefer right hand”, and “Only use right hand”.
Total score
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ehi_tot.edinburgh_handedness | numeric | 2 | 60 |
Hand preference for “Writing”
| Label | Value |
|---|---|
| 1 | Only use left hand |
| 2 | Prefer left hand |
| 3 | Indifferent |
| 4 | Prefer right hand |
| 5 | Only use right hand |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ehi1.edinburgh_handedness | 1, 2, 3, 4, 5 | numeric | Only use left hand, Prefer left hand, Indifferent, Prefer right hand, Only use right hand |
Hand preference for “Opening Box (lid)”
| Variable Name | Type |
|---|---|
| ehi10.edinburgh_handedness | numeric |
Which foot the subject prefers to kick with
| Variable Name | Type |
|---|---|
| ehi11.edinburgh_handedness | numeric |
Which eye the subject uses when only needing one
| Variable Name | Type |
|---|---|
| ehi12.edinburgh_handedness | numeric |
Hand preference for “Drawing”
| Variable Name | Type |
|---|---|
| ehi2.edinburgh_handedness | numeric |
Hand preference for “Throwing”
| Variable Name | Type |
|---|---|
| ehi3.edinburgh_handedness | numeric |
Hand preference for “Scissors”
| Variable Name | Type |
|---|---|
| ehi4.edinburgh_handedness | numeric |
Hand preference for “Toothbrush”
| Variable Name | Type |
|---|---|
| ehi5.edinburgh_handedness | numeric |
Hand preference for “Knife (without a fork)”
| Variable Name | Type |
|---|---|
| ehi6.edinburgh_handedness | numeric |
Hand preference for “Spoon”
| Variable Name | Type |
|---|---|
| ehi7.edinburgh_handedness | numeric |
Hand preference for “Broom (upper hand)”
| Variable Name | Type |
|---|---|
| ehi8.edinburgh_handedness | numeric |
Hand preference for “Striking Match”
| Variable Name | Type |
|---|---|
| ehi9.edinburgh_handedness | numeric |
Whether the subject was naturally left handed and taught (or forced) to switch handedness at a young age
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| natural_l.edinburgh_handedness | 0, 1 | numeric | Yes, No |
Whether the subject was naturally right handed and taught (or forced) to switch handedness at a young age
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| natural_r.edinburgh_handedness | 0, 1 | numeric | Yes, No |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flankerinc.enclosedflanker | numeric | 0.666 | 10.109 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkincacc.enclosedflanker | numeric | 0.000 | 1.000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkincaccscore.enclosedflanker | numeric | 0.000 | 5.000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkinclog.enclosedflanker | numeric | 2.595 | 3.287 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkincrtscore.enclosedflanker | numeric | 0.032 | -6.369 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkincstem.enclosedflanker | numeric | 0.014 | -0.022 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| task.enclosedflanker | AgingCog_EnclosedFlanker, Flanker_RO1_Behavioral | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.enclosedflanker | 1, 1.0.1, 1.0.2 | character |
The Epworth Sleepiness Scale is widely used in the field of sleep medicine as a subjective measure of a patient’s sleepiness. The questionnaire is a list of eight situations in which you rate your tendency to become sleepy on a scale of 0, no chance of dozing, to 3, high chance of dozing. The scale estimates whether you are experiencing excessive sleepiness that possibly requires medical attention.
Total score on questionnaire. The higher the total the higher daytime sleepiness a participant experiences.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ESStotal.epworth_sleepiness | numeric | 0 | 21 |
This is a 51-item self-report questionnaire combinining items from the Everyday Cognition (ECog) questionnaire and the Daily Function Questionnaire (DFQ). Participants are asked to rate whether they’ve experienced a change in their ability to do different domain-specific tasks compared to 10 years ago. Response options include: 1=Better or no change; 2=Questionable/occasionally worse; 3=Consistently a little worse; 4=Consistently much worse
Farias, S. T., Mungas, D., Reed, B. R., Cahn-Weiner, D., Jagust, W., Baynes, K., & DeCarli, C. (2008). The measurement of everyday cognition (ECog): scale development and psychometric properties. Neuropsychology, 22(4), 531.
Farias, S. T., Mungas, D., & Jagust, W. (2005). Degree of discrepancy between self and other‐reported everyday functioning by cognitive status: dementia, mild cognitive impairment, and healthy elders. International Journal of Geriatric Psychiatry: A journal of the psychiatry of late life and allied sciences, 20(9), 827-834.
Executive Function/Attention composite score averaging the responses from 5 attention-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_attn_score.everydaycogself | numeric | 1 | 4 |
Single item asking about concern about memory or thinking problems (yes/no)
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ec_concern.everydaycogself | 0, 1 | categorical | No, Yes |
Language composite score averaging the responses from 9 language-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_lang_score.everydaycogself | numeric | 1 | 4 |
Memory composite score averaging the responses from 11 memory-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_mem_score.everydaycogself | numeric | 1 | 4 |
Executive Function/Organization composite score averaging the responses from 7 organization-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_org_score.everydaycogself | numeric | 1 | 4 |
Composite score averaging the responses from 7 “other” items
| Variable Name | Type |
|---|---|
| ec_other_score.everydaycogself | numeric |
Executive Function/Planning composite score averaging the responses from 5 planning-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_plan_score.everydaycogself | numeric | 1 | 4 |
Total Score: Average of all item responses
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_score.everydaycogself | numeric | 1 | 4 |
Visuospatial composite score averaging the responses from 7 visuospatial-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_vis_score.everydaycogself | numeric | 1 | 4 |
The Functional Activities Questionnaire (FAQ) measures instrumental activities of daily living (IADLs), such as preparing balanced meals and managing personal finances
Pfeffer, R.I., Kurosaki, T.T., Harrah, C.H. Jr., Chance, J.M., & Filos, S. (1982). Measurement of functional activities in older adults in the community. Journal of Gerontology, 37(3), 323-329. Reprinted with permission of Oxford University Press.
Mayo, A. M. (2016). Use of the Functional Activities Questionnaire in older adults with dementia. Hartford Inst Geriatr Nurs, 13(2).
10-item questionnaire in which patient is rated as follows on different activities of daily living (Dependent = 3 • Requires assistance = 2 • Has difficulty but does by self = 1 • Never did and would have difficulty now = 1, Normal = 0 • Never did [the activity] but could do now = 0). Total score ranges from 0-30 with higher numbers indicating more functional impairment.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| faq_tot.faq | numeric | 0 | 30 |
The Fishermen Story is a 20-unit story that is read aloud to the examinee across a minimum of 5 learning trials. Additional learning trials are administered until the examinee reaches a 90% mastery criterion (18/20 units) to help control for initial learning levels. The examinee is then asked to recall the story 30 minutes after and one week later.
How much of the story the participant recalls after 30 minutes.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total30min.fishermanstory | numeric | 0 | 20 |
How much of the story the participants recalls after one week.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| totalweek.fishermanstory | numeric | 0 | 20 |
Participants are asked to wear a Fitbit device for 30 days. Daily aggregate and minute-level information about step counts, sleep, and heart rate are collected. Step cadence metrics were based on published data summarized in Tudor-Locke et al., 2018.
Paolillo, E. W., Lee, S. Y., VandeBunte, A., Djukic, N., Fonseca, C., Kramer, J. H., & Casaletto, K. B. (2022). Wearable use in an observational study among older adults: adherence, feasibility, and effects of clinicodemographic factors. Frontiers in Digital Health, 4, 884208.
Tudor-Locke, C., Han, H., Aguiar, E. J., Barreira, T. V., Schuna Jr, J. M., Kang, M., & Rowe, D. A. (2018). How fast is fast enough? Walking cadence (steps/min) as a practical estimate of intensity in adults: a narrative review. British journal of sports medicine, 52(12), 776-788
An average of the daily estimated total energy expenditure (in kilocalories) across study days.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_daily_calories.fitbit | numeric | 1 | Infinity |
Average number of minutes classified as being asleep per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_mins_asleep.fitbit | numeric | 0 | 1440 |
Average number of minutes classified as being in deep sleep per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_mins_deep.fitbit | numeric | 0 | 1440 |
Average number of minutes classified as being in light sleep per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_mins_light.fitbit | numeric | 0 | 1440 |
Average number of minutes classified as being in REM sleep per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_mins_REM.fitbit | numeric | 0 | 1440 |
Average number of minutes classified as being in awake per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_time_awake.fitbit | numeric | 0 | 1440 |
Average number of minutes classified as being in bed (including awake, light, deep, and REM sleep) during defined sleep periods across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_time_in_bed.fitbit | numeric | 0 | 1440 |
Number of days with Fitbit calorie data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| calorie_days.fitbit | numeric | 7 | 75 |
Number of days with daily aggregate step count data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| daily_days.fitbit | numeric | 7 | 75 |
The Root Mean Square of Successive Differences (RMSSD) of total daily step counts across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| daily_step_variability_rmssd_daily.fitbit | numeric | 0 | Infinity |
Average number of steps taken per day across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| daily_steps_avg_daily.fitbit | numeric | 100 | Infinity |
End date of Fitbit monitoring period
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| end.fitbit | Date | 2017-10-25 | Infinity |
Fitbit model used for monitoring
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fitbit_model.fitbit | Charge 2, Charge 4, Flex 2, Inspire 2 | character |
Number of days with Fitbit daily aggregate heartrate data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| heartrate_days.fitbit | numeric | 7 | 75 |
The Root Mean Square of Successive Differences (RMSSD) between heart beats during sleep (i.e., all sleep stages). It measures short-term variability in the user’s heart rate in milliseconds (ms). This nightly value is then averaged across study days.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| HRV_average_daily_rmssd.fitbit | numeric | Anything >0 | Infinity |
The Root Mean Square of Successive Differences (RMSSD) between heart beats during deep sleep only. It measures short-term variability in the user’s heart rate in milliseconds (ms). This nightly value is then averaged across study days.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| HRV_average_deep_rmssd.fitbit | numeric | Anything >0 | Infinity |
Number of days with Fitbit HRV data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| HRV_days.fitbit | numeric | 7 | 75 |
Average steps/min of the maximum number of steps obtained over 10 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_10min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
Average steps/min of the maximum number of steps obtained over 20 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_20min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
Average steps/min of the maximum number of steps obtained over 30 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_30min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
Average steps/min of the maximum number of steps obtained over 5 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_5min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
Average steps/min of the maximum number of steps obtained over 60 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_60min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
Number of days with minute-level step count data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| min_days.fitbit | numeric | 7 | 75 |
Total minutes spent at >= 120 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_high_across_days_average.fitbit | numeric | 0 | Infinity |
Total minutes spent at 1-39 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_incidental_across_days_average.fitbit | numeric | 0 | Infinity |
Total minutes spent at 80-119 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_moderate_across_days_average.fitbit | numeric | 0 | Infinity |
Total minutes spent at 40-79 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_purposeful_across_days_average.fitbit | numeric | 0 | Infinity |
Total minutes spent at 0 steps/min each day (including likely periods of sleep), then averaged across days.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_sedentary_across_days_average.fitbit | numeric | 0 | Infinity |
Steps/min recorded for the highest single minute in a day
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| peak_1min_steps_per_day_across_days_average.fitbit | numeric | 1 | Infinity |
Average steps/min recorded for the 30 highest, but not necessarily consecutive, minutes in a day
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| peak30_steps_per_min_across_days_average.fitbit | numeric | Anything >0 | Infinity |
Average steps/min recorded for the 60 highest, but not necessarily consecutive, minutes in a day
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| peak60_steps_per_min_across_days_average.fitbit | numeric | Anything >0 | Infinity |
Parent study from which participant was recruited
| Variable Name | Type |
|---|---|
| project_type.fitbit | character |
Number of days with Fitbit sleep data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_days.fitbit | numeric | 7 | 75 |
Start date of Fitbit monitoring period
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| start.fitbit | Date | 2017-09-26 | 2023-08-03 |
Average steps/min across all minutes of each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| steps_per_min_avg_across_days_average.fitbit | numeric | Anything >0 | Infinity |
Total number of steps taken during minutes spent at >= 120 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sum_steps_per_day_high_across_days_average.fitbit | numeric | 0 | Infinity |
Total number of steps taken during minutes spent at 1-39 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sum_steps_per_day_incidental_across_days_average.fitbit | numeric | 0 | Infinity |
Total number of steps taken during minutes spent at 80-119 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sum_steps_per_day_moderate_across_days_average.fitbit | numeric | 0 | Infinity |
Total number of steps taken during minutes spent at 40-79 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sum_steps_per_day_purposeful_across_days_average.fitbit | numeric | 0 | Infinity |
Average daily heartrate across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| timepoint_average_heartrate.fitbit | numeric | Anything >0 | Infinity |
Fitbit visit number, e.g., if this is a participants’ second time completing a 30-day Fitbit monitoring period, their timepoint would be 2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Timepoint.fitbit | 1, 2, 3, 4 | numeric |
The Generalised Anxiety Disorder Assessment (GAD-7) is a seven-item instrument that is used to measure or assess the severity of generalised anxiety disorder (GAD).
Responses of how often bothered by a symptom in the last 2 weeks, rated as not at all,” “several days,” “more than half the days,” and “nearly every day,” and scored as 0, 1, 2, and 3, respectively. Total score is a sum across 7-items (range 0-21).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gad7_tot.gad | numeric | 0 | 21 |
A gait speed measure where participants are asked to walk a certain distance at their normal walking speed as well as a fast as they can walk without running.
The distance in meters the participant was asked to walk
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gait_distance.gait | 3, 6, 8 | numeric |
Calculated average in seconds, from three trials of a participant walking during the “leisure” conditions. Leisure conditions asks the participant to walk at their normal walking speed for a specified distance.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gait_leisure_avg.gait | numeric | 0 | infinity |
Calculated average in seconds, from three trials of a participant walking during the “speed” condition. Speed condition asks the participant to walk as fast as they can without running
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gait_speed_avg.gait | numeric | 0 | infinity |
Updated versions of the gait task throughout the years. Differences between versions is distance the participant is asked to walk, which is specified in the gait_distance.gait variable
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gait_version.gait | 1, 2, 3 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| 9p21_plasmatau_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| 9p21_plasmatau.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ABCA7_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ABCA7.genetics | G/G, G/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ACE_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ACE_1.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ADRA2B_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ADRA2B.genetics | D/D, D/I, I/I | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ApoE_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | Type |
|---|---|
| ApoE.genetics | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| APP_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| APP_1.genetics | A/A | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| APP_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| APP.genetics | Negative | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ATP2C2_1_rs11860694_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ATP2C2_1_rs11860694.genetics | C/C, C/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ATP2C2_2_rs8053211_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ATP2C2_2_rs8053211.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| AVPR1A_RS1_source.genetics | sequenom | character |
| Variable Name | Type |
|---|---|
| AVPR1A_RS1.genetics | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BDNF_rs6265_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BDNF_rs6265.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BIN1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BIN1.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BRAF_V600E_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BRAF_V600E.genetics | A/A | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C2ORF3_rs917235_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C2ORF3_rs917235.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C9orf72_1_rs10757668_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C9orf72_1_rs10757668.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C9ORF72_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C9ORF72.genetics | negative, Negative | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CAMK2B_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CAMK2B_1.genetics | C/C, C/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CCL11_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CCL11.genetics | A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CCR5_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CCR5.genetics | -/-, -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA, GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGG | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CD2AP_1_rs9349407_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CD2AP_1_rs9349407.genetics | C/C, C/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CDC42BPA_rs1320490_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CDC42BPA_rs1320490.genetics | C/C, C/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CETP_rs5882_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CETP_rs5882.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| chr9_rs3849942_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| chr9_rs3849942.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CLU_rs11136000_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CLU_rs11136000.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CMIP_1_rs6564903_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CMIP_1_rs6564903.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CMIP_2_rs16955705_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CMIP_2_rs16955705.genetics | A/A, A/C, C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CNTNAP2_1_rs17236239_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CNTNAP2_1_rs17236239.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CNTNAP2_2_rs4431523_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CNTNAP2_2_rs4431523.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| COMT_rs4680_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| COMT_rs4680.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CPE_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CPE.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CPEB3_rs11186856_source.genetics | omni, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CPEB3_rs11186856.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CR1_1_rs6701713_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CR1_1_rs6701713.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CR1_3_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CR1_3.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_1_rs1446109_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_1_rs1446109.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_2_rs1007371_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_2_rs1007371.genetics | A/A, A/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_3_rs723524_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_3_rs723524.genetics | G/G, G/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CUGBP2_1_rs201119_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CUGBP2_1_rs201119.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CYP46A1_1_rs754203_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CYP46A1_1_rs754203.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_1_rs1419228_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_1_rs1419228.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_2_rs793862_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_2_rs793862.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_3_rs1091047_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_3_rs1091047.genetics | C/C, C/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Do et al_1_rs356220_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Do et al_1_rs356220.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DPF3_rs2192595_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DPF3_rs2192595.genetics | G/G, G/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DRD2_rs1800497_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DRD2_rs1800497.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DRD4_source.genetics | sequenom | character |
| Variable Name | Type |
|---|---|
| DRD4.genetics | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DYX1_1_rs17819126_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DYX1_1_rs17819126.genetics | C/C, C/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DYX1_2_rs57809907_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DYX1_2_rs57809907.genetics | A/A, A/C, C/A, C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EIF2AK3_1_rs7571971_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EIF2AK3_1_rs7571971.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ERBB4_rs839523_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ERBB4_rs839523.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_1.genetics | C/C, C/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_2_rs143595300_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_2_rs143595300.genetics | G/G, G/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2.genetics | negative | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FAM47E_1_rs6812193_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FAM47E_1_rs6812193.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FIG4_1_rs121908287_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FIG4_1_rs121908287.genetics | T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FIG4_2_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FIG4_2.genetics | G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FOXP2_rs17137124_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FOXP2_rs17137124.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FUS_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FUS.genetics | Negative | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRIN2A_1_rs4998386_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRIN2A_1_rs4998386.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_1_rs5848_source.genetics | omni, sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_1_rs5848.genetics | C/C, C/T, G/G, G/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_2_rs72824736_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_2_rs72824736.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN.genetics | negative, Negative | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GSK3B_rs13312998_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GSK3B_rs13312998.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HFE_rs1799945_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HFE_rs1799945.genetics | C/C, C/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HSPA4_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HSPA4_1.genetics | C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HSPA8_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HSPA8_1.genetics | G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| IL2RA_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| IL2RA.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| IL6_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| IL6.genetics | C/C, C/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KCNQ_3_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KCNQ_3.genetics | G/G, G/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KIAA0319_rs4504469_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KIAA0319_rs4504469.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KIAA0319L_rs7523017_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KIAA0319L_rs7523017.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_1_rs9536312_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_1_rs9536312.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_2_rs9536314_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_2_rs9536314.genetics | G/G, G/T, T/G, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_3_rs9527025_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_3_rs9527025.genetics | C/C, C/G, G/C, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_4_rs7997728_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_4_rs7997728.genetics | G/G, G/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KRAS_G13D_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KRAS_G13D.genetics | C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LCMT1_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LCMT1_1.genetics | A/A | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LPR_1_rs4251417_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LPR_1_rs4251417.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LPR_2_rs2020934_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LPR_2_rs2020934.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_1.genetics | A/A | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_15_rs34637584_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_15_rs34637584.genetics | A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_2_rs41286476_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_2_rs41286476.genetics | A/A | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_3_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_3.genetics | C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_1.genetics | A/A, C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_2_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_2.genetics | G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_3_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_3.genetics | C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_2_rs116733906_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_2_rs116733906.genetics | G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_A152T_rs143624519_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_A152T_rs143624519.genetics | A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_1_rs1052590_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_1_rs1052590.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_2_rs8712_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_2_rs8712.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_3_rs17574040_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_3_rs17574040.genetics | A/A, A/C, C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MCCC1_1_rs10513789_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MCCC1_1_rs10513789.genetics | G/G, G/T, T/G, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MOBP_1_rs1768208_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MOBP_1_rs1768208.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MS4A6A_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MS4A6A.genetics | G/G, G/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_1_rs4938933_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_1_rs4938933.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_2_rs3865444_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_2_rs3865444.genetics | A/A, A/C, C/A, C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_3_rs7561528_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_3_rs7561528.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_4_rs2588969_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_4_rs2588969.genetics | A/A, A/C, C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| NRG_2_rs35753505_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| NRG_2_rs35753505.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| OGT_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| OGT_1.genetics | T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| OXTR_rs53576_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| OXTR_rs53576.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PARK2_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PARK2.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PARK7_1_rs71653619_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PARK7_1_rs71653619.genetics | A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PCDH11X_rs5984894_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PCDH11X_rs5984894.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PICALM_rs3851179_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PICALM_rs3851179.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PIDN_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PLCG1_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PLCG1_1.genetics | C/C, C/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PLCG1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PLCG1.genetics | negative | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PPP3CA_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PPP3CA_1.genetics | T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN1_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN1_1.genetics | T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN1.genetics | Negative | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN2_1_rs58973334_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN2_1_rs58973334.genetics | A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN2_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN2.genetics | Negative | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| RAI1_1_rs11649804_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| RAI1_1_rs11649804.genetics | A/A, A/C, C/A, C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| RIT2_1_rs4130047_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| RIT2_1_rs4130047.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rs5848_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rs5848.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rs9909184_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rs9909184.genetics | A/A, A/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SERT_LPR_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SERT_LPR.genetics | 14/14, 14/16, 16/16 | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SERT_VNTR_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SERT_VNTR.genetics | 10/10, 10/12, 12/12, 12/9 | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SLC41A1_1_rs823156_source.genetics | omni, sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SLC41A1_1_rs823156.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SLC6A4_LPR_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SLC6A4_LPR.genetics | 14/14, 14/16, 16/16 | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNAP25_rs1051312_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNAP25_rs1051312.genetics | C/C, C/T, T/C, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCA_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCA_1.genetics | C/C | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_1_rs144384727_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_1_rs144384727.genetics | A/A | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_2_rs145038921_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_2_rs145038921.genetics | G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_3_rs140850272_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_3_rs140850272.genetics | A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SOD1_1_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SOD1_1.genetics | A/A | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_1_rs62617129_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_1_rs62617129.genetics | A/A, A/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_10_rs2070045_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_10_rs2070045.genetics | G/G, G/T, T/G, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_11_rs3824968_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_11_rs3824968.genetics | A/A, A/T, T/A, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_2_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_2.genetics | G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_3_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_3.genetics | A/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_8_rs661057_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_8_rs661057.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_9_rs12285364_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_9_rs12285364.genetics | C/C, C/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SREBP1_1_rs11868035_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SREBP1_1_rs11868035.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| STX6_1_rs1411478_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| STX6_1_rs1411478.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TARDBP_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TARDBP.genetics | G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TAU Haplotype_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TAU Haplotype.genetics | H1/H1, H1/H2, H2/H2 | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM106B_2_rs1020004_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM106B_2_rs1020004.genetics | C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM106B_rs1990622_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM106B_rs1990622.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM175_1_rs6599389_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM175_1_rs6599389.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TOMM40_rs10524523_source.genetics | sequenom | character |
| Variable Name | Type |
|---|---|
| TOMM40_rs10524523.genetics | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TPH1-S_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TPH1-S.genetics | G/G, G/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TREM2_rs75932628_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TREM2_rs75932628.genetics | C/C, C/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TTRAP_rs2143340_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TTRAP_rs2143340.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| USP14_1_rs146959256_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| USP14_1_rs146959256.genetics | C/C, C/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VNTR_1_rs2020942_source.genetics | sequenom | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VNTR_1_rs2020942.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VNTR_2_rs2066713_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VNTR_2_rs2066713.genetics | A/A, A/G, G/A, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Wijsman_1_rs7814569_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Wijsman_1_rs7814569.genetics | A/A, A/G, G/G | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Wijsman_2_rs4145454_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Wijsman_2_rs4145454.genetics | C/C, C/T, T/T | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| WWC1_rs17070145_source.genetics | omni, sequenom, sequenom + omni | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| WWC1_rs17070145.genetics | C/C, C/T, T/T | character |
The Short (8-item) Grit Scale (Grit-S; Duckworth & Quinn, 2009) is a self-report measure of trait-level perseverance and passion for long-term goals.
Duckworth, A. L., & Quinn, P. D. (2009). Development and validation of the Short Grit Scale (GRIT–S). Journal of personality assessment, 91(2), 166-174.
Duckworth, A.L., Peterson, C., Matthews, M.D., & Kelly, D.R. (2007). Grit: Perseverance and passion for long-term goals. Journal of Personality and Social Psychology, 9, 1087-1101. http://www.sas.upenn.edu/~duckwort/images/Grit%20JPSP.pdf
Consistency of Interest Subscale
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| grit_consistence_score.grit | numeric | 1.00 | 5.00 |
Perseverance of Effort Subscale
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| grit_persev_eff_score.grit | numeric | 1 | 5.00 |
Total Grit Score - the maximum score on this scale is 5 (extremely gritty), and minimum score is 1 (not at all gritty)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| grit_score.grit | numeric | 1 | 5.000 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| abusothr.health_history | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| abusx.health_history | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| alcfreq.health_history | 0, 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| alcoccas.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| alcohol.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anxiety.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apnea.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthloex.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthrit.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthspin.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthtype.health_history | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| arthtypx.health_history | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthunk.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthupex.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| b12def.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bipolar.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cbothr.health_history | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| cbothrx.health_history | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cbstroke.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cbtia.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvafib.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvangina.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvangio.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvbypass.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvchf.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvhatt.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvhvalve.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvothr.health_history | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| cvothrx.health_history | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvpacdef.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvpace.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dep2yrs.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| depothr.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| diabetes.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| diabtype.health_history | 1, 2, 3 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hattmult.health_history | 0, 1 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hattyear.health_history | numeric | 1988 | 2018 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hypercho.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hyperten.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| incontf.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| incontu.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| insomn.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ncothr.health_history | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| ncothrx.health_history | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| npsydev.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ocd.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| othsleep.health_history | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| othsleex.health_history | character |
| Variable Name | Type |
|---|---|
| packsper.health_history | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pd.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pdothr.health_history | 0, 1 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pdothryr.health_history | numeric | 1959 | 2022 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pdyr.health_history | numeric | 2003 | 2020 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| psycdis.health_history | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| psycdisx.health_history | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptsd.health_history | 0, 1, 2 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| quitsmok.health_history | numeric | 0 | 1983 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rbd.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| schiz.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| seizures.health_history | 0, 1, 2 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| smokyrs.health_history | numeric | 0 | 80 |
| Variable Name | Type |
|---|---|
| strok1yr.health_history | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strok2yr.health_history | 2007 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strokmul.health_history | 0, 1 | numeric |
| Variable Name | Type |
|---|---|
| strokyr.health_history | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tbi.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tbibrief.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tbiexten.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tbiwolos.health_history | 0, 1, 2 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tbiyear.health_history | numeric | 1938 | 2022 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| thyroid.health_history | 0, 1, 2 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tia1yr.health_history | numeric | 1990 | 2014 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia2yr.health_history | 2003, 2004, 2013 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia3yr.health_history | 0, 2004, 2011 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia4yr.health_history | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia5yr.health_history | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia6yr.health_history | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tiamult.health_history | 0, 1 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiayear.health_history | numeric | 1983 | 2020 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tobac100.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tobac30.health_history | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| traumbrf.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| traumchr.health_history | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| traumext.health_history | 0, 1, 2 | numeric |
Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Fractional anisotropy (FA) specifically assesses the directionality of the water diffusion. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Prisma scanner uses a multi-shell scheme where multiple b-values are used.
left anterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right anterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
right anterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
body of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| body_of_corpus_callosum.imaging_dti_prisma_fa | numeric | 0 | 1 |
left cerebral peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right cerebral peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left cingulum cingulate gyrus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right cingulum cingulate gyrus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left corticospinal tract FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right corticospinal tract FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_dti_prisma_fa | numeric | 0 | infinity |
left external capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right external capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left fornix FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right fornix FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
genu of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| genu_of_corpus_callosum.imaging_dti_prisma_fa | numeric | 0 | 1 |
left inferior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right inferior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
Calculation of FA in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_dti_prisma_fa | Mean | character |
left medial lemniscus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right medial lemniscus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
middle cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| middle_cerebellar_peduncle.imaging_dti_prisma_fa | numeric | 0 | 1 |
pontine crossing tract a part of mcp FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pontine_crossing_tract_a_part_of_mcp.imaging_dti_prisma_fa | numeric | 0 | 1 |
left posterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right posterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left posterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right posterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left posterior thalamic radiation FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right posterior thalamic radiation FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left sagittal stratum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right sagittal stratum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
splenium of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| splenium_of_corpus_callosum.imaging_dti_prisma_fa | numeric | 0 | 1 |
left superior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right superior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left superior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right superior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
right superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left superior longitudinal fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
right superior longitudinal fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
left tapetum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tapetum_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Mean Diffusivity (MD) specifically assesses the number, size, or mylination of the tissue fibers in units of 10^-3 mm^2/s. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Prisma scanner uses a multi-shell scheme where multiple b-values are used.
left anterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right anterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_r.imaging_dti_prisma_md | numeric | 0 | 3 |
right anterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_r.imaging_dti_prisma_md | numeric | 0 | 3 |
body of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| body_of_corpus_callosum.imaging_dti_prisma_md | numeric | 0 | 3 |
left cerebral peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right cerebral peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left cingulum cingulate gyrus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right cingulum cingulate gyrus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left corticospinal tract MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right corticospinal tract MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_r.imaging_dti_prisma_md | numeric | 0 | 3 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_dti_prisma_md | numeric | 0 | infinity |
left external capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right external capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left fornix MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right fornix MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_r.imaging_dti_prisma_md | numeric | 0 | 3 |
genu of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| genu_of_corpus_callosum.imaging_dti_prisma_md | numeric | 0 | 3 |
left inferior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right inferior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_r.imaging_dti_prisma_md | numeric | 0 | 3 |
Calculation of MD in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_dti_prisma_md | Mean | character |
left medial lemniscus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right medial lemniscus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_r.imaging_dti_prisma_md | numeric | 0 | 3 |
middle cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| middle_cerebellar_peduncle.imaging_dti_prisma_md | numeric | 0 | 3 |
pontine crossing tract a part of mcp MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pontine_crossing_tract_a_part_of_mcp.imaging_dti_prisma_md | numeric | 0 | 3 |
left posterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right posterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left posterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right posterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left posterior thalamic radiation MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right posterior thalamic radiation MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left sagittal stratum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right sagittal stratum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_r.imaging_dti_prisma_md | numeric | 0 | 3 |
splenium of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| splenium_of_corpus_callosum.imaging_dti_prisma_md | numeric | 0 | 3 |
left superior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right superior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left superior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right superior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_r.imaging_dti_prisma_md | numeric | 0 | 3 |
right superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left superior longitudinal fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_l.imaging_dti_prisma_md | numeric | 0 | 3 |
right superior longitudinal fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_r.imaging_dti_prisma_md | numeric | 0 | 3 |
left tapetum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tapetum_l.imaging_dti_prisma_md | numeric | 0 | 3 |
Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Fractional anisotropy (FA) specifically assesses the directionality of the water diffusion. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Trio scanner uses a single-shell scheme where one b-value is used.
left anterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right anterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left anterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right anterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_r.imaging_dti_trio_fa | numeric | 0 | 1 |
body of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| body_of_corpus_callosum.imaging_dti_trio_fa | numeric | 0 | 1 |
left cerebral peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right cerebral peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left cingulum cingulate gyrus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right cingulum cingulate gyrus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left cingulum hippocampus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_hippocampus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right cingulum hippocampus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_hippocampus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left corticospinal tract FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right corticospinal tract FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_r.imaging_dti_trio_fa | numeric | 0 | 1 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_dti_trio_fa | numeric | 0 | infinity |
left external capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right external capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left fornix FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right fornix FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_r.imaging_dti_trio_fa | numeric | 0 | 1 |
genu of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| genu_of_corpus_callosum.imaging_dti_trio_fa | numeric | 0 | 1 |
left inferior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right inferior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_r.imaging_dti_trio_fa | numeric | 0 | 1 |
Calculation of FA in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_dti_trio_fa | Mean | character |
left medial lemniscus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right medial lemniscus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
middle cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| middle_cerebellar_peduncle.imaging_dti_trio_fa | numeric | 0 | 1 |
pontine crossing tract a part of mcp FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pontine_crossing_tract_a_part_of_mcp.imaging_dti_trio_fa | numeric | 0 | 1 |
left posterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right posterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left posterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right posterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left posterior thalamic radiation FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right posterior thalamic radiation FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left sagittal stratum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right sagittal stratum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_r.imaging_dti_trio_fa | numeric | 0 | 1 |
splenium of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| splenium_of_corpus_callosum.imaging_dti_trio_fa | numeric | 0 | 1 |
left superior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right superior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left superior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right superior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left superior longitudinal fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right superior longitudinal fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
left tapetum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tapetum_l.imaging_dti_trio_fa | numeric | 0 | 1 |
right uncinate fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uncinate_fasciculus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Mean Diffusivity (MD) specifically assesses the number, size, or mylination of the tissue fibers in units of 10^-3 mm^2/s. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Trio scanner uses a single-shell scheme where one b-value is used.
left anterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_l.imaging_dti_trio_md | numeric | 0 | 3 |
right anterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_r.imaging_dti_trio_md | numeric | 0 | 3 |
left anterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_l.imaging_dti_trio_md | numeric | 0 | 3 |
right anterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_r.imaging_dti_trio_md | numeric | 0 | 3 |
body of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| body_of_corpus_callosum.imaging_dti_trio_md | numeric | 0 | 3 |
left cerebral peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_l.imaging_dti_trio_md | numeric | 0 | 3 |
right cerebral peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_r.imaging_dti_trio_md | numeric | 0 | 3 |
left cingulum cingulate gyrus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_l.imaging_dti_trio_md | numeric | 0 | 3 |
right cingulum cingulate gyrus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_r.imaging_dti_trio_md | numeric | 0 | 3 |
left cingulum hippocampus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_hippocampus_l.imaging_dti_trio_md | numeric | 0 | 3 |
right cingulum hippocampus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_hippocampus_r.imaging_dti_trio_md | numeric | 0 | 3 |
left corticospinal tract MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_l.imaging_dti_trio_md | numeric | 0 | 3 |
right corticospinal tract MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_r.imaging_dti_trio_md | numeric | 0 | 3 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_dti_trio_md | numeric | 0 | infinity |
left external capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_l.imaging_dti_trio_md | numeric | 0 | 3 |
right external capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_r.imaging_dti_trio_md | numeric | 0 | 3 |
left fornix MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_l.imaging_dti_trio_md | numeric | 0 | 3 |
right fornix MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_r.imaging_dti_trio_md | numeric | 0 | 3 |
genu of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| genu_of_corpus_callosum.imaging_dti_trio_md | numeric | 0 | 3 |
left inferior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_l.imaging_dti_trio_md | numeric | 0 | 3 |
right inferior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_r.imaging_dti_trio_md | numeric | 0 | 3 |
Calculation of MD in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_dti_trio_md | Mean | character |
left medial lemniscus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_l.imaging_dti_trio_md | numeric | 0 | 3 |
right medial lemniscus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_r.imaging_dti_trio_md | numeric | 0 | 3 |
middle cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| middle_cerebellar_peduncle.imaging_dti_trio_md | numeric | 0 | 3 |
pontine crossing tract a part of mcp MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pontine_crossing_tract_a_part_of_mcp.imaging_dti_trio_md | numeric | 0 | 3 |
left posterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_l.imaging_dti_trio_md | numeric | 0 | 3 |
right posterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_r.imaging_dti_trio_md | numeric | 0 | 3 |
left posterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_l.imaging_dti_trio_md | numeric | 0 | 3 |
right posterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_r.imaging_dti_trio_md | numeric | 0 | 3 |
left posterior thalamic radiation MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_l.imaging_dti_trio_md | numeric | 0 | 3 |
right posterior thalamic radiation MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_r.imaging_dti_trio_md | numeric | 0 | 3 |
left retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_l.imaging_dti_trio_md | numeric | 0 | 3 |
right retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_r.imaging_dti_trio_md | numeric | 0 | 3 |
left sagittal stratum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_l.imaging_dti_trio_md | numeric | 0 | 3 |
right sagittal stratum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_r.imaging_dti_trio_md | numeric | 0 | 3 |
splenium of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| splenium_of_corpus_callosum.imaging_dti_trio_md | numeric | 0 | 3 |
left superior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_l.imaging_dti_trio_md | numeric | 0 | 3 |
right superior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_r.imaging_dti_trio_md | numeric | 0 | 3 |
left superior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_l.imaging_dti_trio_md | numeric | 0 | 3 |
right superior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_r.imaging_dti_trio_md | numeric | 0 | 3 |
left superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_l.imaging_dti_trio_md | numeric | 0 | 3 |
right superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_r.imaging_dti_trio_md | numeric | 0 | 3 |
left superior longitudinal fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_l.imaging_dti_trio_md | numeric | 0 | 3 |
right superior longitudinal fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_r.imaging_dti_trio_md | numeric | 0 | 3 |
left tapetum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tapetum_l.imaging_dti_trio_md | numeric | 0 | 3 |
right uncinate fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uncinate_fasciculus_r.imaging_dti_trio_md | numeric | 0 | 3 |
Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: neurite density index (NDI) specifically quantifies the packing density of axons or dendrites and is typically known to decrease from middle to old age.
Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908
Cox, S. R., Ritchie, S. J., Tucker-Drob, E. M., Liewald, D. C., Hagenaars, S. P., Davies, G., Wardlaw, J. M., Gale, C. R., Bastin, M. E., & Deary, I. J. (2016). Ageing and brain white matter structure in 3,513 UK Biobank participants. Nature Communications, 7(1). https://doi.org/10.1038/ncomms13629
ad meta six composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_noddi_ficv | numeric | 0 | 1 |
ad meta ten composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_noddi_ficv | numeric | 0 | 1 |
brain stem NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_noddi_ficv | numeric | 0 | 1 |
anterior corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_noddi_ficv | numeric | 0 | 1 |
central corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_noddi_ficv | numeric | 0 | 1 |
mid anterior corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_noddi_ficv | numeric | 0 | 1 |
mid posterior corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_noddi_ficv | numeric | 0 | 1 |
posterior corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_noddi_ficv | numeric | 0 | 1 |
csf NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_noddi_ficv | numeric | 0 | 1 |
left bankssts NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_noddi_ficv | numeric | 0 | 1 |
left caudalanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
left caudalmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
left cuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_noddi_ficv | numeric | 0 | 1 |
left entorhinal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_noddi_ficv | numeric | 0 | 1 |
left frontalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_noddi_ficv | numeric | 0 | 1 |
left fusiform NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_noddi_ficv | numeric | 0 | 1 |
left inferiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
left inferiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
left insula NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_noddi_ficv | numeric | 0 | 1 |
left isthmuscingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_noddi_ficv | numeric | 0 | 1 |
left lateraloccipital NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_noddi_ficv | numeric | 0 | 1 |
left lateralorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
left lingual NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_noddi_ficv | numeric | 0 | 1 |
left medialorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
left middletemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_noddi_ficv | numeric | 0 | 1 |
left paracentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_noddi_ficv | numeric | 0 | 1 |
left parahippocampal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_noddi_ficv | numeric | 0 | 1 |
left parsopercularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_noddi_ficv | numeric | 0 | 1 |
left parsorbitalis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_noddi_ficv | numeric | 0 | 1 |
left parstriangularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_noddi_ficv | numeric | 0 | 1 |
left pericalcarine NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_noddi_ficv | numeric | 0 | 1 |
left postcentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_noddi_ficv | numeric | 0 | 1 |
left posteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
left precentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_noddi_ficv | numeric | 0 | 1 |
left precuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_noddi_ficv | numeric | 0 | 1 |
left rostralanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
left rostralmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
left superiorfrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_noddi_ficv | numeric | 0 | 1 |
left superiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
left superiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
left supramarginal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_noddi_ficv | numeric | 0 | 1 |
left temporalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_noddi_ficv | numeric | 0 | 1 |
left transversetemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_noddi_ficv | numeric | 0 | 1 |
left unknown NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_noddi_ficv | numeric | 0 | 1 |
right bankssts NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_noddi_ficv | numeric | 0 | 1 |
right caudalanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
right caudalmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
right cuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_noddi_ficv | numeric | 0 | 1 |
right entorhinal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_noddi_ficv | numeric | 0 | 1 |
right frontalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_noddi_ficv | numeric | 0 | 1 |
right fusiform NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_noddi_ficv | numeric | 0 | 1 |
right inferiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
right inferiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
right insula NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_noddi_ficv | numeric | 0 | 1 |
right isthmuscingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_noddi_ficv | numeric | 0 | 1 |
right lateraloccipital NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_noddi_ficv | numeric | 0 | 1 |
right lateralorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
right lingual NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_noddi_ficv | numeric | 0 | 1 |
right medialorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
right middletemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_noddi_ficv | numeric | 0 | 1 |
right paracentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_noddi_ficv | numeric | 0 | 1 |
right parahippocampal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_noddi_ficv | numeric | 0 | 1 |
right parsopercularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_noddi_ficv | numeric | 0 | 1 |
right parsorbitalis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_noddi_ficv | numeric | 0 | 1 |
right parstriangularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_noddi_ficv | numeric | 0 | 1 |
right pericalcarine NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_noddi_ficv | numeric | 0 | 1 |
right postcentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_noddi_ficv | numeric | 0 | 1 |
right posteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
right precentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_noddi_ficv | numeric | 0 | 1 |
right precuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_noddi_ficv | numeric | 0 | 1 |
right rostralanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
right rostralmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
right superiorfrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_noddi_ficv | numeric | 0 | 1 |
right superiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
right superiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
right supramarginal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_noddi_ficv | numeric | 0 | 1 |
right temporalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_noddi_ficv | numeric | 0 | 1 |
right transversetemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_noddi_ficv | numeric | 0 | 1 |
right unknown NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_noddi_ficv | numeric | 0 | 1 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_noddi_ficv | numeric | 0 | infinity |
frontal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_noddi_ficv | numeric | 0 | 1 |
global grey matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_noddi_ficv | numeric | 0 | infinity |
Calculation of NDI in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_noddi_ficv | Mean | character |
left accumbens area NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_noddi_ficv | numeric | 0.4698577 | 0.8280393 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_noddi_ficv | numeric | 0.4846368 | 0.8365276 |
left amygdala NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_noddi_ficv | numeric | 0 | 1 |
left caudate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_noddi_ficv | numeric | 0 | 1 |
left cerebellum cortex NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_noddi_ficv | numeric | 0 | 1 |
left cerebellum white matter NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_noddi_ficv | numeric | 0 | 1 |
left choroid plexus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_noddi_ficv | numeric | 0.4472082 | 0.9415706 |
left hippocampus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_noddi_ficv | numeric | 0 | 1 |
left inf lat vent NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_noddi_ficv | numeric | 0 | 1 |
left lateral ventricle NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_noddi_ficv | numeric | 0.5325407 | 0.9499977 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_noddi_ficv | numeric | 0.4375480 | 0.9048434 |
left pallidum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_noddi_ficv | numeric | 0.4365152 | 0.8114024 |
left putamen NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_noddi_ficv | numeric | 0.4934487 | 0.8373833 |
left thalamus proper NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_noddi_ficv | numeric | 0 | 1 |
left unsegmented white matter NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_noddi_ficv | numeric | 0 | 1 |
left ventral dc NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_noddi_ficv | numeric | 0 | 1 |
left vessel NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_noddi_ficv | numeric | 0 | 1 |
medial temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_noddi_ficv | numeric | 0 | 1 |
occipital composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_noddi_ficv | numeric | 0 | 1 |
optic chiasm NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_noddi_ficv | numeric | 0 | 1 |
parietal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_noddi_ficv | numeric | 0 | 1 |
right accumbens area NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_noddi_ficv | numeric | 0.4771932 | 0.8793782 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_noddi_ficv | numeric | 0.4776771 | 0.8796096 |
right amygdala NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_noddi_ficv | numeric | 0 | 1 |
right caudate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_noddi_ficv | numeric | 0 | 1 |
right cerebellum cortex NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_noddi_ficv | numeric | 0 | 1 |
right cerebellum white matter NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_noddi_ficv | numeric | 0 | 1 |
right choroid plexus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_noddi_ficv | numeric | 0.4398425 | 0.9567229 |
right hippocampus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_noddi_ficv | numeric | 0 | 1 |
right inf lat vent NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_noddi_ficv | numeric | 0 | 1 |
right lateral ventricle NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_noddi_ficv | numeric | 0.5349477 | 0.9731770 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_noddi_ficv | numeric | 0.4204730 | 0.9093815 |
right pallidum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_noddi_ficv | numeric | 0.4361167 | 0.7980473 |
right putamen NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_noddi_ficv | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_noddi_ficv | numeric | 0.4878995 | 0.8851367 |
right thalamus proper NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_noddi_ficv | numeric | 0 | 1 |
right unsegmented white matter NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_noddi_ficv | numeric | 0 | 1 |
right ventral dc NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_noddi_ficv | numeric | 0 | 1 |
right vessel NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_noddi_ficv | numeric | 0 | 1 |
temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_noddi_ficv | numeric | 0 | 1 |
global total intracranial volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_noddi_ficv | numeric | 0 | infinity |
white matter hypointensities NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left bankssts NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left caudalanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left caudalmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left cuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left entorhinal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left frontalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left fusiform NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left inferiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left inferiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left insula NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left isthmuscingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left lateraloccipital NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left lateralorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left lingual NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left medialorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left middletemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left paracentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left parahippocampal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left parsopercularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left parsorbitalis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left parstriangularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left pericalcarine NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left postcentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left posteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left precentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left precuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left rostralanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left rostralmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left superiorfrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left superiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left superiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left supramarginal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left temporalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_noddi_ficv | numeric | 0 | 1 |
white matter left transversetemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right bankssts NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right caudalanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right caudalmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right cuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right entorhinal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right frontalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right fusiform NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right inferiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right inferiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right insula NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right isthmuscingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right lateraloccipital NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right lateralorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right lingual NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right medialorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right middletemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right paracentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right parahippocampal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right parsopercularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right parsorbitalis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right parstriangularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right pericalcarine NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right postcentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right posteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right precentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right precuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right rostralanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right rostralmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right superiorfrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right superiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right superiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right supramarginal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right temporalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_noddi_ficv | numeric | 0 | 1 |
white matter right transversetemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_noddi_ficv | numeric | 0 | 1 |
global white matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_noddi_ficv | numeric | 0 | infinity |
3rd ventricle NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_noddi_ficv | numeric | 0 | 1 |
4th ventricle NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_noddi_ficv | numeric | 0 | 1 |
Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: free water fraction (FWF) estimates the extent of CSF contamination which points to a use as a marker for inflammation.
Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908
Kraguljac, N. V., Guerreri, M., Strickland, M. J., & Zhang, H. (2023). Neurite orientation dispersion and density imaging in psychiatric disorders: A systematic literature review and a technical note. Biological Psychiatry Global Open Science, 3(1), 10–21. https://doi.org/10.1016/j.bpsgos.2021.12.012
ad meta six composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_noddi_fiso | numeric | 0 | 1 |
ad meta ten composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_noddi_fiso | numeric | 0 | 1 |
brain stem free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_noddi_fiso | numeric | 0 | 1 |
anterior corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_noddi_fiso | numeric | 0 | 1 |
central corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_noddi_fiso | numeric | 0 | 1 |
mid anterior corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_noddi_fiso | numeric | 0 | 1 |
mid posterior corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_noddi_fiso | numeric | 0 | 1 |
posterior corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_noddi_fiso | numeric | 0 | 1 |
csf free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_noddi_fiso | numeric | 0 | 1 |
left bankssts free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_noddi_fiso | numeric | 0 | 1 |
left caudalanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
left caudalmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
left cuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_noddi_fiso | numeric | 0 | 1 |
left entorhinal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_noddi_fiso | numeric | 0 | 1 |
left frontalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_noddi_fiso | numeric | 0 | 1 |
left fusiform free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_noddi_fiso | numeric | 0 | 1 |
left inferiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
left inferiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
left insula free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_noddi_fiso | numeric | 0 | 1 |
left isthmuscingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_noddi_fiso | numeric | 0 | 1 |
left lateraloccipital free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_noddi_fiso | numeric | 0 | 1 |
left lateralorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
left lingual free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_noddi_fiso | numeric | 0 | 1 |
left medialorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
left middletemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_noddi_fiso | numeric | 0 | 1 |
left paracentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_noddi_fiso | numeric | 0 | 1 |
left parahippocampal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_noddi_fiso | numeric | 0 | 1 |
left parsopercularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_noddi_fiso | numeric | 0 | 1 |
left parsorbitalis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_noddi_fiso | numeric | 0 | 1 |
left parstriangularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_noddi_fiso | numeric | 0 | 1 |
left pericalcarine free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_noddi_fiso | numeric | 0 | 1 |
left postcentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_noddi_fiso | numeric | 0 | 1 |
left posteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
left precentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_noddi_fiso | numeric | 0 | 1 |
left precuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_noddi_fiso | numeric | 0 | 1 |
left rostralanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
left rostralmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
left superiorfrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_noddi_fiso | numeric | 0 | 1 |
left superiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
left superiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
left supramarginal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_noddi_fiso | numeric | 0 | 1 |
left temporalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_noddi_fiso | numeric | 0 | 1 |
left transversetemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_noddi_fiso | numeric | 0 | 1 |
left unknown free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_noddi_fiso | numeric | 0 | 1 |
right bankssts free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_noddi_fiso | numeric | 0 | 1 |
right caudalanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
right caudalmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
right cuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_noddi_fiso | numeric | 0 | 1 |
right entorhinal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_noddi_fiso | numeric | 0 | 1 |
right frontalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_noddi_fiso | numeric | 0 | 1 |
right fusiform free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_noddi_fiso | numeric | 0 | 1 |
right inferiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
right inferiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
right insula free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_noddi_fiso | numeric | 0 | 1 |
right isthmuscingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_noddi_fiso | numeric | 0 | 1 |
right lateraloccipital free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_noddi_fiso | numeric | 0 | 1 |
right lateralorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
right lingual free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_noddi_fiso | numeric | 0 | 1 |
right medialorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
right middletemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_noddi_fiso | numeric | 0 | 1 |
right paracentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_noddi_fiso | numeric | 0 | 1 |
right parahippocampal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_noddi_fiso | numeric | 0 | 1 |
right parsopercularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_noddi_fiso | numeric | 0 | 1 |
right parsorbitalis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_noddi_fiso | numeric | 0 | 1 |
right parstriangularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_noddi_fiso | numeric | 0 | 1 |
right pericalcarine free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_noddi_fiso | numeric | 0 | 1 |
right postcentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_noddi_fiso | numeric | 0 | 1 |
right posteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
right precentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_noddi_fiso | numeric | 0 | 1 |
right precuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_noddi_fiso | numeric | 0 | 1 |
right rostralanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
right rostralmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
right superiorfrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_noddi_fiso | numeric | 0 | 1 |
right superiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
right superiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
right supramarginal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_noddi_fiso | numeric | 0 | 1 |
right temporalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_noddi_fiso | numeric | 0 | 1 |
right transversetemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_noddi_fiso | numeric | 0 | 1 |
right unknown free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_noddi_fiso | numeric | 0 | 1 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_noddi_fiso | numeric | 0 | infinty |
frontal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_noddi_fiso | numeric | 0 | 1 |
global grey matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_noddi_fiso | numeric | 0 | infinty |
Calculation of free water fraction in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_noddi_fiso | Mean | character |
left accumbens area free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_noddi_fiso | numeric | 0.03746143 | 0.49354400 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_noddi_fiso | numeric | 0.03488694 | 0.48884290 |
left amygdala free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_noddi_fiso | numeric | 0 | 1 |
left caudate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_noddi_fiso | numeric | 0 | 1 |
left cerebellum cortex free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_noddi_fiso | numeric | 0 | 1 |
left cerebellum white matter free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_noddi_fiso | numeric | 0 | 1 |
left choroid plexus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_noddi_fiso | numeric | 0.04986550 | 0.50509410 |
left hippocampus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_noddi_fiso | numeric | 0 | 1 |
left inf lat vent free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_noddi_fiso | numeric | 0 | 1 |
left lateral ventricle free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_noddi_fiso | numeric | 0.06271857 | 0.49622000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_noddi_fiso | numeric | 0.03683771 | 0.52225537 |
left pallidum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_noddi_fiso | numeric | 0.04079328 | 0.55622300 |
left putamen free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_noddi_fiso | numeric | 0.03968512 | 0.48812327 |
left thalamus proper free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_noddi_fiso | numeric | 0 | 1 |
left unsegmented white matter free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_noddi_fiso | numeric | 0 | 1 |
left ventral dc free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_noddi_fiso | numeric | 0 | 1 |
left vessel free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_noddi_fiso | numeric | 0 | 1 |
medial temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_noddi_fiso | numeric | 0 | 1 |
occipital composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_noddi_fiso | numeric | 0 | 1 |
optic chiasm free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_noddi_fiso | numeric | 0 | 1 |
parietal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_noddi_fiso | numeric | 0 | 1 |
right accumbens area free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_noddi_fiso | numeric | 0.03734681 | 0.49804217 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_noddi_fiso | numeric | 0.03975091 | 0.48304460 |
right amygdala free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_noddi_fiso | numeric | 0 | 1 |
right caudate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_noddi_fiso | numeric | 0 | 1 |
right cerebellum cortex free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_noddi_fiso | numeric | 0 | 1 |
right cerebellum white matter free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_noddi_fiso | numeric | 0 | 1 |
right choroid plexus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_noddi_fiso | numeric | 0.04790281 | 0.51155520 |
right hippocampus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_noddi_fiso | numeric | 0 | 1 |
right inf lat vent free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_noddi_fiso | numeric | 0 | 1 |
right lateral ventricle free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_noddi_fiso | numeric | 0.07241590 | 0.51515600 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_noddi_fiso | numeric | 0.02757500 | 0.52851000 |
right pallidum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_noddi_fiso | numeric | 0.03990878 | 0.55479617 |
right putamen free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_noddi_fiso | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_noddi_fiso | numeric | 0.04204959 | 0.47913809 |
right thalamus proper free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_noddi_fiso | numeric | 0 | 1 |
right unsegmented white matter free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_noddi_fiso | numeric | 0 | 1 |
right ventral dc free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_noddi_fiso | numeric | 0 | 1 |
right vessel free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_noddi_fiso | numeric | 0 | 1 |
temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_noddi_fiso | numeric | 0 | 1 |
global total intracranial volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_noddi_fiso | numeric | 0 | infinity |
white matter hypointensities free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left bankssts free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left caudalanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left caudalmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left cuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left entorhinal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left frontalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left fusiform free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left inferiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left inferiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left insula free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left isthmuscingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left lateraloccipital free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left lateralorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left lingual free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left medialorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left middletemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left paracentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left parahippocampal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left parsopercularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left parsorbitalis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left parstriangularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left pericalcarine free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left postcentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left posteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left precentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left precuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left rostralanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left rostralmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left superiorfrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left superiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left superiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left supramarginal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left temporalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_noddi_fiso | numeric | 0 | 1 |
white matter left transversetemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right bankssts free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right caudalanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right caudalmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right cuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right entorhinal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right frontalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right fusiform free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right inferiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right inferiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right insula free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right isthmuscingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right lateraloccipital free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right lateralorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right lingual free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right medialorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right middletemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right paracentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right parahippocampal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right parsopercularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right parsorbitalis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right parstriangularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right pericalcarine free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right postcentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right posteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right precentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right precuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right rostralanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right rostralmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right superiorfrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right superiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right superiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right supramarginal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right temporalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_noddi_fiso | numeric | 0 | 1 |
white matter right transversetemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_noddi_fiso | numeric | 0 | 1 |
global white matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_noddi_fiso | numeric | 0 | infinity |
3rd ventricle free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_noddi_fiso | numeric | 0 | 1 |
4th ventricle free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_noddi_fiso | numeric | 0 | 1 |
Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: orientation dispersion index (ODI) assesses the orientational coherence of neurites and generally shows a nonlinear increase until around 60 years, followed by a decrease.
Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908
Kraguljac, N. V., Guerreri, M., Strickland, M. J., & Zhang, H. (2023). Neurite orientation dispersion and density imaging in psychiatric disorders: A systematic literature review and a technical note. Biological Psychiatry Global Open Science, 3(1), 10–21. https://doi.org/10.1016/j.bpsgos.2021.12.012
ad meta six composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_noddi_odi | numeric | 0 | 1 |
ad meta ten composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_noddi_odi | numeric | 0 | 1 |
brain stem ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_noddi_odi | numeric | 0 | 1 |
anterior corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_noddi_odi | numeric | 0 | 1 |
central corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_noddi_odi | numeric | 0 | 1 |
mid anterior corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_noddi_odi | numeric | 0 | 1 |
mid posterior corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_noddi_odi | numeric | 0 | 1 |
posterior corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_noddi_odi | numeric | 0 | 1 |
csf ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_noddi_odi | numeric | 0 | 1 |
left bankssts ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_noddi_odi | numeric | 0 | 1 |
left caudalanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
left caudalmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
left cuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_noddi_odi | numeric | 0 | 1 |
left entorhinal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_noddi_odi | numeric | 0 | 1 |
left frontalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_noddi_odi | numeric | 0 | 1 |
left fusiform ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_noddi_odi | numeric | 0 | 1 |
left inferiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
left inferiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
left insula ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_noddi_odi | numeric | 0 | 1 |
left isthmuscingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_noddi_odi | numeric | 0 | 1 |
left lateraloccipital ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_noddi_odi | numeric | 0 | 1 |
left lateralorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
left lingual ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_noddi_odi | numeric | 0 | 1 |
left medialorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
left middletemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_noddi_odi | numeric | 0 | 1 |
left paracentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_noddi_odi | numeric | 0 | 1 |
left parahippocampal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_noddi_odi | numeric | 0 | 1 |
left parsopercularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_noddi_odi | numeric | 0 | 1 |
left parsorbitalis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_noddi_odi | numeric | 0 | 1 |
left parstriangularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_noddi_odi | numeric | 0 | 1 |
left pericalcarine ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_noddi_odi | numeric | 0 | 1 |
left postcentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_noddi_odi | numeric | 0 | 1 |
left posteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
left precentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_noddi_odi | numeric | 0 | 1 |
left precuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_noddi_odi | numeric | 0 | 1 |
left rostralanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
left rostralmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
left superiorfrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_noddi_odi | numeric | 0 | 1 |
left superiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
left superiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
left supramarginal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_noddi_odi | numeric | 0 | 1 |
left temporalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_noddi_odi | numeric | 0 | 1 |
left transversetemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_noddi_odi | numeric | 0 | 1 |
left unknown ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_noddi_odi | numeric | 0 | 1 |
right bankssts ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_noddi_odi | numeric | 0 | 1 |
right caudalanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
right caudalmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
right cuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_noddi_odi | numeric | 0 | 1 |
right entorhinal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_noddi_odi | numeric | 0 | 1 |
right frontalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_noddi_odi | numeric | 0 | 1 |
right fusiform ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_noddi_odi | numeric | 0 | 1 |
right inferiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
right inferiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
right insula ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_noddi_odi | numeric | 0 | 1 |
right isthmuscingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_noddi_odi | numeric | 0 | 1 |
right lateraloccipital ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_noddi_odi | numeric | 0 | 1 |
right lateralorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
right lingual ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_noddi_odi | numeric | 0 | 1 |
right medialorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
right middletemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_noddi_odi | numeric | 0 | 1 |
right paracentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_noddi_odi | numeric | 0 | 1 |
right parahippocampal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_noddi_odi | numeric | 0 | 1 |
right parsopercularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_noddi_odi | numeric | 0 | 1 |
right parsorbitalis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_noddi_odi | numeric | 0 | 1 |
right parstriangularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_noddi_odi | numeric | 0 | 1 |
right pericalcarine ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_noddi_odi | numeric | 0 | 1 |
right postcentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_noddi_odi | numeric | 0 | 1 |
right posteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
right precentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_noddi_odi | numeric | 0 | 1 |
right precuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_noddi_odi | numeric | 0 | 1 |
right rostralanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
right rostralmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
right superiorfrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_noddi_odi | numeric | 0 | 1 |
right superiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
right superiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
right supramarginal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_noddi_odi | numeric | 0 | 1 |
right temporalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_noddi_odi | numeric | 0 | 1 |
right transversetemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_noddi_odi | numeric | 0 | 1 |
right unknown ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_noddi_odi | numeric | 0 | 1 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_noddi_odi | numeric | 0 | infinity |
frontal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_noddi_odi | numeric | 0 | 1 |
global grey matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_noddi_odi | numeric | 0 | infinity |
Calculation of ODI in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_noddi_odi | Mean | character |
left accumbens area ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_noddi_odi | numeric | 0.5017342 | 0.6957600 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_noddi_odi | numeric | 0.5116984 | 0.6690579 |
left amygdala ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_noddi_odi | numeric | 0 | 1 |
left caudate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_noddi_odi | numeric | 0 | 1 |
left cerebellum cortex ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_noddi_odi | numeric | 0 | 1 |
left cerebellum white matter ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_noddi_odi | numeric | 0 | 1 |
left choroid plexus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_noddi_odi | numeric | 0.4978984 | 0.7251463 |
left hippocampus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_noddi_odi | numeric | 0 | 1 |
left inf lat vent ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_noddi_odi | numeric | 0 | 1 |
left lateral ventricle ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_noddi_odi | numeric | 0.5604377 | 0.7650453 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_noddi_odi | numeric | 0.5106432 | 0.6527217 |
left pallidum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_noddi_odi | numeric | 0.4797904 | 0.6032680 |
left putamen ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_noddi_odi | numeric | 0.5279805 | 0.6823442 |
left thalamus proper ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_noddi_odi | numeric | 0 | 1 |
left unsegmented white matter ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_noddi_odi | numeric | 0 | 1 |
left ventral dc ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_noddi_odi | numeric | 0 | 1 |
left vessel ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_noddi_odi | numeric | 0 | 1 |
medial temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_noddi_odi | numeric | 0 | 1 |
occipital composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_noddi_odi | numeric | 0 | 1 |
optic chiasm ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_noddi_odi | numeric | 0 | 1 |
parietal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_noddi_odi | numeric | 0 | 1 |
right accumbens area ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_noddi_odi | numeric | 0.5384152 | 0.7193815 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_noddi_odi | numeric | 0.5355784 | 0.6875598 |
right amygdala ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_noddi_odi | numeric | 0 | 1 |
right caudate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_noddi_odi | numeric | 0 | 1 |
right cerebellum cortex ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_noddi_odi | numeric | 0 | 1 |
right cerebellum white matter ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_noddi_odi | numeric | 0 | 1 |
right choroid plexus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_noddi_odi | numeric | 0.4878051 | 0.7193713 |
right hippocampus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_noddi_odi | numeric | 0 | 1 |
right inf lat vent ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_noddi_odi | numeric | 0 | 1 |
right lateral ventricle ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_noddi_odi | numeric | 0.5675093 | 0.7628787 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_noddi_odi | numeric | 0.4840530 | 0.6685028 |
right pallidum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_noddi_odi | numeric | 0.5051765 | 0.6119965 |
right putamen ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_noddi_odi | numeric | 0 | 1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_noddi_odi | numeric | 0.5383616 | 0.6977409 |
right thalamus proper ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_noddi_odi | numeric | 0 | 1 |
right unsegmented white matter ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_noddi_odi | numeric | 0 | 1 |
right ventral dc ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_noddi_odi | numeric | 0 | 1 |
right vessel ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_noddi_odi | numeric | 0 | 1 |
temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_noddi_odi | numeric | 0 | 1 |
global total intracranial volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_noddi_odi | numeric | 0 | infinity |
white matter hypointensities ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_noddi_odi | numeric | 0 | 1 |
white matter left bankssts ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_noddi_odi | numeric | 0 | 1 |
white matter left caudalanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
white matter left caudalmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left cuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_noddi_odi | numeric | 0 | 1 |
white matter left entorhinal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left frontalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_noddi_odi | numeric | 0 | 1 |
white matter left fusiform ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_noddi_odi | numeric | 0 | 1 |
white matter left inferiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left inferiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left insula ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_noddi_odi | numeric | 0 | 1 |
white matter left isthmuscingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_noddi_odi | numeric | 0 | 1 |
white matter left lateraloccipital ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_noddi_odi | numeric | 0 | 1 |
white matter left lateralorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left lingual ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_noddi_odi | numeric | 0 | 1 |
white matter left medialorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left middletemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left paracentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_noddi_odi | numeric | 0 | 1 |
white matter left parahippocampal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left parsopercularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_noddi_odi | numeric | 0 | 1 |
white matter left parsorbitalis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_noddi_odi | numeric | 0 | 1 |
white matter left parstriangularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_noddi_odi | numeric | 0 | 1 |
white matter left pericalcarine ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_noddi_odi | numeric | 0 | 1 |
white matter left postcentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_noddi_odi | numeric | 0 | 1 |
white matter left posteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
white matter left precentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_noddi_odi | numeric | 0 | 1 |
white matter left precuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_noddi_odi | numeric | 0 | 1 |
white matter left rostralanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
white matter left rostralmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left superiorfrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left superiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left superiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left supramarginal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_noddi_odi | numeric | 0 | 1 |
white matter left temporalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_noddi_odi | numeric | 0 | 1 |
white matter left transversetemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right bankssts ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_noddi_odi | numeric | 0 | 1 |
white matter right caudalanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
white matter right caudalmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right cuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_noddi_odi | numeric | 0 | 1 |
white matter right entorhinal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right frontalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_noddi_odi | numeric | 0 | 1 |
white matter right fusiform ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_noddi_odi | numeric | 0 | 1 |
white matter right inferiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right inferiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right insula ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_noddi_odi | numeric | 0 | 1 |
white matter right isthmuscingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_noddi_odi | numeric | 0 | 1 |
white matter right lateraloccipital ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_noddi_odi | numeric | 0 | 1 |
white matter right lateralorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right lingual ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_noddi_odi | numeric | 0 | 1 |
white matter right medialorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right middletemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right paracentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_noddi_odi | numeric | 0 | 1 |
white matter right parahippocampal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right parsopercularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_noddi_odi | numeric | 0 | 1 |
white matter right parsorbitalis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_noddi_odi | numeric | 0 | 1 |
white matter right parstriangularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_noddi_odi | numeric | 0 | 1 |
white matter right pericalcarine ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_noddi_odi | numeric | 0 | 1 |
white matter right postcentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_noddi_odi | numeric | 0 | 1 |
white matter right posteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
white matter right precentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_noddi_odi | numeric | 0 | 1 |
white matter right precuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_noddi_odi | numeric | 0 | 1 |
white matter right rostralanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
white matter right rostralmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right superiorfrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right superiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right superiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right supramarginal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_noddi_odi | numeric | 0 | 1 |
white matter right temporalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_noddi_odi | numeric | 0 | 1 |
white matter right transversetemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_noddi_odi | numeric | 0 | 1 |
global white matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_noddi_odi | numeric | 0 | infinity |
3rd ventricle ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_noddi_odi | numeric | 0 | 1 |
4th ventricle ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_noddi_odi | numeric | 0 | 1 |
PASL, or pulsed pseudocontinuous arterial spin labeling, is an MRI sequence used to non-invasively measure cerebral blood flow (CBF). Values in this sheet represent CBF in raw units of mL/100g tissues/min
Dolui, S., Vidorreta, M., Wang, Z., Nasrallah, I. M., Alavi, A., Wolk, D. A., & Detre, J. A. (2017). Comparison of PASL, PCASL, and background‐suppressed 3D PCASL in mild cognitive impairment. Human brain mapping, 38(10), 5260-5273.
van Osch, M. J. P., Hendrikse, J., & van der Grond, J. (2006). Sensitivity comparison of multiple vs. single inversion time pulsed arterial spin labeling fmri. Journal of Magnetic Resonance Imaging, 25(1), 215–221. https://doi.org/10.1002/jmri.20823
ad meta six composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_pasl | numeric | 0 | 42.905092 |
ad meta ten composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_pasl | numeric | 0 | 41.026320 |
brainstem CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_pasl | numeric | 0 | 5.838820 |
whole brain CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cbf.imaging_pasl | numeric | 0 | 48.597288 |
anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_pasl | numeric | 0 | -0.34388400 |
central corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_pasl | numeric | 0 | -1.07872000 |
mid anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_pasl | numeric | 0 | -9.82317e-02 |
mid posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_pasl | numeric | 0 | 10.2442000 |
posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_pasl | numeric | 0 | -1.419870000 |
csf CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_pasl | numeric | 0 | 26.611700 |
left banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_pasl | numeric | 0 | 96.08980 |
left caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_pasl | numeric | 0 | 33.772300 |
left caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_pasl | numeric | 0 | 36.34160 |
left cuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_pasl | numeric | 0 | 64.97480 |
left entorhinal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_pasl | numeric | 0 | 55.218200 |
left frontalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_pasl | numeric | 0 | -15.842900 |
left fusiform CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_pasl | numeric | 0 | 47.00600 |
left inferiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_pasl | numeric | 0 | 45.894900 |
left inferiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_pasl | numeric | 0 | 46.03040000 |
left insula CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_pasl | numeric | 0 | 49.18260 |
left isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_pasl | numeric | 0 | 61.85910 |
left lateraloccipital CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_pasl | numeric | 0 | 64.02000 |
left lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_pasl | numeric | 0 | -25.1460000 |
left lingual CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_pasl | numeric | 0 | 70.56480 |
left medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_pasl | numeric | 0 | -21.63080 |
left middletemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_pasl | numeric | 0 | 50.314700 |
left paracentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_pasl | numeric | 0 | 47.473400 |
left parahippocampal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_pasl | numeric | 0 | 62.15120 |
left parsopercularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_pasl | numeric | 0 | 50.13850 |
left parsorbitalis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_pasl | numeric | 0 | -15.071500 |
left parstriangularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_pasl | numeric | 0 | 48.83140 |
left pericalcarine CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_pasl | numeric | 0 | 66.84170 |
left postcentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_pasl | numeric | 0 | 40.07190 |
left posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_pasl | numeric | 0 | 62.371700 |
left precentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_pasl | numeric | 0 | 37.26010 |
left precuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_pasl | numeric | 0 | 50.5834000 |
left rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_pasl | numeric | 0 | 36.757800 |
left rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_pasl | numeric | 0 | 36.38880 |
left superiorfrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_pasl | numeric | 0 | 31.87120 |
left superiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_pasl | numeric | 0 | 33.678600 |
left superiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_pasl | numeric | 0 | 58.68570 |
left supramarginal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_pasl | numeric | 0 | 67.10780 |
left temporalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_pasl | numeric | 0 | -42.085400 |
left transversetemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_pasl | numeric | 0 | 66.95150 |
left unknown CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_pasl | numeric | 0 | 34.025700 |
right banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_pasl | numeric | 0 | 77.46440 |
right caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_pasl | numeric | 0 | 67.18200 |
right caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_pasl | numeric | 0 | 33.580500 |
right cuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_pasl | numeric | 0 | 64.531600 |
right entorhinal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_pasl | numeric | 0 | -22.7758000 |
right frontalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_pasl | numeric | 0 | -41.6373000 |
right fusiform CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_pasl | numeric | 0 | 47.688100 |
right inferiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_pasl | numeric | 0 | 51.804300 |
right inferiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_pasl | numeric | 0 | 42.0412000 |
right insula CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_pasl | numeric | 0 | 62.14270 |
right isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_pasl | numeric | 0 | 67.46070 |
right lateraloccipital CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_pasl | numeric | 0 | 52.461400 |
right lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_pasl | numeric | 0 | -22.34480 |
right lingual CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_pasl | numeric | 0 | 61.6776 |
right medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_pasl | numeric | 0 | -18.0972000 |
right middletemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_pasl | numeric | 0 | 58.4179000 |
right paracentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_pasl | numeric | 0 | 51.56490 |
right parahippocampal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_pasl | numeric | 0 | 64.62400 |
right parsopercularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_pasl | numeric | 0 | 60.06110 |
right parsorbitalis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_pasl | numeric | 0 | -10.820600 |
right parstriangularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_pasl | numeric | 0 | 61.84620 |
right pericalcarine CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_pasl | numeric | 0 | 70.60640 |
right postcentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_pasl | numeric | 0 | 39.06360 |
right posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_pasl | numeric | 0 | 112.12600 |
right precentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_pasl | numeric | 0 | 39.40180 |
right precuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_pasl | numeric | 0 | 52.44960 |
right rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_pasl | numeric | 0 | -21.93730 |
right rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_pasl | numeric | 0 | 35.3218000 |
right superiorfrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_pasl | numeric | 0 | 38.76000 |
right superiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_pasl | numeric | 0 | 31.831100 |
right superiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_pasl | numeric | 0 | 75.75780 |
right supramarginal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_pasl | numeric | 0 | 58.54960 |
right temporalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_pasl | numeric | 0 | -28.388600 |
right transversetemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_pasl | numeric | 0 | 87.1071 |
right unknown CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_pasl | numeric | 0 | 45.786800 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_pasl | numeric | 0 | infinity |
frontal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_pasl | numeric | 0 | 36.435655 |
global grey matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_pasl | numeric | 0 | infinity |
Calculation of CBF in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_pasl | Mean | character |
left accumbens area CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_pasl | numeric | 0 | 46.98080 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_pasl | numeric | 4.7904724 | 47.5018000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_pasl | numeric | 5.798903 | 41.755200 |
left amygdala CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_pasl | numeric | 0 | 51.67600 |
left caudate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_pasl | numeric | 0 | 31.72720 |
left cerebellum cortex CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_pasl | numeric | 0 | 47.25200 |
left cerebellum white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_pasl | numeric | 0 | 12.40110000 |
left choroid plexus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_pasl | numeric | 0 | 17.783600 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_pasl | numeric | 3.044970 | 37.126320 |
left hippocampus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_pasl | numeric | 0 | 49.95020 |
left inf lat vent CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_pasl | numeric | 0 | 32.701100 |
left lateral ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_pasl | numeric | 0 | 5.6376700 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_pasl | numeric | 2.539067 | 45.596400 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_pasl | numeric | 8.09869 | 53.71102 |
left pallidum CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_pasl | numeric | 0 | 7.666590 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_pasl | numeric | 5.143659 | 41.692340 |
left putamen CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_pasl | numeric | 0 | 45.5755 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_pasl | numeric | 6.100476 | 45.025036 |
left thalamus proper CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_pasl | numeric | 0 | 35.39800 |
left unsegmented white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_pasl | numeric | 0 | -0.1604700 |
left ventral dc CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_pasl | numeric | 0 | 14.311000 |
left vessel CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_pasl | numeric | 0 | 52.05920 |
medial temporal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_pasl | numeric | 0 | 44.674817 |
occipital composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_pasl | numeric | 0 | 53.71102 |
optic chiasm CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_pasl | numeric | 0 | 19.48280000 |
parietal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_pasl | numeric | 0 | 41.876280 |
right accumbens area CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_pasl | numeric | 0 | -13.87700 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_pasl | numeric | 1.579717 | 48.657500 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_pasl | numeric | 1.807209 | 44.149230 |
right amygdala CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_pasl | numeric | 0 | 60.72200 |
right caudate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_pasl | numeric | 0 | 31.59500 |
right cerebellum cortex CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_pasl | numeric | 0 | 48.32400 |
right cerebellum white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_pasl | numeric | 0 | 10.0875000 |
right choroid plexus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_pasl | numeric | 0 | 20.07650 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_pasl | numeric | 3.546092 | 38.628910 |
right hippocampus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_pasl | numeric | 0 | 55.71020 |
right inf lat vent CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_pasl | numeric | 0 | 34.207700 |
right lateral ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_pasl | numeric | 0 | 3.8153000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_pasl | numeric | 2.834333 | 47.991533 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_pasl | numeric | 10.34520 | 54.98035 |
right pallidum CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_pasl | numeric | 0 | 3.162990 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_pasl | numeric | 7.457093 | 42.538450 |
right putamen CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_pasl | numeric | 0 | 46.14060 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_pasl | numeric | 3.200217 | 49.025009 |
right thalamus proper CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_pasl | numeric | 0 | 39.32210 |
right unsegmented white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_pasl | numeric | 0 | -0.0367542 |
right ventral dc CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_pasl | numeric | 0 | 17.99840 |
right vessel CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_pasl | numeric | 0 | 51.976500 |
temporal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_pasl | numeric | 0 | 47.025023 |
global total intracranial volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_pasl | numeric | 0 | 2039491 |
white matter hypointensities CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_pasl | numeric | 0 | 40.00370 |
white matter left bankssts CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_pasl | numeric | 0 | 20.277800 |
white matter left caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_pasl | numeric | 0 | -0.430474000 |
white matter left caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_pasl | numeric | 0 | 15.660400 |
white matter left cuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_pasl | numeric | 0 | 34.145000 |
white matter left entorhinal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_pasl | numeric | 0 | 21.7266000 |
white matter left frontalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_pasl | numeric | 0 | 34.794000 |
white matter left fusiform CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_pasl | numeric | 0 | 20.21880 |
white matter left inferiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_pasl | numeric | 0 | 23.8169000 |
white matter left inferiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_pasl | numeric | 0 | -10.3157000 |
white matter left insula CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_pasl | numeric | 0 | 15.35160 |
white matter left isthmuscingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_pasl | numeric | 0 | 9.338530 |
white matter left lateraloccipital CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_pasl | numeric | 0 | 32.155200 |
white matter left lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_pasl | numeric | 0 | 14.602400 |
white matter left lingual CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_pasl | numeric | 0 | 30.39160 |
white matter left medialorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_pasl | numeric | 0 | 12.268100 |
white matter left middletemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_pasl | numeric | 0 | 27.03220 |
white matter left paracentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_pasl | numeric | 0 | -1.1495800 |
white matter left parahippocampal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_pasl | numeric | 0 | 19.84480 |
white matter left parsopercularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_pasl | numeric | 0 | 12.92010 |
white matter left parsorbitalis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_pasl | numeric | 0 | 25.936900 |
white matter left parstriangularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_pasl | numeric | 0 | 21.78530 |
white matter left pericalcarine CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_pasl | numeric | 0 | 26.344000 |
white matter left postcentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_pasl | numeric | 0 | 25.70490 |
white matter left posteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_pasl | numeric | 0 | 11.2279000 |
white matter left precentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_pasl | numeric | 0 | 12.5106000 |
white matter left precuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_pasl | numeric | 0 | 17.282800 |
white matter left rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_pasl | numeric | 0 | -0.173023000 |
white matter left rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_pasl | numeric | 0 | 16.281600 |
white matter left superiorfrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_pasl | numeric | 0 | -0.9617850 |
white matter left superiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_pasl | numeric | 0 | 12.85440000 |
white matter left superiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_pasl | numeric | 0 | 18.66070 |
white matter left supramarginal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_pasl | numeric | 0 | 23.49320 |
white matter left temporalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_pasl | numeric | 0 | -16.359100 |
white matter left transversetemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_pasl | numeric | 0 | 23.83980 |
white matter right bankssts CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_pasl | numeric | 0 | 10.97010 |
white matter right caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_pasl | numeric | 0 | 11.6144000 |
white matter right caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_pasl | numeric | 0 | 10.776900 |
white matter right cuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_pasl | numeric | 0 | 34.01130 |
white matter right entorhinal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_pasl | numeric | 0 | 17.2635000 |
white matter right frontalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_pasl | numeric | 0 | -23.5439000 |
white matter right fusiform CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_pasl | numeric | 0 | 22.23840 |
white matter right inferiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_pasl | numeric | 0 | 21.495800 |
white matter right inferiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_pasl | numeric | 0 | 21.1081000 |
white matter right insula CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_pasl | numeric | 0 | 14.27250 |
white matter right isthmuscingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_pasl | numeric | 0 | 12.413200 |
white matter right lateraloccipital CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_pasl | numeric | 0 | 31.23930 |
white matter right lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_pasl | numeric | 0 | 17.22780 |
white matter right lingual CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_pasl | numeric | 0 | 30.72980 |
white matter right medialorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_pasl | numeric | 0 | 12.0676000 |
white matter right middletemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_pasl | numeric | 0 | 20.430700 |
white matter right paracentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_pasl | numeric | 0 | -1.5267000 |
white matter right parahippocampal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_pasl | numeric | 0 | 22.40610 |
white matter right parsopercularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_pasl | numeric | 0 | 11.01320 |
white matter right parsorbitalis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_pasl | numeric | 0 | 28.303500 |
white matter right parstriangularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_pasl | numeric | 0 | 20.13200 |
white matter right pericalcarine CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_pasl | numeric | 0 | 33.77730 |
white matter right postcentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_pasl | numeric | 0 | 17.440200 |
white matter right posteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_pasl | numeric | 0 | 26.9787000 |
white matter right precentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_pasl | numeric | 0 | -0.4669170 |
white matter right precuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_pasl | numeric | 0 | 15.30730 |
white matter right rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_pasl | numeric | 0 | 10.4125000 |
white matter right rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_pasl | numeric | 0 | 12.697700 |
white matter right superiorfrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_pasl | numeric | 0 | 10.041000 |
white matter right superiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_pasl | numeric | 0 | 14.0930000 |
white matter right superiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_pasl | numeric | 0 | 16.47790 |
white matter right supramarginal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_pasl | numeric | 0 | 17.23680 |
white matter right temporalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_pasl | numeric | 0 | 23.9682000 |
white matter right transversetemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_pasl | numeric | 0 | 15.372000 |
global white matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_pasl | numeric | 0 | 643893.3 |
3rd ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_pasl | numeric | 0 | 16.9449000 |
4th ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_pasl | numeric | 0 | 19.7679000 |
PCASL, or pseudocontinuous arterial spin labeling, is an MRI sequence used to non-invasively measure cerebral blood flow (CBF). PCASL is typically thought to have better signal-to-noise ratio and higher test-retest reliability than other ASL methods (e.g., pulsed ASL; continuous ASL). Values in this sheet represent CBF in raw units of mL/100g tissues/min
Dai, W., Garcia, D., De Bazelaire, C., & Alsop, D. C. (2008). Continuous flow‐driven inversion for arterial spin labeling using pulsed radio frequency and gradient fields. Magnetic Resonance in Medicine: An Official Journal of the International Society for Magnetic Resonance in Medicine, 60(6), 1488-1497.
Dolui, S., Vidorreta, M., Wang, Z., Nasrallah, I. M., Alavi, A., Wolk, D. A., & Detre, J. A. (2017). Comparison of PASL, PCASL, and background‐suppressed 3D PCASL in mild cognitive impairment. Human brain mapping, 38(10), 5260-5273.
ad meta six composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_pcasl | numeric | 0 | 34.446175 |
ad meta ten composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_pcasl | numeric | 0 | 37.677820 |
brainstem CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_pcasl | numeric | 0 | -1.4589800 |
whole brain CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cbf.imaging_pcasl | numeric | 0 | 54.31068 |
anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_pcasl | numeric | 0 | -0.291158 |
central corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_pcasl | numeric | 0 | 26.160800000 |
mid anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_pcasl | numeric | 0 | -1.46639000 |
mid posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_pcasl | numeric | 0 | 16.3073000 |
posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_pcasl | numeric | 0 | -1.00238000 |
csf CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_pcasl | numeric | 0 | 28.7916000 |
left banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_pcasl | numeric | 0 | 45.5427 |
left caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_pcasl | numeric | 0 | 50.24070 |
left caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_pcasl | numeric | 0 | 50.77770 |
left cuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_pcasl | numeric | 0 | 55.54520 |
left entorhinal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_pcasl | numeric | 0 | -15.706400 |
left frontalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_pcasl | numeric | 0 | 59.784000 |
left fusiform CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_pcasl | numeric | 0 | 37.176900 |
left inferiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_pcasl | numeric | 0 | 51.12080 |
left inferiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_pcasl | numeric | 0 | 43.02690 |
left insula CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_pcasl | numeric | 0 | 40.0207 |
left isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_pcasl | numeric | 0 | 49.29320 |
left lateraloccipital CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_pcasl | numeric | 0 | 53.92090 |
left lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_pcasl | numeric | 0 | 46.69690 |
left lingual CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_pcasl | numeric | 0 | 48.440400 |
left medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_pcasl | numeric | 0 | 47.56020 |
left middletemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_pcasl | numeric | 0 | 42.8341 |
left paracentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_pcasl | numeric | 0 | 43.13260 |
left parahippocampal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_pcasl | numeric | 0 | -10.716500 |
left parsopercularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_pcasl | numeric | 0 | 46.8145 |
left parsorbitalis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_pcasl | numeric | 0 | 49.8189 |
left parstriangularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_pcasl | numeric | 0 | 44.2379 |
left pericalcarine CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_pcasl | numeric | 0 | 51.86560 |
left postcentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_pcasl | numeric | 0 | 41.01860 |
left posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_pcasl | numeric | 0 | 53.41060 |
left precentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_pcasl | numeric | 0 | 44.60060 |
left precuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_pcasl | numeric | 0 | 52.83330 |
left rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_pcasl | numeric | 0 | 47.2348 |
left rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_pcasl | numeric | 0 | 52.43950 |
left superiorfrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_pcasl | numeric | 0 | 48.60700 |
left superiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_pcasl | numeric | 0 | 46.262500 |
left superiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_pcasl | numeric | 0 | 41.6325 |
left supramarginal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_pcasl | numeric | 0 | 43.4903 |
left temporalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_pcasl | numeric | 0 | 33.212700 |
left transversetemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_pcasl | numeric | 0 | 56.4887 |
left unknown CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_pcasl | numeric | 0 | 24.15610 |
right banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_pcasl | numeric | 0 | 47.9254 |
right caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_pcasl | numeric | 0 | 58.84400 |
right caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_pcasl | numeric | 0 | 52.74430 |
right cuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_pcasl | numeric | 0 | 56.27520 |
right entorhinal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_pcasl | numeric | 0 | 36.82920000 |
right frontalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_pcasl | numeric | 0 | 74.75130 |
right fusiform CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_pcasl | numeric | 0 | 33.80820 |
right inferiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_pcasl | numeric | 0 | 58.18610 |
right inferiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_pcasl | numeric | 0 | 45.07720 |
right insula CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_pcasl | numeric | 0 | 40.02420 |
right isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_pcasl | numeric | 0 | 55.42110 |
right lateraloccipital CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_pcasl | numeric | 0 | 50.08340 |
right lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_pcasl | numeric | 0 | 49.3001 |
right lingual CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_pcasl | numeric | 0 | 47.56860 |
right medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_pcasl | numeric | 0 | 52.58100 |
right middletemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_pcasl | numeric | 0 | 47.0305 |
right paracentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_pcasl | numeric | 0 | 43.71320 |
right parahippocampal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_pcasl | numeric | 0 | 32.96340 |
right parsopercularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_pcasl | numeric | 0 | 55.7225 |
right parsorbitalis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_pcasl | numeric | 0 | 50.00450 |
right parstriangularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_pcasl | numeric | 0 | 47.3771 |
right pericalcarine CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_pcasl | numeric | 0 | 54.44980 |
right postcentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_pcasl | numeric | 0 | 46.15340 |
right posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_pcasl | numeric | 0 | 61.4821 |
right precentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_pcasl | numeric | 0 | 46.16800 |
right precuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_pcasl | numeric | 0 | 49.34570 |
right rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_pcasl | numeric | 0 | 49.9981 |
right rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_pcasl | numeric | 0 | 52.68880 |
right superiorfrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_pcasl | numeric | 0 | 49.12480 |
right superiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_pcasl | numeric | 0 | 51.740000 |
right superiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_pcasl | numeric | 0 | 42.13770 |
right supramarginal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_pcasl | numeric | 0 | 47.7366 |
right temporalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_pcasl | numeric | 0 | 36.77440 |
right transversetemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_pcasl | numeric | 0 | 58.8117 |
right unknown CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_pcasl | numeric | 0 | 35.05890 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_pcasl | numeric | 0 | infinity |
frontal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_pcasl | numeric | 0 | 48.12895 |
global grey matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_pcasl | numeric | 0 | infinity |
Calculation of CBF in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_pcasl | Mean | character |
left accumbens area CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_pcasl | numeric | 0 | -10.63870 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_pcasl | numeric | 4.438522 | 32.782767 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_pcasl | numeric | 6.655443 | 36.260220 |
left amygdala CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_pcasl | numeric | 0 | 38.310800 |
left caudate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_pcasl | numeric | 0 | 34.609600 |
left cerebellum cortex CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_pcasl | numeric | 0 | -18.807900 |
left cerebellum white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_pcasl | numeric | 0 | 10.9110000 |
left choroid plexus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_pcasl | numeric | 0 | 17.153000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_pcasl | numeric | 9.927425 | 46.137600 |
left hippocampus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_pcasl | numeric | 0 | 39.15720 |
left inf lat vent CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_pcasl | numeric | 0 | 26.786200 |
left lateral ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_pcasl | numeric | 0 | -1.269170 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_pcasl | numeric | 4.636722 | 32.794533 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_pcasl | numeric | 5.035354 | 52.166550 |
left pallidum CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_pcasl | numeric | 0 | 10.300600 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_pcasl | numeric | 7.911658 | 45.570740 |
left putamen CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_pcasl | numeric | 0 | 37.9508 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_pcasl | numeric | 7.210142 | 35.655582 |
left thalamus proper CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_pcasl | numeric | 0 | 23.405500 |
left unsegmented white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_pcasl | numeric | 0 | 0.976057 |
left ventral dc CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_pcasl | numeric | 0 | 16.547900 |
left vessel CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_pcasl | numeric | 0 | 48.56790 |
medial temporal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_pcasl | numeric | 0 | 32.403400 |
occipital composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_pcasl | numeric | 0 | 52.166550 |
optic chiasm CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_pcasl | numeric | 0 | 18.222700 |
parietal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_pcasl | numeric | 0 | 47.658110 |
right accumbens area CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_pcasl | numeric | 0 | 58.996200 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_pcasl | numeric | 6.218467 | 36.640817 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_pcasl | numeric | 6.887535 | 39.095420 |
right amygdala CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_pcasl | numeric | 0 | 44.55870 |
right caudate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_pcasl | numeric | 0 | 38.284900 |
right cerebellum cortex CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_pcasl | numeric | 0 | 40.990800 |
right cerebellum white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_pcasl | numeric | 0 | -1.80809000 |
right choroid plexus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_pcasl | numeric | 0 | 19.496800 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_pcasl | numeric | 11.75054 | 50.12029 |
right hippocampus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_pcasl | numeric | 0 | 45.89640 |
right inf lat vent CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_pcasl | numeric | 0 | 27.167700 |
right lateral ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_pcasl | numeric | 0 | -0.198145 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_pcasl | numeric | 3.896760 | 33.942733 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_pcasl | numeric | 3.522730 | 52.020400 |
right pallidum CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_pcasl | numeric | 0 | -0.0905455 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_pcasl | numeric | 8.292881 | 49.204900 |
right putamen CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_pcasl | numeric | 0 | 35.08960 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_pcasl | numeric | 8.618654 | 38.444691 |
right thalamus proper CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_pcasl | numeric | 0 | 34.944900 |
right unsegmented white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_pcasl | numeric | 0 | 1.228620 |
right ventral dc CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_pcasl | numeric | 0 | 20.313600 |
right vessel CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_pcasl | numeric | 0 | -10.61880 |
temporal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_pcasl | numeric | 0 | 37.050136 |
global total intracranial volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_pcasl | numeric | 0 | 2075711 |
white matter hypointensities CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_pcasl | numeric | 0 | 39.57300 |
white matter left bankssts CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_pcasl | numeric | 0 | 10.71620 |
white matter left caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_pcasl | numeric | 0 | 6.347070 |
white matter left caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_pcasl | numeric | 0 | 20.83140 |
white matter left cuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_pcasl | numeric | 0 | 30.12670 |
white matter left entorhinal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_pcasl | numeric | 0 | 15.934100 |
white matter left frontalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_pcasl | numeric | 0 | 38.151600 |
white matter left fusiform CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_pcasl | numeric | 0 | 14.752100 |
white matter left inferiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_pcasl | numeric | 0 | 22.48270 |
white matter left inferiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_pcasl | numeric | 0 | 21.81510 |
white matter left insula CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_pcasl | numeric | 0 | 15.73410 |
white matter left isthmuscingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_pcasl | numeric | 0 | -0.0930159 |
white matter left lateraloccipital CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_pcasl | numeric | 0 | 26.091400 |
white matter left lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_pcasl | numeric | 0 | 14.633500 |
white matter left lingual CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_pcasl | numeric | 0 | 21.51930 |
white matter left medialorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_pcasl | numeric | 0 | 13.53620 |
white matter left middletemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_pcasl | numeric | 0 | 23.55950 |
white matter left paracentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_pcasl | numeric | 0 | -0.078523 |
white matter left parahippocampal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_pcasl | numeric | 0 | 16.5060000 |
white matter left parsopercularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_pcasl | numeric | 0 | 13.75780 |
white matter left parsorbitalis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_pcasl | numeric | 0 | 32.02480 |
white matter left parstriangularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_pcasl | numeric | 0 | 18.67790 |
white matter left pericalcarine CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_pcasl | numeric | 0 | 21.999200 |
white matter left postcentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_pcasl | numeric | 0 | 24.49010 |
white matter left posteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_pcasl | numeric | 0 | 10.79740 |
white matter left precentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_pcasl | numeric | 0 | 14.90210 |
white matter left precuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_pcasl | numeric | 0 | 14.38330 |
white matter left rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_pcasl | numeric | 0 | 6.49873 |
white matter left rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_pcasl | numeric | 0 | 25.47280 |
white matter left superiorfrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_pcasl | numeric | 0 | 10.47840 |
white matter left superiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_pcasl | numeric | 0 | 18.720000 |
white matter left superiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_pcasl | numeric | 0 | 14.77530 |
white matter left supramarginal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_pcasl | numeric | 0 | 20.61580 |
white matter left temporalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_pcasl | numeric | 0 | 18.186500 |
white matter left transversetemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_pcasl | numeric | 0 | 19.17270 |
white matter right bankssts CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_pcasl | numeric | 0 | 8.78415 |
white matter right caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_pcasl | numeric | 0 | 12.17120 |
white matter right caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_pcasl | numeric | 0 | 20.23110 |
white matter right cuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_pcasl | numeric | 0 | 30.9932000 |
white matter right entorhinal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_pcasl | numeric | 0 | 14.6136000 |
white matter right frontalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_pcasl | numeric | 0 | 41.71660 |
white matter right fusiform CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_pcasl | numeric | 0 | 12.6659000 |
white matter right inferiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_pcasl | numeric | 0 | 25.08210 |
white matter right inferiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_pcasl | numeric | 0 | 18.30250 |
white matter right insula CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_pcasl | numeric | 0 | 11.37480 |
white matter right isthmuscingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_pcasl | numeric | 0 | 10.288100 |
white matter right lateraloccipital CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_pcasl | numeric | 0 | 28.29520 |
white matter right lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_pcasl | numeric | 0 | 17.68690 |
white matter right lingual CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_pcasl | numeric | 0 | 24.46320 |
white matter right medialorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_pcasl | numeric | 0 | 16.20200 |
white matter right middletemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_pcasl | numeric | 0 | 15.28800 |
white matter right paracentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_pcasl | numeric | 0 | 6.137420 |
white matter right parahippocampal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_pcasl | numeric | 0 | 14.485600 |
white matter right parsopercularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_pcasl | numeric | 0 | 11.75570 |
white matter right parsorbitalis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_pcasl | numeric | 0 | 38.565100 |
white matter right parstriangularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_pcasl | numeric | 0 | 16.30950 |
white matter right pericalcarine CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_pcasl | numeric | 0 | 26.54310 |
white matter right postcentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_pcasl | numeric | 0 | 19.30660 |
white matter right posteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_pcasl | numeric | 0 | 18.44670 |
white matter right precentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_pcasl | numeric | 0 | 12.02330 |
white matter right precuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_pcasl | numeric | 0 | 12.77760 |
white matter right rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_pcasl | numeric | 0 | 14.06790 |
white matter right rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_pcasl | numeric | 0 | 20.89920 |
white matter right superiorfrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_pcasl | numeric | 0 | 10.81920 |
white matter right superiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_pcasl | numeric | 0 | 16.838300 |
white matter right superiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_pcasl | numeric | 0 | 12.40050 |
white matter right supramarginal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_pcasl | numeric | 0 | 15.46090 |
white matter right temporalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_pcasl | numeric | 0 | 12.1033000 |
white matter right transversetemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_pcasl | numeric | 0 | 11.481200 |
global white matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_pcasl | numeric | 0 | 627774.2 |
3rd ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_pcasl | numeric | 0 | 39.8600000 |
4th ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_pcasl | numeric | 0 | -16.75690000 |
Structural MRI is a technique that looks at the anatomical information of the gray and white matter structures of the brain. Brain volume is a widely used analysis that takes structural MRI to investigate volumetric changes in brain regions as it has been shown that aging, brain injury, and diseases like dementia can cause reductions in specific parts of the brain.
ad meta six composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_t1 | numeric | 23643.50 | 52917.30 |
ad meta ten composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_t1 | numeric | 45128.22 | 100966.39 |
brain stem volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_t1 | numeric | 1435.455 | 4168.125 |
anterior corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_t1 | numeric | 70.43119 | 191.56466 |
central corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_t1 | numeric | 10.24154 | 112.58629 |
mid anterior corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_t1 | numeric | 6.072097 | 109.048275 |
mid posterior corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_t1 | numeric | 20.94356 | 113.01053 |
posterior corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_t1 | numeric | 36.35516 | 171.35888 |
global csf volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf_22.imaging_t1 | numeric | 275.3865 | 770.6576 |
csf volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf_7.imaging_t1 | numeric | 165129.9 | 1105035.9 |
left bankssts volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_t1 | numeric | 594.4286 | 1742.6408 |
left caudalanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_t1 | numeric | 284.4980 | 918.3881 |
left caudalmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_t1 | numeric | 1519.796 | 4929.154 |
left cuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_t1 | numeric | 627.3146 | 2009.4109 |
left entorhinal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_t1 | numeric | 838.2724 | 2095.4464 |
left frontalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_t1 | numeric | 144.1125 | 685.5874 |
left fusiform volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_t1 | numeric | 4092.457 | 8702.539 |
left inferiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_t1 | numeric | 3196.095 | 9184.522 |
left inferiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_t1 | numeric | 3487.354 | 8623.834 |
left insula volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_t1 | numeric | 2487.091 | 5651.842 |
left isthmuscingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_t1 | numeric | 617.5744 | 1682.0325 |
left lateraloccipital volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_t1 | numeric | 2235.151 | 7438.230 |
left lateralorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_t1 | numeric | 1903.824 | 4918.792 |
left lingual volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_t1 | numeric | 1908.043 | 4460.839 |
left medialorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_t1 | numeric | 1472.236 | 3737.812 |
left middletemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_t1 | numeric | 3537.506 | 9519.761 |
left paracentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_t1 | numeric | 696.2287 | 2001.9623 |
left parahippocampal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_t1 | numeric | 743.6812 | 1483.2450 |
left parsopercularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_t1 | numeric | 1011.896 | 3189.520 |
left parsorbitalis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_t1 | numeric | 460.9136 | 1676.5076 |
left parstriangularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_t1 | numeric | 710.7986 | 2371.9061 |
left pericalcarine volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_t1 | numeric | 410.4675 | 1279.3309 |
left postcentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_t1 | numeric | 1513.438 | 4570.155 |
left posteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_t1 | numeric | 568.3129 | 2037.2580 |
left precentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_t1 | numeric | 2170.412 | 6667.717 |
left precuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_t1 | numeric | 2346.610 | 6700.219 |
left rostralanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_t1 | numeric | 717.2516 | 2175.8828 |
left rostralmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_t1 | numeric | 3317.034 | 11865.353 |
left superiorfrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_t1 | numeric | 4917.746 | 15391.552 |
left superiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_t1 | numeric | 2767.358 | 7128.844 |
left superiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_t1 | numeric | 3645.844 | 9481.894 |
left supramarginal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_t1 | numeric | 2638.238 | 6600.589 |
left temporalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_t1 | numeric | 306.2178 | 2068.6793 |
left transversetemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_t1 | numeric | 233.3701 | 924.2100 |
left unknown volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_t1 | numeric | 248.2329 | 535.3830 |
right bankssts volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_t1 | numeric | 710.8391 | 2137.6946 |
right caudalanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_t1 | numeric | 350.7097 | 1366.1662 |
right caudalmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_t1 | numeric | 1164.031 | 4002.818 |
right cuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_t1 | numeric | 749.2264 | 2221.2022 |
right entorhinal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_t1 | numeric | 568.1509 | 1783.7044 |
right frontalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_t1 | numeric | 149.5159 | 687.1365 |
right fusiform volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_t1 | numeric | 3558.532 | 7846.335 |
right inferiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_t1 | numeric | 3033.302 | 9556.245 |
right inferiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_t1 | numeric | 3523.635 | 8988.266 |
right insula volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_t1 | numeric | 2577.454 | 5944.961 |
right isthmuscingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_t1 | numeric | 625.2727 | 1571.3359 |
right lateraloccipital volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_t1 | numeric | 2584.136 | 7552.204 |
right lateralorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_t1 | numeric | 1967.881 | 4714.267 |
right lingual volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_t1 | numeric | 2115.612 | 4430.464 |
right medialorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_t1 | numeric | 1108.681 | 3150.498 |
right middletemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_t1 | numeric | 3222.102 | 9522.866 |
right paracentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_t1 | numeric | 751.5315 | 2381.7173 |
right parahippocampal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_t1 | numeric | 593.0381 | 1202.7386 |
right parsopercularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_t1 | numeric | 942.3135 | 3086.8594 |
right parsorbitalis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_t1 | numeric | 417.7474 | 1613.9385 |
right parstriangularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_t1 | numeric | 1088.620 | 3354.791 |
right pericalcarine volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_t1 | numeric | 594.7223 | 1848.8486 |
right postcentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_t1 | numeric | 1411.104 | 4239.000 |
right posteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_t1 | numeric | 482.4664 | 2233.9665 |
right precentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_t1 | numeric | 2281.203 | 7464.690 |
right precuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_t1 | numeric | 2451.826 | 7862.704 |
right rostralanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_t1 | numeric | 476.7862 | 1503.7954 |
right rostralmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_t1 | numeric | 3242.460 | 13084.605 |
right superiorfrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_t1 | numeric | 4881.971 | 15666.649 |
right superiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_t1 | numeric | 2491.287 | 7332.795 |
right superiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_t1 | numeric | 3465.045 | 8986.815 |
right supramarginal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_t1 | numeric | 2449.322 | 6528.600 |
right temporalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_t1 | numeric | 447.7714 | 1551.2006 |
right transversetemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_t1 | numeric | 195.1165 | 640.1835 |
right unknown volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_t1 | numeric | 390.8891 | 898.6174 |
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_t1 | numeric | 0 | Infinity |
frontal composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_t1 | numeric | 32984.59 | 99604.15 |
global grey matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_t1 | numeric | 392434.3 | 856851.3 |
Calculation of volume in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_t1 | Sum | character |
left accumbens area volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_t1 | numeric | 171.4932 | 455.2841 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_t1 | numeric | 11703.66 | 26784.82 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_t1 | numeric | 22959.13 | 50889.86 |
left amygdala volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_t1 | numeric | 674.8920 | 1528.8986 |
left caudate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_t1 | numeric | 681.5374 | 2800.1295 |
left cerebellum cortex volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_t1 | numeric | 21294.26 | 46504.46 |
left cerebellum white matter volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_t1 | numeric | 2452.852 | 5457.847 |
left choroid plexus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_t1 | numeric | 370.9564 | 1008.8381 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_t1 | numeric | 16820.46 | 50012.90 |
left hippocampus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_t1 | numeric | 1619.501 | 3971.869 |
left inf lat vent volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_t1 | numeric | 76.63140 | 196.22081 |
left lateral ventricle volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_t1 | numeric | 730.7516 | 2672.3250 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_t1 | numeric | 3246.308 | 7462.753 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_t1 | numeric | 12139.49 | 30404.09 |
left pallidum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_t1 | numeric | 251.9812 | 648.1620 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_t1 | numeric | 13044.83 | 32757.48 |
left putamen volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_t1 | numeric | 1733.197 | 4520.745 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_t1 | numeric | 22068.10 | 48869.71 |
left thalamus proper volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_t1 | numeric | 938.2703 | 3209.0479 |
left unsegmented white matter volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_t1 | numeric | 1872.032 | 4423.477 |
left ventral dc volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_t1 | numeric | 555.1470 | 1299.3446 |
left vessel volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_t1 | numeric | 21.20438 | 43.95735 |
medial temporal composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_t1 | numeric | 6203.739 | 13669.806 |
occipital composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_t1 | numeric | 12139.49 | 30404.09 |
optic chiasm volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_t1 | numeric | 52.17514 | 147.22931 |
parietal composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_t1 | numeric | 25199.84 | 66543.02 |
right accumbens area volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_t1 | numeric | 160.9261 | 351.3071 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_t1 | numeric | 10813.95 | 26332.34 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_t1 | numeric | 22169.09 | 50360.08 |
right amygdala volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_t1 | numeric | 623.8148 | 1554.8456 |
right caudate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_t1 | numeric | 741.2141 | 3147.8220 |
right cerebellum cortex volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_t1 | numeric | 23486.73 | 51290.55 |
right cerebellum white matter volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_t1 | numeric | 2499.238 | 5578.267 |
right choroid plexus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_t1 | numeric | 473.5598 | 1186.7445 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_t1 | numeric | 16164.13 | 49591.25 |
right hippocampus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_t1 | numeric | 1473.147 | 3630.116 |
right inf lat vent volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_t1 | numeric | 68.66404 | 198.80032 |
right lateral ventricle volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_t1 | numeric | 687.0589 | 2542.0365 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_t1 | numeric | 2737.324 | 6539.765 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_t1 | numeric | 6091.271 | 15470.720 |
right pallidum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_t1 | numeric | 178.3897 | 526.6485 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_t1 | numeric | 14849.48 | 39671.10 |
right putamen volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_t1 | numeric | 1310.205 | 4115.542 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_t1 | numeric | 19470.07 | 46584.54 |
right thalamus proper volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_t1 | numeric | 1113.429 | 3513.139 |
right unsegmented white matter volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_t1 | numeric | 2050.137 | 4765.095 |
right ventral dc volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_t1 | numeric | 508.9736 | 1175.4990 |
right vessel volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_t1 | numeric | 11.30149 | 24.77098 |
temporal composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_t1 | numeric | 43460.43 | 95160.62 |
global total intracranial volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_t1 | numeric | 1111535 | 2100666 |
white matter hypointensities volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_t1 | numeric | 22.00510 | 62.42434 |
white matter left bankssts volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_t1 | numeric | 514.3770 | 1489.5563 |
white matter left caudalanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_t1 | numeric | 301.9029 | 932.9006 |
white matter left caudalmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_t1 | numeric | 1169.448 | 3039.140 |
white matter left cuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_t1 | numeric | 584.7323 | 1807.2450 |
white matter left entorhinal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_t1 | numeric | 321.0739 | 815.6160 |
white matter left frontalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_t1 | numeric | 45.66004 | 181.36001 |
white matter left fusiform volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_t1 | numeric | 1426.052 | 3252.221 |
white matter left inferiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_t1 | numeric | 1880.196 | 5181.536 |
white matter left inferiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_t1 | numeric | 1445.421 | 3652.155 |
white matter left insula volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_t1 | numeric | 1781.180 | 3848.816 |
white matter left isthmuscingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_t1 | numeric | 523.0271 | 1203.9604 |
white matter left lateraloccipital volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_t1 | numeric | 1842.682 | 6814.733 |
white matter left lateralorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_t1 | numeric | 1398.576 | 3383.505 |
white matter left lingual volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_t1 | numeric | 1471.831 | 3534.334 |
white matter left medialorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_t1 | numeric | 867.2839 | 2063.9880 |
white matter left middletemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_t1 | numeric | 1518.544 | 3865.894 |
white matter left paracentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_t1 | numeric | 566.8447 | 1589.8309 |
white matter left parahippocampal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_t1 | numeric | 559.4839 | 1152.9405 |
white matter left parsopercularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_t1 | numeric | 661.2806 | 1822.1726 |
white matter left parsorbitalis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_t1 | numeric | 179.3100 | 523.7257 |
white matter left parstriangularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_t1 | numeric | 549.5175 | 1375.2146 |
white matter left pericalcarine volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_t1 | numeric | 750.6405 | 2278.0744 |
white matter left postcentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_t1 | numeric | 1397.483 | 3877.875 |
white matter left posteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_t1 | numeric | 356.2819 | 1622.0857 |
white matter left precentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_t1 | numeric | 1940.639 | 5455.114 |
white matter left precuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_t1 | numeric | 1466.360 | 4179.870 |
white matter left rostralanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_t1 | numeric | 343.4164 | 909.4714 |
white matter left rostralmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_t1 | numeric | 1973.896 | 6114.488 |
white matter left superiorfrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_t1 | numeric | 2503.062 | 7051.658 |
white matter left superiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_t1 | numeric | 2463.278 | 6232.714 |
white matter left superiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_t1 | numeric | 1609.629 | 3944.734 |
white matter left supramarginal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_t1 | numeric | 1705.131 | 4414.534 |
white matter left temporalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_t1 | numeric | 123.0852 | 426.7991 |
white matter left transversetemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_t1 | numeric | 107.8967 | 413.6062 |
white matter right bankssts volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_t1 | numeric | 518.3122 | 1529.5534 |
white matter right caudalanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_t1 | numeric | 276.6494 | 1114.5128 |
white matter right caudalmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_t1 | numeric | 870.5610 | 2282.9040 |
white matter right cuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_t1 | numeric | 637.2675 | 1891.9507 |
white matter right entorhinal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_t1 | numeric | 191.1708 | 572.5924 |
white matter right frontalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_t1 | numeric | 45.66105 | 174.22965 |
white matter right fusiform volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_t1 | numeric | 1427.774 | 3079.704 |
white matter right inferiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_t1 | numeric | 2051.595 | 5968.417 |
white matter right inferiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_t1 | numeric | 1184.652 | 3230.675 |
white matter right insula volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_t1 | numeric | 1900.375 | 4279.061 |
white matter right isthmuscingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_t1 | numeric | 528.3967 | 1200.6360 |
white matter right lateraloccipital volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_t1 | numeric | 2180.425 | 7067.385 |
white matter right lateralorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_t1 | numeric | 1317.728 | 2926.631 |
white matter right lingual volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_t1 | numeric | 1691.418 | 3600.787 |
white matter right medialorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_t1 | numeric | 652.0399 | 1821.0859 |
white matter right middletemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_t1 | numeric | 1290.445 | 3732.379 |
white matter right paracentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_t1 | numeric | 627.1931 | 1870.8637 |
white matter right parahippocampal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_t1 | numeric | 580.7025 | 1193.0557 |
white matter right parsopercularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_t1 | numeric | 518.9602 | 1535.8073 |
white matter right parsorbitalis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_t1 | numeric | 155.8251 | 535.3796 |
white matter right parstriangularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_t1 | numeric | 655.9312 | 1775.9621 |
white matter right pericalcarine volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_t1 | numeric | 803.6989 | 2418.4778 |
white matter right postcentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_t1 | numeric | 1159.360 | 3324.740 |
white matter right posteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_t1 | numeric | 329.6761 | 1811.8991 |
white matter right precentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_t1 | numeric | 1947.928 | 5364.360 |
white matter right precuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_t1 | numeric | 1439.340 | 4578.356 |
white matter right rostralanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_t1 | numeric | 318.4923 | 936.7650 |
white matter right rostralmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_t1 | numeric | 1887.391 | 5851.778 |
white matter right superiorfrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_t1 | numeric | 2549.927 | 7268.467 |
white matter right superiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_t1 | numeric | 1839.669 | 5294.092 |
white matter right superiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_t1 | numeric | 1474.021 | 3681.787 |
white matter right supramarginal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_t1 | numeric | 1363.858 | 3526.571 |
white matter right temporalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_t1 | numeric | 114.4712 | 361.0845 |
white matter right transversetemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_t1 | numeric | 83.11241 | 270.02936 |
global white matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_t1 | numeric | 271997.7 | 676189.9 |
3rd ventricle volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_t1 | numeric | 253.7916 | 738.8449 |
4th ventricle volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_t1 | numeric | 431.9561 | 1150.9627 |
White matter hyperintensities (WMH) are lesions in the brain that are likely the result of demyelination and axonal loss due to cerebral small vessel disease. These hyperintense areas are predominantly seen near the ventricles or in subcortical white matter areas and are quantified through segmentation from FLAIR MR images. While the exact underlying cause of WMH is not yet fully understood, age is an important risk factor as WMH becomes more prevalent and severe with older age. There has also been evidence to suggest that WMH play a role in cognitive decline and risk of dementia.
Kim, K. W., MacFall, J. R., & Payne, M. E. (2008). Classification of white matter lesions on magnetic resonance imaging in elderly persons. Biological Psychiatry, 64(4), 273–280. https://doi.org/10.1016/j.biopsych.2008.03.024
Prins, N. D., & Scheltens, P. (2015). White matter hyperintensities, cognitive impairment and dementia: An update. Nature Reviews Neurology, 11(3), 157–165. https://doi.org/10.1038/nrneurol.2015.10
global CSF volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_wmh | numeric | 158716.4 | 1199485.8 |
Days between scans for each PIDN
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| delta_t.imaging_wmh | 0 | numeric |
| Variable Name | Type |
|---|---|
| FLAIR.imaging_wmh | numeric |
global grey matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_wmh | numeric | 354034.9 | 846619.1 |
Calculation of volume in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_wmh | Sum | character |
| Variable Name | Type |
|---|---|
| log_wmh_mm3_prisma.imaging_wmh | numeric |
| Variable Name | Type |
|---|---|
| log_wmh_mm3_trio.imaging_wmh | numeric |
| Variable Name | Type |
|---|---|
| mci_dataset.imaging_wmh | numeric |
| Variable Name | Type |
|---|---|
| new.imaging_wmh | numeric |
| Variable Name | Type |
|---|---|
| old.imaging_wmh | numeric |
Suject Source ID
| Variable Name | Type |
|---|---|
| source_id.imaging_wmh | character |
global total intracranial volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_wmh | numeric | 1105908 | 2200421 |
global white matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_wmh | numeric | 265428.6 | 667508.4 |
WMH volume (mm3) for Prisma Scanner
| Variable Name | Type |
|---|---|
| wmh_mm3_prisma.imaging_wmh | numeric |
WMH volume (mm3) for Trio Scanner
| Variable Name | Type |
|---|---|
| wmh_mm3_trio.imaging_wmh | numeric |
WMH volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wmh.imaging_wmh | numeric | 13.4783 | 236932.4043 |
| Variable Name | Type |
|---|---|
| WMH.imaging_wmh | numeric |
Info Processing Speed is a computerized battery of 10 binary choice reaction time tasks that rely upon non-verbal visuospatial cues, developed at the UCSF Memory and Aging Center and designed to measure cognitive processing speed. Tasks include abstract matching, mental rotation, visual search, distance judgement, length judgement, shape judgement, and semantic language tasks.
Z-score for Animal task: non-animal word performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animnoz.infoprocessingspeed | numeric | 0.000 | 37.209 |
Z-score for Animal task: animal word performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animyesz.infoprocessingspeed | numeric | 0.000 | 343.560 |
Z-score for Animal task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animz.infoprocessingspeed | numeric | 0.003 | 29.369 |
Z-score for Dot task (distance judgement) performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dotz.infoprocessingspeed | numeric | 0.002 | 47.265 |
Z-score for Line task: lines differing by 10% performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| line10z.infoprocessingspeed | numeric | 0.002 | 37.900 |
Z-score for Line task: lines differing by 20% performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| line20z.infoprocessingspeed | numeric | 0.000 | 42.412 |
Z-score for Line task (length judgement) performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| linez.infoprocessingspeed | numeric | 0.001 | 37.513 |
Z-score for Abstract Matching task: matching arrays equivalent on 2 dimensions performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match1z.infoprocessingspeed | numeric | 0.003 | 39.640 |
Z-score for Abstract Matching 2 task: matching arrays equivalent on 3 dimensions performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match21z.infoprocessingspeed | numeric | 0.002 | 15.185 |
Z-score for Abstract Matching 2 task: matching arrays equivalent on 2 dimensions performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match22z.infoprocessingspeed | numeric | 0.002 | 12.496 |
Z-score for Abstract Matching 2 task: matching arrays equivalent on 1 dimension performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match23z.infoprocessingspeed | numeric | 0.005 | 19.285 |
Z-score for Abstract Matching task: matching arrays equivalent on 1 dimension performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match2z.infoprocessingspeed | numeric | 0.002 | 12.881 |
Z-score for Pronounce task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pronz.infoprocessingspeed | numeric | 0.001 | 18.053 |
Z-score for Rhyme task: non-rhyming word pair performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rhymenoz.infoprocessingspeed | numeric | 0.001 | 19.395 |
Z-score for Rhyme task: rhyming word pair performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rhymeyesz.infoprocessingspeed | numeric | 0.003 | 20.130 |
Z-score for Rhyme task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rhymez.infoprocessingspeed | numeric | 0.000 | 19.763 |
Z-score for Rotation task: 120° mental rotation performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rotate120z.infoprocessingspeed | numeric | 0.023 | -0.569 |
Z-score for Rotation task: 60° mental rotation performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rotate60z.infoprocessingspeed | numeric | 0.026 | -0.717 |
Z-score for Rotation task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rotatez.infoprocessingspeed | numeric | 0.023 | -0.510 |
Z-score for Search task: 16 object array without target performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| search16nz.infoprocessingspeed | numeric | 0.001 | 21.526 |
Z-score for Search task: 16 object array with target performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| search16yz.infoprocessingspeed | numeric | 0.024 | 41.002 |
Z-score for Search task: 24 object array without target performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| search24nz.infoprocessingspeed | numeric | 0.011 | 18.071 |
Z-score for Search task: 24 object array with target performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| search24yz.infoprocessingspeed | numeric | 0.008 | 51.355 |
Z-score for Search task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| searchz.infoprocessingspeed | numeric | 0.038 | 30.126 |
Z-score for Shape task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shapez.infoprocessingspeed | numeric | 0.112 | 52.837 |
Z-score for performance on Spacial tasks
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| spatial.infoprocessingspeed | numeric | 0.003 | 15.904 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| task.infoprocessingspeed | AgingCog_RXNTestsPart1, AgingCog_RXNTestsPart2 | character |
Z-score for performance on Verbal tasks
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| verbal.infoprocessingspeed | numeric | 0.000 | 22.346 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.infoprocessingspeed | 1.0.1 | character |
Z-score for Word task: non-real English word performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wordnoz.infoprocessingspeed | numeric | 0.008 | 26.391 |
Z-score for Word task: real English word performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wordyesz.infoprocessingspeed | numeric | 0.003 | 25.787 |
Z-score for Word task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wordz.infoprocessingspeed | numeric | 0.002 | 26.089 |
7-item questionnaire asks respondents to rate the nature and symptoms of their sleep problems (the severity of symptoms, the respondent’s satisfaction with his or her sleep patterns, the degree to which insomnia interferes with daily functioning, how noticeable the respondent feels his or her insomnia is to others, and the overall level of distress)
level of insomnia by category - total score of 0–7 indicates “no clinically signifi cant insomnia,” 8–14 means “subthreshold insomnia,” 15–21 is “clinical insomnia (moderate severity),” and 22–28 means “clinical insomnia (severe).”
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ISIdx.insomnia_severity_index | clinical insomnia (moderate), no clinical insomnia, subthreshold insomnia | character |
level of insomnia by total score - total score of 0–7 indicates “no clinically signifi cant insomnia,” 8–14 means “subthreshold insomnia,” 15–21 is “clinical insomnia (moderate severity),” and 22–28 means “clinical insomnia (severe).”
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ISItotal.insomnia_severity_index | numeric | 0 | 21 |
Plasma biomarker assays performed in collaboration with Janssen. P-tau217 was measured using an in-house SiMOA assay developed by Janssen. GFAP and NfL were measured using the Quanterix SiMOA Neurology 2‐Plex B kit.
Saloner, R., VandeVrede, L., Asken, B. M., Paolillo, E. W., Gontrum, E. Q., Wolf, A., Lario-Lago, A., Milà-Alomà, M., Triana-Baltzer, G., Kolb, H. C., Dubal, D. B., Rabinovici, G. D., Miller, B. L., Boxer, A. L., Casaletto, K. B., & Kramer, J. H. (2024). Plasma phosphorylated tau-217 exhibits sex-specific prognostication of cognitive decline and brain atrophy in cognitively unimpaired adults. Alzheimer’s & dementia : the journal of the Alzheimer’s Association, 20(1), 376–387. https://doi.org/10.1002/alz.13454
Triana-Baltzer, G., Moughadam, S., Slemmon, R., Van Kolen, K., Theunis, C., Mercken, M., & Kolb, H. C. (2021). Development and validation of a high-sensitivity assay for measuring p217+tau in plasma. Alzheimer’s & dementia (Amsterdam, Netherlands), 13(1), e12204. https://doi.org/10.1002/dad2.12204
Glial fibrillary acidic protein (GFAP) coefficient of variation (cv)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cv_janssen.janssen | numeric | 0 | 18.871068623 |
GFAP concentration (pg/ml)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_janssen.janssen | numeric | 0 | 1121.44195 |
Neurofilament light chain (nfl) coefficient of variation (cv)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cv_janssen.janssen | numeric | 0 | 17.66269943 |
Nfl concentration (pg/ml)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_janssen.janssen | numeric | 0 | 116.103074 |
Phosphorylated tau-217 (P-tau217) coefficient of variation (cv)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau217_cv_janssen.janssen | numeric | 0 | 44.73198027 |
P-tau217 concentration (pg/ml)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau217_janssen.janssen | numeric | 0 | 0.54509011 |
The MAAS is a 15-item scale designed to assess a core characteristic of dispositional mindfulness, namely, open or receptive awareness of and attention to what is taking place in the present.
MAAS score: mean mindfulness score of 15 item scale
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| maas_mindfulnessscore.maas_mindfulness | numeric | 1 | 6.00 |
total score of 15 mindfullnesss items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| maas_mindfulnesstot.maas_mindfulness | numeric | 15 | 90 |
Clinician-assessed medical conditions from Form D2 UDS version 3
Besser, L., Kukull, W., Knopman, D. S., Chui, H., Galasko, D., Weintraub, S., … & Neuropsychology Work Group. (2018). Version 3 of the national Alzheimer’s coordinating center’s uniform data set. Alzheimer Disease & Associated Disorders, 32(4), 351-358.
https://naccdata.org/data-collection/forms-documentation/uds-3
Atrial fibrillation
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| afibrill.med_conditions | 0, 1 | numeric | no, yes |
Angina
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| angina.med_conditions | 0, 1 | numeric | no, yes |
Carotid procedure: angioplasty, endarterectomy, or stent
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| angiocp.med_conditions | 0, 1 | numeric | no, yes |
Percutaneous coronary intervention: angioplasty and/or stent
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| angiopci.med_conditions | 0, 1 | numeric | no, yes |
Antibody-mediated encephalopathy
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| antienc.med_conditions | 0, 1 | numeric | no, yes |
Antibody-mediated encephalopathy, specify
| Variable Name | Type |
|---|---|
| antiencx.med_conditions | character |
Arthritis
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| arth.med_conditions | 0, 1 | numeric | no, yes |
Arthritis region affected — lower extremity
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artloex.med_conditions | 0, 1 | numeric | no, yes |
Arthritis region affected — spine
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artspin.med_conditions | 0, 1 | numeric | no, yes |
Arthritis region affected — unknown
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artunkn.med_conditions | 0, 1 | numeric | no, yes |
Arthritis region affected — upper extremity
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artupex.med_conditions | 0, 1 | numeric | no, yes |
Arthritis type
| Label | Value |
|---|---|
| 1 | Rheumatoid |
| 2 | Osteoarthritis |
| 3 | Other |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artype.med_conditions | 1, 2, 3 | numeric | Rheumatoid, Osteoarthritis, Other |
Other arthritis type specification
| Variable Name | Type |
|---|---|
| artypex.med_conditions | character |
Incontinence — bowel
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| bowlinc.med_conditions | 0, 1 | numeric | no, yes |
Cancer (excluding non-melanoma skin cancer), primary or metastatic
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| cancer.med_conditions | 0, 1, 2 | numeric | no, yes, primary/non-metastatic, yes, metastatic |
Cancer primary site specification
| Variable Name | Type |
|---|---|
| cancsite.med_conditions | character |
Congestive Heart Failure
| Label | Value |
|---|---|
| 0 | absent |
| 1 | recent/active |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| conghrt.med_conditions | 0, 1 | numeric | absent, recent/active |
Diabetes
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes type 1 |
| 2 | yes type 2 |
| 3 | yes other type |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| diabet.med_conditions | 0, 1, 2, 3 | numeric | no, yes type 1, yes type 2, yes other type |
Form Type
| Label | Value |
|---|---|
| 3.0 | form version 3.0 |
| 3.2 | form version 3.2 |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| form_ver.med_conditions | 3.0, 3.2 | numeric | form version 3.0, form version 3.2 |
heart valve replacement or repair
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hvalve.med_conditions | 0, 1 | numeric | no, yes |
Hypercholesterolemia
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hypchol.med_conditions | 0, 1 | numeric | no, yes |
Hypertension
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hypert.med_conditions | 0, 1 | numeric | no, yes |
Hyposomnia/insomnia
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hyposom.med_conditions | 0, 1 | numeric | no, yes |
Myocardial infarct
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| myoinf.med_conditions | 0, 1 | numeric | no, yes |
Other medical conditions or procedures not listed above
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| othcond.med_conditions | 0, 1 | numeric | no, yes |
Other medical conditions specification
| Variable Name | Type |
|---|---|
| othcondx.med_conditions | character |
Pacemaker and/or defrbillator
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| pacemake.med_conditions | 0, 1 | numeric | no, yes |
REM sleep behavior disorder (RBD)
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| remdis.med_conditions | 0, 1 | numeric | no, yes |
Sleep apnea
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| sleepap.med_conditions | 0, 1 | numeric | no, yes |
other sleep disorder
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| sleepoth.med_conditions | 0, 1 | numeric | no, yes |
Other sleep disorder specification
| Variable Name | Type |
|---|---|
| sleepotx.med_conditions | character |
Thyroid disease
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| thydis.med_conditions | 0, 1 | numeric | no, yes |
Incontinence — urinary
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| urineinc.med_conditions | 0, 1 | numeric | no, yes |
B12 deficiency
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| vb12def.med_conditions | 0, 1 | numeric | no, yes |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_bfgf_clncv.mesoscale | numeric | 0.570 | 796.740 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_bfgf_cv.mesoscale | numeric | 0.008 | 30.700 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_bfgf.mesoscale | numeric | 0.570 | 796.740 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_flt_1_clncv.mesoscale | numeric | 9.112 | 163.670 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_flt_1_cv.mesoscale | numeric | 0.000 | 20.927 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_flt_1.mesoscale | numeric | 9.112 | 163.670 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_plgf_clncv.mesoscale | numeric | 3.840 | 19.186 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_plgf_cv.mesoscale | numeric | 0.000 | 17.266 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_plgf.mesoscale | numeric | 3.840 | 19.186 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_tie_2_clncv.mesoscale | numeric | 193.982 | 14804.620 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_tie_2_cv.mesoscale | numeric | 0.007 | 100.440 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_tie_2.mesoscale | numeric | 193.982 | 14804.620 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_c_clncv.mesoscale | numeric | 25.280 | 2032.100 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_c_cv.mesoscale | numeric | 0.000 | 98.730 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_c.mesoscale | numeric | 24.038 | 2032.100 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_clncv.mesoscale | numeric | 25.420 | 864.460 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_cv.mesoscale | numeric | 0.000 | 19.200 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_d_clncv.mesoscale | numeric | 45.690 | 2271.960 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_d_cv.mesoscale | numeric | 0.010 | 41.370 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_d.mesoscale | numeric | 45.690 | 2271.960 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf.mesoscale | numeric | 25.420 | 864.460 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_3_clncv.mesoscale | numeric | 0.7896232 | 3316.2327580 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_3_cv.mesoscale | numeric | 0.0000000 | 136.6200000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_3.mesoscale | numeric | 0.7896232 | 3316.2327580 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_clncv.mesoscale | numeric | 35.25931 | 2201.45200 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_cv.mesoscale | numeric | 0.000000000 | 49.815000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin.mesoscale | numeric | 35.25931 | 2201.45200 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_ip_10_clncv.mesoscale | numeric | 0.0000 | 14793.9526 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_ip_10_cv.mesoscale | numeric | 0.000000e+00 | 9.995000e+00 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_ip_10.mesoscale | numeric | 0.0000 | 14793.9526 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_1_clncv.mesoscale | numeric | 16.09000 | 333.35351 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_1_cv.mesoscale | numeric | 0.006000000 | 85.540000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_1.mesoscale | numeric | 16.09000 | 333.35351 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_4_clncv.mesoscale | numeric | 11.40600 | 1734.23700 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_4_cv.mesoscale | numeric | 0.000000000 | 68.910000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_4.mesoscale | numeric | 11.40600 | 1734.23700 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mdc_clncv.mesoscale | numeric | 217.3490 | 23498.9500 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mdc_cv.mesoscale | numeric | 0.01045173 | 77.05000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mdc.mesoscale | numeric | 217.3490 | 23498.9500 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1alpha_clncv.mesoscale | numeric | 3.513518 | 746.952854 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1alpha_cv.mesoscale | numeric | 0.0000000 | 123.0300000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1alpha.mesoscale | numeric | 1.581820 | 746.952854 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1beta_clncv.mesoscale | numeric | 13.62669 | 523.93000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1beta_cv.mesoscale | numeric | 0.003557655 | 56.700000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1beta.mesoscale | numeric | 13.62669 | 523.93000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_tarc_clncv.mesoscale | numeric | 8.859382 | 3710.250000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_tarc_cv.mesoscale | numeric | 0.00000000 | 73.88000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_tarc.mesoscale | numeric | 6.972760 | 3710.250000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_ifn_gamma_clncv.mesoscale | numeric | 0.4066359 | 749.5975302 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_ifn_gamma_cv.mesoscale | numeric | 0.00000000 | 67.13834315 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_ifn_gamma.mesoscale | numeric | 0.3210666 | 749.5975302 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_10_clncv.mesoscale | numeric | 0.06847087 | 16.84495125 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_10_cv.mesoscale | numeric | 0.00000000 | 103.38000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_10.mesoscale | numeric | 0.03740846 | 16.84495125 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_12p70_clncv.mesoscale | numeric | 0.008135177 | 6.021390238 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_12p70_cv.mesoscale | numeric | 0.0000000 | 140.5465313 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_12p70.mesoscale | numeric | 0.001958770 | 6.021390238 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_13_clncv.mesoscale | numeric | 0.1281520 | 8.1599861 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_13_cv.mesoscale | numeric | 0.0000000 | 134.2184627 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_13.mesoscale | numeric | 0.07670215 | 8.15998614 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_1beta_clncv.mesoscale | numeric | 0.004834041 | 1.790074301 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_1beta_cv.mesoscale | numeric | 0.4354365 | 131.4346251 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_1beta.mesoscale | numeric | 0.004184987 | 14.539722000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_2_clncv.mesoscale | numeric | 0.00006890 | 113.89536090 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_2_cv.mesoscale | numeric | 0.0000000 | 135.4783285 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_2.mesoscale | numeric | 1.006149e-01 | 9.949623e-02 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_4_clncv.mesoscale | numeric | 0.001259597 | 1.529505746 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_4_cv.mesoscale | numeric | 0.0000000 | 139.4589891 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_4.mesoscale | numeric | 0.000172982 | 1.529505746 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_6_clncv.mesoscale | numeric | 0.1150000 | 62.0100000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_6_cv.mesoscale | numeric | 0.00000000 | 80.38000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_6.mesoscale | numeric | 0.0500000 | 62.0100000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_8_clncv.mesoscale | numeric | 1.262448 | 3541.786927 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_8_cv.mesoscale | numeric | 0.0000000 | 140.9614505 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_8.mesoscale | numeric | 1.262448 | 3677.231791 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_tnf_alph_clncv.mesoscale | numeric | 0.7900000 | 35.1600000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_tnf_alph_cv.mesoscale | numeric | 0.00000000 | 17.89000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_tnf_alph.mesoscale | numeric | 0.7900000 | 35.1600000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| il_8_p_clncv.mesoscale | numeric | 1.439664 | 660.294828 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| il_8_p_cv.mesoscale | numeric | 0.00000000 | 67.36930440 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| il_8_p.mesoscale | numeric | 1.439664 | 660.294828 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| meso_plate.mesoscale | numeric | 1 | 34 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_gm_csf.mesoscale | numeric | 0.006118335 | 0.791806968 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_1.mesoscale | numeric | 0.2552253 | 101.0278045 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_12p40.mesoscale | numeric | 24.50345 | 1184.51537 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_15.mesoscale | numeric | 0.9717009 | 7.0070758 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_16.mesoscale | numeric | 20.81769 | 1470.61875 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_17.mesoscale | numeric | 0.2712118 | 13.3502784 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_5.mesoscale | numeric | 0.1482988 | 2.9899785 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_7.mesoscale | numeric | 0.8170460 | 28.3601503 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_tnf.mesoscale | numeric | 0.03474753 | 1.03086943 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_vegf.mesoscale | numeric | 18.37737 | 443.96111 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_crp_clncv.mesoscale | numeric | 71604.29 | 84889271.68 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_crp_cv.mesoscale | numeric | 0.00000000 | 62.26000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_crp.mesoscale | numeric | 71604.29 | 92167127.44 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_icam_1_clncv.mesoscale | numeric | 212627.0 | 2078658.3 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_icam_1_cv.mesoscale | numeric | 0.0150000 | 58.3300000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_icam_1.mesoscale | numeric | 212627.0 | 2078658.3 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_saa_clncv.mesoscale | numeric | 162223.6 | 304395515.3 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_saa_cv.mesoscale | numeric | 0.000000000 | 65.170000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_saa.mesoscale | numeric | 162223.6 | 304395515.3 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_vcam_1_clncv.mesoscale | numeric | 199334.6 | 2739272.1 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_vcam_1_cv.mesoscale | numeric | 0.00000000 | 62.78000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_vcam_1.mesoscale | numeric | 199334.6 | 2739272.1 |
The NPI-Q is based on a study partner interview in which a series of questions are read about 12 behaviors. After each behavior, the study partner responds yes or no. If the study partner responds yes, then they are asked to rate the behavior as mild, moderate, or severe.
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| abandon.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| affair.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| ag_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ag_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ag_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ag_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| ag_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| agitate.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anger.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| anx_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anx_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anx_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anx_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| anx_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anxiety.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apathy.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| appetite.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| apth_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apth_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apth_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apth_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| apth_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| avoid.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| awaken.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behavior.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| burden.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| change.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| chores.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| claim.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| clothing.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| convrs.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| coping.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cranky.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| crude.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| curse.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| day.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| death.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| del_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| del_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| del_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| del_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| del_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| delusn.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| dep_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dep_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dep_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dep_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| dep_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| difficult.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| dis_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dis_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dis_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dis_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| dis_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| disinhibition.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dngr.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dprssn.npi | 1, 2 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dstrs_tot.npi | numeric | 0 | 46 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| early.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| eat_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eat_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eat_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eat_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| eat_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eat.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| emotion.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| enthuse.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| eup_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eup_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eup_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eup_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| eup_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| euphoria.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| failure.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fall_asleep.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fidget.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| food_type.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| food.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| friends.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| future.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| giggle.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| habits.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| hal_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hal_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hal_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hal_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| hal_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| happy.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| help.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hit.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hlcntns.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| home.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hug.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| humor.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hurt.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| impulsiv.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| increase.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| intrst.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| irr_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| irr_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| irr_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| irr_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| irr_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| irritble.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| jokes.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mood.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| mot_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mot_freq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mot_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mot_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| mot_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| motor.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nervous.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| night.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| npi_q.npi | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| openly.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pace.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pranks.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| punish.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| repetitive.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| resist.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rummage.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sad.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| see.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sighing.npi | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| sle_dis.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sle_frq.npi | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sle_sev.npi | 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| sle_totl.npi | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_oth.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| smell.npi | 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| spntns.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| start.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| steal.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| stranger.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| stubborn.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| t_vfigs.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| talk.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| taste.npi | 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tearful.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| temper.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tense.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| throw.npi | 1, 2 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total.npi | numeric | 0 | 123 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| touch.npi | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| truth.npi | 1, 2 | numeric |
Agitation or aggression in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_agit.npi | 0, 1 | categorical | No, Yes |
Agitation or aggression severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_agitsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Anxiety in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_anx.npi | 0, 1 | categorical | No, Yes |
Anxiety severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_anxsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Apathy or indifference in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_apa.npi | 0, 1 | categorical | No, Yes |
Apathy or indifference severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_apasev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Appetite and eating problems in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_app.npi | 0, 1 | categorical | No, Yes |
appetite and eating severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_appsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Delusions in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_del.npi | 0, 1 | categorical | No, Yes |
Delusions severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_delsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Depression or dysphoria in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_depd.npi | 0, 1 | categorical | No, Yes |
Depression or dysphoria severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_depdsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Disinhibition in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_disn.npi | 0, 1 | categorical | No, Yes |
Disinhibition severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_disnsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Elation or euphoria in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_elat.npi | 0, 1 | categorical | No, Yes |
Elation or euphoria severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_elatsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Hallucinations in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_hall.npi | 0, 1 | categorical | No, Yes |
Hallucinations severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_hallsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Irritability or lability in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_irr.npi | 0, 1 | categorical | No, Yes |
Irritability or lability severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_irrsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Motor disturbance in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_mot.npi | 0, 1 | categorical | No, Yes |
Motor severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_motsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
Nighttime behaviors in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_nite.npi | 0, 1 | categorical | No, Yes |
Nighttime behaviors severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_nitesev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
NPI-Q co-participant
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| uds_npiqinf.npi | 1, 2, 3 | character |
NPI-Q co-participant, other specify
| Variable Name | Type |
|---|---|
| uds_npiqinfx.npi | character |
The Ohio State University (OSU) Traumatic Brain Injury (TBI) Identification Method (OSU TBI-ID) is a standardized procedure for eliciting a person’s lifetime history of TBI via a 3-5 minute structured interview.
Bogner, J.A., Corrigan, J.D. (2009). Reliability and validity of the OSU TBI Identification Method with Prisoners. Journal of Head Trauma Rehabilitation, 24(6), 279-291
Corrigan, J.D., Bogner, J.A. (2007). Initial reliability and validity of the OSU TBI Identification Method. Journal of Head Trauma Rehabilitation, 22(6), 318-329.
Worst? has there been one moderate or severe TBI (i.e., any TBI with 30 minutes or more loss of consciousness)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| osu_any_modsev_tbi.osu_tbi | 0, 1 | categorical |
??
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| osu_tbi_locpta_total.osu_tbi | 0, 1, 2, 3 | numeric |
Age of first TBI
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| osu_tbi1_locpta_age.osu_tbi | numeric | 1 | 76 |
Age of second TBI
| Variable Name | Type |
|---|---|
| osu_tbi2_locpta_age.osu_tbi | numeric |
TBI
| Variable Name | Type |
|---|---|
| osu_tbi3_locpta_age.osu_tbi | numeric |
??
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| osu_tbi7_locpta_age.osu_tbi | 52 | numeric |
Mnemonic similarity task: During incidental encoding, participants viewed pictures of 80 common objects. In order to enhance encoding/attention, they were asked to judge whether the objects were most commonly found indoors or outdoors. Immediately following encoding, they were shown 40 of the studied objects, 40 novel foil objects, and 40 lure objects that were similar but not identical to studied objects. Participants were asked to classify items as “old,” “similar” or “new.” The critical metric of pattern separation is the ability to discriminate similar lure items from old items.
Stark, S. M., Yassa, M. A., Lacy, J. W., & Stark, C. E. (2013). A task to assess behavioral pattern separation (BPS) in humans: Data from healthy aging and mild cognitive impairment. Neuropsychologia, 51(12), 2442–2449. https://doi.org/10.1016/j.neuropsychologia.2012.12.014.
Memel, M., Staffaroni, A. M., Cobigo, Y., Casaletto, K. B., Fonseca, C., Bettcher, B. M., … & Kramer, J. H. (2021). APOE moderates the effect of hippocampal blood flow on memory pattern separation in clinically normal older adults. Hippocampus, 31(8), 845-857.
Lure Discrimination Index: the difference between the probability of giving a “similar” response to lure items and the probability of giving a “similar” response to a new item
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| LDI.patternseparation | numeric | 0 | 120 |
Number of foil tems classified as “similar”
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| p_sep_sim_foil.patternseparation | numeric | 0 | 120 |
Number of lure items classified as “similar”
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| p_sep_sim_lure.patternseparation | numeric | 0 | 120 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PET_status_inferred.pet | DISCREPANT, NEGATIVE, POSITIVE | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PET_suvr_threshold_positive.pet | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PET_suvr_threshold.pet | 1.08, 1.11, 1.21 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| PETcentiloids.pet | numeric | 0.018685720 | 148.305259700 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PETcompound.pet | AV45, FBB, PIB | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PETlocation.pet | CB, LBL, SFVA | character |
| Variable Name | Type |
|---|---|
| PETnotes.pet | character |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| PETsuvr.pet | numeric | 0.8470289 | 2.4323309 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PETvisit.pet | Amyloid PET CB, AV45 PET, LBL PET, PIB | character |
Physical measurements and vital signs are collected during the neurological exam at each research visit.
Diastolic blood pressure of participant; minimum blood pressure detected just prior to the next contraction
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bpdias.physical | numeric | 30 | 170 |
Systolic blood pressure of participant; maximum blood pressure detected during contraction of the ventricles
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bpsys.physical | numeric | 86 | 220 |
Height of the participant measured in inches
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| height.physical | numeric | -6.0 | 79.0 |
Resting heart rate of the participant
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hrate.physical | numeric | 19 | 120 |
Weight of the participant measured in lbs
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| weight.physical | numeric | 80 | 320 |
The Physical Activity Scale for the Elderly (PASE) is a widely validated measure of self-reported activity levels for older adults. Participants are ask to rate weekly frequency and daily duration for the following recreational activities: (1) walking; (2) light, moderate, and strenuous sports; (3) housework; (4) yardwork; and (5) strength training. Activity scores are computed by multiplying activity frequencies by the task-specific weights, according to the scoring manual. Activity scores are then summed to obtain a total score representing overall physical activity level, with higher values indicating greater activity.
PASE scores are calculated from weights and frequency values for each type of activity. Range can be from 0 to 500 or more.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pase_pase_total.physical_activity_scale | numeric | 0.00 | infinity |
The Pittsburgh Sleep Quality Index (PSQI) is a self-report questionnaire that assesses sleep quality over a 1-month time interval. Each of the questionnaire’s 19 self-reported items belongs to one of seven subcategories: subjective sleep quality, sleep latency, sleep duration, habitual sleep efficiency, sleep disturbances, use of sleeping medication, and daytime dysfunction. The 19 individual items, with 7 components, produce one global score. The PSQI takes 5–10 minutes to complete.
Total score is the sum of the 7 components
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| psqi_PSQItot.psqi | numeric | 0.0 | 21 |
Total less than or equal to 5 is associated with good sleep quality (0); Total greater than 5 associated with poor sleep quality (1)
| Label | Value |
|---|---|
| 0 | good |
| 1 | poor |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| psqi_totBinary.psqi | 0, 1 | categorical | good, poor |
The Perceived Stress Scale (PSS) measures the perception of stress. The PSS has 10-items assessing degree of life stress over the past month (e.g., how “unpredictable, uncontrollable, and overloaded” respondents find their lives). Likert scale answers range from “never” (zero points) to “very often” (four points). Score range: 0-40.
Cohen, S., Kamarck, T., & Mermelstein, R. (1983). A global measure of perceived stress. Journal of Health and Social Behavior, 24(4), 385–396. https://doi.org/10.2307/2136404
Cohen, S. and Williamson, G. (1988) Perceived stress in a probability sample of the United States. The Social Psychology of Health, 13, 31-67.
Total PSS score: sum of PSS1 – PSS10, each question max of 4 points
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| PSSTotal.pss | numeric | 0 | 40 |
Plasma biomarker assays performed in-house at UCSF MAC using the Quanterix SiMOA Neurology 4‐Plex E (amyloid-beta 40/42, NfL, GFAP), P-tau181, and total tau kits. Experiments were conducted on two non-overlapping study samples: 1) BrANCH participants, 2) Fitbit substudy participants.
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_analysis_date_branch.quanterix | 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 | Date |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_analysis_date_fitbit.quanterix | 2023-04-24, 2023-04-25, 2023-04-26 | Date |
Amyloid-beta40 concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_branch.quanterix | numeric | 0 | 249.0 |
Amyloid-beta40 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_cleaned_branch.quanterix | numeric | 0 | 249.0 |
Amyloid-beta40 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_cleaned_fitbit.quanterix | numeric | 0 | 194.0 |
Amyloid-beta40 coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_cv_branch.quanterix | numeric | 0 | 0.365 |
Amyloid-beta40 coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_cv_fitbit.quanterix | numeric | 0 | 1.139 |
Amyloid-beta40 concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_fitbit.quanterix | numeric | 0 | 194.0 |
Kit lot number BrANCH experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_kit_lot_number_branch.quanterix | 503819 | numeric |
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_kit_lot_number_fitbit.quanterix | 503420 | numeric |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_specimen_type_branch.quanterix | plasma | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_specimen_type_fitbit.quanterix | plasma | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_analysis_date_branch.quanterix | 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 | Date |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_analysis_date_fitbit.quanterix | 2023-04-24, 2023-04-25, 2023-04-26 | Date |
Amyloid-beta42 concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_branch.quanterix | numeric | 0 | 17.800 |
Amyloid-beta42 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_cleaned_branch.quanterix | numeric | 0 | 17.800 |
Amyloid-beta42 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_cleaned_fitbit.quanterix | numeric | 0 | 11.40 |
Amyloid-beta42 coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_cv_branch.quanterix | numeric | 0 | 0.335 |
Amyloid-beta42 coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_cv_fitbit.quanterix | numeric | 0 | 1.221 |
Amyloid-beta42 concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_fitbit.quanterix | numeric | 0 | 11.40 |
Kit lot number BrANCH experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_kit_lot_number_branch.quanterix | 503819 | character |
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_kit_lot_number_fitbit.quanterix | 503420 | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_specimen_type_branch.quanterix | plasma | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_specimen_type_fitbit.quanterix | plasma | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_analysis_date_branch.quanterix | 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 | Date |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_analysis_date_fitbit.quanterix | 2023-04-24, 2023-04-25, 2023-04-26 | Date |
GFAP concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_branch.quanterix | numeric | 0 | 743.0 |
GFAP concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cleaned_branch.quanterix | numeric | 0 | 743.0 |
GFAP concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cleaned_fitbit.quanterix | numeric | 0 | 682.0 |
GFAP coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cv_branch.quanterix | numeric | 0 | 0.458 |
GFAP coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cv_fitbit.quanterix | numeric | 0 | 1.031 |
GFAP concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_fitbit.quanterix | numeric | 0 | 682.0 |
Kit lot number BrANCH experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_kit_lot_number_branch.quanterix | 503819 | character |
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_kit_lot_number_fitbit.quanterix | 503420 | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_specimen_type_branch.quanterix | plasma | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_specimen_type_fitbit.quanterix | plasma | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_analysis_date_branch.quanterix | 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 | Date |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_analysis_date_fitbit.quanterix | 2023-04-24, 2023-04-25, 2023-04-26 | Date |
NfL concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_branch.quanterix | numeric | 0 | 198.00 |
NfL concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cleaned_branch.quanterix | numeric | 0 | 198.00 |
NfL concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cleaned_fitbit.quanterix | numeric | 0 | 133.00 |
NfL coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cv_branch.quanterix | numeric | 0 | 0.536 |
NfL coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cv_fitbit.quanterix | numeric | 0 | 1.126 |
NfL concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_fitbit.quanterix | numeric | 0 | 133.00 |
Kit lot number BrANCH experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_kit_lot_number_branch.quanterix | 503819 | character |
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_kit_lot_number_fitbit.quanterix | 503420 | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_specimen_type_branch.quanterix | plasma | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_specimen_type_fitbit.quanterix | plasma | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptau181_analysis_date_fitbit.quanterix | 2023-04-03, 2023-04-04, 2023-04-05 | Date |
P-tau181 concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_branch.quanterix | numeric | 0 | 15.500 |
P-tau181 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_cleaned_branch.quanterix | numeric | 0 | 7.770 |
P-tau181 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_cleaned_fitbit.quanterix | numeric | 0 | 35.800 |
P-tau181 coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_cv_branch.quanterix | numeric | 0 | 0.787 |
P-tau181 coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_cv_fitbit.quanterix | numeric | 0 | 1.134 |
P-tau181 concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_fitbit.quanterix | numeric | 0 | 35.800 |
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptau181_kit_lot_number_fitbit.quanterix | 503545 | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptau181_specimen_type_branch.quanterix | plasma | character |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptau181_specimen_type_fitbit.quanterix | plasma | character |
Total tau concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ttau_branch.quanterix | numeric | 0 | 3.270 |
Total tau concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ttau_cleaned_branch.quanterix | numeric | 0 | 3.270 |
Total tau coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ttau_cv_branch.quanterix | numeric | 0 | 0.854 |
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ttau_specimen_type_branch.quanterix | plasma | character |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| age.sdoh | numeric | 31 | 92 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sdoh_date.sdoh | POSIXct | 2022-01-02 | 2023-02-13 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sex.sdoh | Female, Male | character |
Set Shifting is an NIH-EXAMINER task in which participants match a stimulus on the top of the screen to one of two stimuli in the lower corners of the screen. The screen on each trial contains a red triangle in the bottom left corner and a blue rectangle in the bottom right corner. At the beginning of each trial, a cue that reads “shape” or “color” appears at the bottom of the screen followed by a blue triangle stimulus or a red rectangle stimulus in the top-center of the screen. The examinee is then instructed to match the stimulus presented with one of the reference objects based on the cue provided.
Computer program that NIH-EXAMINER Set Shifting is run on (E-Prime)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| platform.setshifting | E-Prime | character |
Log 10 of the mean response time of the correct shift block trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shftlog.setshifting | numeric | 2.602 | 3.431 |
Measure of reaction time after log transformations/calculations
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shftstem.setshifting | numeric | 0.002 | -0.093 |
Measure of accuracy calculated as # of correct trials / # of total trials in the shift block
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shiftacc.setshifting | numeric | 0.313 | 1.000 |
Accuracy score = shiftacc.setshifting multiplied by 5
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shiftaccscore.setshifting | numeric | 1.563 | 5.000 |
Reaction time score = 5 - (shftstem.setshifting multiplied by 5)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shiftrtscore.setshifting | numeric | 0.004 | -2.055 |
A calcuated composite score that combines accuracy and reaction time scores
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shiftscore.setshifting | numeric | 1.076 | 10.184 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sexQ_ageatlastperiod.sex_and_reproductive_health | numeric | 32.0 | 70.0 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_birthcontrol_currently_years.sex_and_reproductive_health | 34 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_birthcontrol_currently.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| sexQ_children_ageatfirstchild.sex_and_reproductive_health | character |
| Variable Name | Type |
|---|---|
| sexQ_children_ageatlastchild.sex_and_reproductive_health | character |
| Variable Name | Type |
|---|---|
| sexQ_children_number.sex_and_reproductive_health | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_everpregnant.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_facialhairgrowth.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| sexQ_fertilitytreatments_type_other.sex_and_reproductive_health | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_fertilitytreatments_type.sex_and_reproductive_health | 1, 2, 3 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_fertilitytreatments.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sexQ_firstperiodage.sex_and_reproductive_health | numeric | 9.0 | 17.0 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_gender.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_hormonalbirthcontrol_everused.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| sexQ_hormonalbirthcontrol_yearsused.sex_and_reproductive_health | character |
| Variable Name | Type |
|---|---|
| sexQ_hormonetherapy_currently_length.sex_and_reproductive_health | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_hormonetherapy_length.sex_and_reproductive_health | 1, 3, 4, 5 | numeric |
| Variable Name | Type |
|---|---|
| sexQ_hormonetherapy_why_other.sex_and_reproductive_health | character |
| Variable Name | Type |
|---|---|
| sexQ_hormonetherapy_why.sex_and_reproductive_health | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_hormonetherapy.sex_and_reproductive_health | 1, 2, 4 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sexQ_hysterectomyremoval_age.sex_and_reproductive_health | numeric | 32.0 | 77.0 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_hysterectomyremoval.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_menstrualpattern.sex_and_reproductive_health | 1, 2, 3 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sexQ_ovaryremoval_age.sex_and_reproductive_health | numeric | 21.0 | 77.0 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_ovaryremoval.sex_and_reproductive_health | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_PCOS_endometriosis_infertility.sex_and_reproductive_health | 1, 2, 3, 13, 23 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_periodregular.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| sexQ_pregnancies_firsttrimester.sex_and_reproductive_health | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_pregnancies_secondtrimester.sex_and_reproductive_health | 0, 1, 2, 10 | numeric |
| Variable Name | Type |
|---|---|
| sexQ_pregnancies_thirdtrimester.sex_and_reproductive_health | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_sex.sex_and_reproductive_health | 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_sexorientation_other.sex_and_reproductive_health | Pansexual | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_sexorientation.sex_and_reproductive_health | 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_stillmenstruating_lastmenses.sex_and_reproductive_health | 1/1/2020, 4/6/2020, 8/23/1984 | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_stillmenstruating_periodfreq.sex_and_reproductive_health | 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_stillmenstruating_regularperiods.sex_and_reproductive_health | 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_stillmenstruating.sex_and_reproductive_health | 4, 5 | numeric |
Sleep Intruments include different questionnaires that participants enrolled in the Sleep Project at UCSF asnwer during the 7 day study. These questionnaires include the Circadian Type Inventory, Functional Outcomes of Sleep Questionnaire, Morningness Evening Type, and the Sleep Preoccupation Scale.
BMI captured from the Berlin Sleep Questionnaire
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bmi.sleep_instruments | numeric | 17.00000 | 41.00000 |
Circadian type inventory - high scores = fluidity/ low scores = rigidity
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cti_fr.sleep_instruments | numeric | 5 | 21 |
Circadian type inventory - high scores = languid/ low scores = vigorous
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cti_lv.sleep_instruments | numeric | 6 | 24 |
functional outcomes of sleep: affect on activity levels
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_activity_level.sleep_instruments | numeric | 1.166667 | 4.000000 |
functional outcomes of sleep: affect on productivity levels
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_general_productivity.sleep_instruments | numeric | 1.125000 | 4.000000 |
functional outcomes of sleep: affect on sexual relationships
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_intimate_rels_sexual_activity.sleep_instruments | numeric | 0.000000 | 5.333333 |
functional outcomes of sleep total score (high score= better function, low scores = worse function)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_total.sleep_instruments | numeric | 8.646825 | 26.000000 |
functional outcomes of sleep: affect on vigilance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_vigilance.sleep_instruments | numeric | 1.000000 | 10.000000 |
morningness eveningness questionnaire total score
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| meq_morn_total.sleep_instruments | numeric | 22.00 | 81.00 |
morningness eveningness type ( 0 = neither type, 1 = morning type, 3 = evening type)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| meq_score.sleep_instruments | 0, 1, 2 | numeric |
sleep preoccupation scale - affective consequences
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sps_ac.sleep_instruments | numeric | 7 | 39 |
sleep preoccupation scale - cognitive and behavioral consequences
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sps_cbc.sleep_instruments | numeric | 14 | 62 |
sleep preoccupation scale total (high scores = more preoccupation, low scores = low preoccupation)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sps_total.sleep_instruments | numeric | 33 | 127 |
The Sleep Profiler provides detailed information on rapid eye movement, the percentage of sleep you get overall and other aspects of sleep quality.
Total time spent in sleep stages across the first night
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| actual_sleep_time_hrs_night_1.sleep_profiler | numeric | 3.541667 | 8.775000 |
Total time spent in sleep stages across the second night
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| actual_sleep_time_hrs_night_2.sleep_profiler | numeric | 3.541667 | 9.008333 |
Total time spent in sleep stages across the third night
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| actual_sleep_time_hrs_night_3.sleep_profiler | numeric | 2.975000 | 8.316667 |
Total time spent in sleep stages across the fourth night
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| actual_sleep_time_hrs_night_4.sleep_profiler | 4.066667, 6.166667, 6.291667, 6.600000, 7.516667 | numeric |
Total time spent in sleep stages across the fifth night
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| actual_sleep_time_hrs_night_5.sleep_profiler | 3.966667, 4.333333, 9.616667 | numeric |
Total time spent in sleep stages across the sixth night
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| actual_sleep_time_hrs_night_6.sleep_profiler | 6.016667 | numeric |
Invalid sleep time during night 1(not used to calculate summary variables)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| invalid_time_hrs_night_1.sleep_profiler | numeric | 0.000000000 | 3.408333000 |
Invalid sleep time during night 2(not used to calculate summary variables)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| invalid_time_hrs_night_2.sleep_profiler | numeric | 0.000000000 | 4.491667000 |
Invalid sleep time during night 3(not used to calculate summary variables)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| invalid_time_hrs_night_3.sleep_profiler | numeric | 0.000000000 | 4.666667000 |
Invalid sleep time during night 4(not used to calculate summary variables)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| invalid_time_hrs_night_4.sleep_profiler | 0.00000000, 0.03333334, 0.16666670 | numeric |
Invalid sleep time during night 5(not used to calculate summary variables)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| invalid_time_hrs_night_5.sleep_profiler | 0.000000, 2.841667 | numeric |
Invalid sleep time during night 6(not used to calculate summary variables)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| invalid_time_hrs_night_6.sleep_profiler | 0.01666667 | numeric |
Average delta power duing N1 epochs on night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_delta_night_1.sleep_profiler | numeric | 0.08240977 | 0.99258361 |
Average delta power duing N1 epochs on night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_delta_night_2.sleep_profiler | numeric | 0.09493082 | 0.66833355 |
Average delta power duing N1 epochs on night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_delta_night_3.sleep_profiler | numeric | 0.08832198 | 0.85857893 |
Average delta power duing N1 epochs on night 4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_delta_night_4.sleep_profiler | 0.1049325, 0.1298847, 0.1374232, 0.1520938, 0.1643450 | numeric |
Average delta power duing N1 epochs on night 5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_delta_night_5.sleep_profiler | 0.1550275, 0.1909848, 0.2064550 | numeric |
Average delta power duing N1 epochs on night 6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_delta_night_6.sleep_profiler | 0.1335652 | numeric |
Time spent in N1 sleep (light sleep) across the night during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_time_hrs_night_1.sleep_profiler | numeric | 0.05833333 | 0.70833330 |
Time spent in N1 sleep (light sleep) across the night during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_time_hrs_night_2.sleep_profiler | numeric | 0.05833333 | 1.20833300 |
Time spent in N1 sleep (light sleep) across the night during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_time_hrs_night_3.sleep_profiler | numeric | 0.05000000 | 1.35000000 |
Time spent in N1 sleep (light sleep) across the night during night 4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_time_hrs_night_4.sleep_profiler | 0.1583333, 0.1750000, 0.2083333, 0.5250000 | numeric |
Time spent in N1 sleep (light sleep) across the night during night 5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_time_hrs_night_5.sleep_profiler | 0.1833333, 0.1916667, 0.3750000 | numeric |
Time spent in N1 sleep (light sleep) across the night during night 6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_time_hrs_night_6.sleep_profiler | 0.1416667 | numeric |
Average delta power duing N2 epochs during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_delta_night_1.sleep_profiler | numeric | 0.1048906 | 0.8912354 |
Average delta power duing N2 epochs during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_delta_night_2.sleep_profiler | numeric | 0.1041672 | 0.3071150 |
Average delta power duing N2 epochs during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_delta_night_3.sleep_profiler | numeric | 0.1107100 | 0.9062055 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_delta_night_4.sleep_profiler | 0.1314645, 0.1476429, 0.1476847, 0.1533604, 0.3593146 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_delta_night_5.sleep_profiler | 0.1352762, 0.1682801, 0.1762796 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_delta_night_6.sleep_profiler | 0.1431319 | numeric |
Time spent in N2 sleep across the night during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_time_hrs_night_1.sleep_profiler | numeric | 1.208333 | 5.550000 |
Time spent in N2 sleep across the night during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_time_hrs_night_2.sleep_profiler | numeric | 1.166667 | 5.516667 |
Time spent in N2 sleep across the night during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_time_hrs_night_3.sleep_profiler | numeric | 0.625000 | 5.291667 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_time_hrs_night_4.sleep_profiler | 1.550000, 3.000000, 3.508333, 3.516667, 4.641667 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_time_hrs_night_5.sleep_profiler | 1.350000, 3.666667, 5.375000 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_time_hrs_night_6.sleep_profiler | 3.466667 | numeric |
Average delta power duing N3 epochs during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_delta_night_1.sleep_profiler | numeric | 0.1546968 | 0.9048144 |
Average delta power duing N3 epochs during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_delta_night_2.sleep_profiler | numeric | 0.1271705 | 0.3579841 |
Average delta power duing N3 epochs during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_delta_night_3.sleep_profiler | numeric | 0.1503306 | 0.4133622 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_delta_night_4.sleep_profiler | 0.1748096, 0.2030818, 0.2121810, 0.2125902, 0.2272466 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_delta_night_5.sleep_profiler | 0.1595341, 0.2050501, 0.2423254 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_delta_night_6.sleep_profiler | 0.1834426 | numeric |
Time spent in N3 sleep (SWS sleep) across the night during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_time_hrs_night_1.sleep_profiler | numeric | 0.000000000 | 3.025000000 |
Time spent in N3 sleep (SWS sleep) across the night during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_time_hrs_night_2.sleep_profiler | numeric | 0.00000000 | 4.21666700 |
Time spent in N3 sleep (SWS sleep) across the night during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_time_hrs_night_3.sleep_profiler | numeric | 0.000000000 | 3.500000000 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_time_hrs_night_4.sleep_profiler | 0.4583333, 0.4750000, 0.9250000, 1.4250000, 1.9583330 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_time_hrs_night_5.sleep_profiler | 0.008333334, 0.358333300, 1.200000000 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_time_hrs_night_6.sleep_profiler | 0.25 | numeric |
Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n1_night_1.sleep_profiler | numeric | 1.136364 | 20.000000 |
Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n1_night_2.sleep_profiler | numeric | 0.7667032 | 29.7741300 |
Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n1_night_3.sleep_profiler | numeric | 0.6993007 | 25.1141500 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n1_night_4.sleep_profiler | 2.328160, 3.156566, 3.378378, 3.893443, 8.344371 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n1_night_5.sleep_profiler | 3.899480, 4.423077, 4.621849 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n1_night_6.sleep_profiler | 2.354571 | numeric |
Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n2_night_1.sleep_profiler | numeric | 25.43860 | 81.27208 |
Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n2_night_2.sleep_profiler | numeric | 19.70398 | 75.33113 |
Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n2_night_3.sleep_profiler | numeric | 15.36885 | 76.76399 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n2_night_4.sleep_profiler | 38.11475, 48.64865, 53.28283, 55.76159, 61.75166 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n2_night_5.sleep_profiler | 34.03362, 55.89255, 84.61539 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n2_night_6.sleep_profiler | 57.61773 | numeric |
Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n3_night_1.sleep_profiler | numeric | 0.0000000 | 50.0000000 |
Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n3_night_2.sleep_profiler | numeric | 0.0000000 | 55.6742300 |
Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n3_night_3.sleep_profiler | numeric | 0.0000000 | 67.6229600 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n3_night_4.sleep_profiler | 6.097561, 7.549669, 14.015150, 31.756760, 35.040980 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n3_night_5.sleep_profiler | 0.1923077, 3.7261700, 30.2521000 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n3_night_6.sleep_profiler | 4.155125 | numeric |
Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_rem_night_1.sleep_profiler | numeric | 12.59398 | 39.68254 |
Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_rem_night_2.sleep_profiler | numeric | 6.361829 | 42.214530 |
Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_rem_night_3.sleep_profiler | numeric | 13.44538 | 45.89041 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_rem_night_4.sleep_profiler | 16.21622, 22.95082, 28.34437, 29.41919, 29.82261 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_rem_night_5.sleep_profiler | 10.76923, 31.09244, 36.48180 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_rem_night_6.sleep_profiler | 35.87257 | numeric |
Average delta power duing REM epochs (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_delta_night_1.sleep_profiler | numeric | 0.08191241 | 0.67787162 |
Average delta power duing REM epochs (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_delta_night_2.sleep_profiler | numeric | 0.08790630 | 0.30564024 |
Average delta power duing REM epochs (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_delta_night_3.sleep_profiler | numeric | 0.07753680 | 0.89780582 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_delta_night_4.sleep_profiler | 0.1151842, 0.1241935, 0.1433784, 0.1553233, 0.5109914 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_delta_night_5.sleep_profiler | 0.1142421, 0.1540582, 0.1652997 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_delta_night_6.sleep_profiler | 0.1398343 | numeric |
Time spent in REM sleep across the night (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_time_hrs_night_1.sleep_profiler | numeric | 0.5583333 | 2.5000000 |
Time spent in REM sleep across the night (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_time_hrs_night_2.sleep_profiler | numeric | 0.2666667 | 2.7833330 |
Time spent in REM sleep across the night (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_time_hrs_night_3.sleep_profiler | numeric | 0.4000000 | 2.5583330 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_time_hrs_night_4.sleep_profiler | 0.9333333, 1.0000000, 1.7833330, 1.9416670, 2.2416670 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_time_hrs_night_5.sleep_profiler | 0.4666667, 1.2333330, 3.5083330 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_time_hrs_night_6.sleep_profiler | 2.158333 | numeric |
Actual sleep time divided by Time In Bed X 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_efficiency_percent_night_1.sleep_profiler | numeric | 33.65004 | 96.04366 |
Actual sleep time divided by Time In Bed X 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_efficiency_percent_night_2.sleep_profiler | numeric | 42.01898 | 97.86781 |
Actual sleep time divided by Time In Bed X 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_efficiency_percent_night_3.sleep_profiler | numeric | 41.91388 | 96.90844 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_efficiency_percent_night_4.sleep_profiler | 54.16204, 66.51982, 71.98444, 82.75862, 85.25520 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_efficiency_percent_night_5.sleep_profiler | 63.29787, 77.38096, 80.19458 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_efficiency_percent_night_6.sleep_profiler | 76.89031 | numeric |
Minutes required to fall asleep (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_latency_mins_night_1.sleep_profiler | numeric | 1 | 175 |
Minutes required to fall asleep (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_latency_mins_night_2.sleep_profiler | numeric | 2 | 69 |
Minutes required to fall asleep (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_latency_mins_night_3.sleep_profiler | numeric | 1 | 115 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_latency_mins_night_4.sleep_profiler | 7, 9, 11, 19, 23 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_latency_mins_night_5.sleep_profiler | 9, 16 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_latency_mins_night_6.sleep_profiler | 34 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| startdate.sleep_profiler | Date | 2018-08-28 | 2022-11-14 |
Time spent in bed from start of recording to end of recording (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| time_in_bed_hrs_night_1.sleep_profiler | numeric | 5.200000 | 11.025000 |
Time spent in bed from start of recording to end of recording (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| time_in_bed_hrs_night_2.sleep_profiler | numeric | 6.075000 | 11.996390 |
Time spent in bed from start of recording to end of recording (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| time_in_bed_hrs_night_3.sleep_profiler | numeric | 4.675000 | 11.996390 |
Time spent in bed from start of recording to end of recording (Night 4)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| time_in_bed_hrs_night_4.sleep_profiler | 7.508333, 7.975000, 8.566667, 8.816667, 9.460834 | numeric |
Time spent in bed from start of recording to end of recording (Night 5)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| time_in_bed_hrs_night_5.sleep_profiler | 5.600000, 6.266667, 11.991670 | numeric |
Time spent in bed from start of recording to end of recording (Night 6)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| time_in_bed_hrs_night_6.sleep_profiler | 7.825 | numeric |
Total minutes the participant was awake after sleep onset until the end of the recording (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_after_sleep_onset_mins_night_1.sleep_profiler | numeric | 11 | 320 |
Total minutes the participant was awake after sleep onset until the end of the recording (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_after_sleep_onset_mins_night_2.sleep_profiler | numeric | 8 | 291 |
Total minutes the participant was awake after sleep onset until the end of the recording (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_after_sleep_onset_mins_night_3.sleep_profiler | numeric | 10 | 258 |
Total minutes the participant was awake after sleep onset until the end of the recording (Night 4)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_after_sleep_onset_mins_night_4.sleep_profiler | 59, 69, 136, 167, 199 | numeric |
Total minutes the participant was awake after sleep onset until the end of the recording (Night 5)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_after_sleep_onset_mins_night_5.sleep_profiler | 66, 121, 128 | numeric |
Total minutes the participant was awake after sleep onset until the end of the recording (Night 6)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_after_sleep_onset_mins_night_6.sleep_profiler | 72 | numeric |
Average delta power during wake epochs (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_delta_night_1.sleep_profiler | numeric | 0.09730534 | 0.68893232 |
Average delta power during wake epochs (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_delta_night_2.sleep_profiler | numeric | 0.1234879 | 0.4058309 |
Average delta power during wake epochs (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_delta_night_3.sleep_profiler | numeric | 0.1280672 | 0.5426953 |
Average delta power during wake epochs (Night 4)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_delta_night_4.sleep_profiler | 0.1583221, 0.1711860, 0.1944113, 0.1977259, 0.2189980 | numeric |
Average delta power during wake epochs (Night 5)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_delta_night_5.sleep_profiler | 0.1749399, 0.1808890, 0.2453625 | numeric |
Average delta power during wake epochs (Night 6)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_delta_night_6.sleep_profiler | 0.2022863 | numeric |
Time spent awake during the night (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_time_hrs_night_1.sleep_profiler | numeric | 0.2416667 | 7.2416670 |
Time spent awake during the night (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_time_hrs_night_2.sleep_profiler | numeric | 0.1666667 | 5.6000000 |
Time spent awake during the night (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_time_hrs_night_3.sleep_profiler | numeric | 0.2166667 | 5.0583330 |
Time spent awake during the night (Night 4)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_time_hrs_night_4.sleep_profiler | 1.300000, 1.375000, 2.400000, 3.166667, 3.441667 | numeric |
Time spent awake during the night (Night 5)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_time_hrs_night_5.sleep_profiler | 1.266667, 2.300000, 2.375000 | numeric |
Time spent awake during the night (Night 6)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_time_hrs_night_6.sleep_profiler | 1.808333 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sample_id.specimens | numeric | 329777 | 4077971 |
Animal Fluency is a widely used test of language generation. Examinees are asked to generate as many animals as possible in 1 minute, and the total correct is recorded.
Language of administration
| Label | Value |
|---|---|
| English | English |
| Mandarin | Mandarin |
| Spanish-MEX | Spanish-MEX |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| animal_fluency_task_language.tabcat_animal_fluency | English, Mandarin, Spanish-MEX | character | English, Mandarin, Spanish-MEX |
TabCAT version
| Label | Value |
|---|---|
| 1.0.0 | 1.0.0 |
| 3.0.0 | 3.0.0 |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| animal_fluency_task_version.tabcat_animal_fluency | 1.0.0, 3.0.0 | character | 1.0.0, 3.0.0 |
Z-score adjusted for age, sex, education
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| animal_fluency_total_correct_z.tabcat_animal_fluency | 22 | numeric |
Number of animals generated in 60-seconds
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| animal_fluency_total_correct.tabcat_animal_fluency | 10, 18, 22, 23, 24 | numeric |
Number of repetition errors
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| animal_fluency_total_repetitions.tabcat_animal_fluency | 0, 1, 2, 3, 4 | numeric |
Number of rule violation errors
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| animal_fluency_total_rule_violations.tabcat_animal_fluency | 0, 1 | numeric |
The Brain Health Assessment (BHA) battery includes two required tests (Favorites, Match), two optional tests (Line Orientation, Animal Fluency), and an optional informant survey (Brain Health Survey [BHS]). The battery is optimized for the accurate detection of MCI and mild dementia, reliably measures change over time, and provides a performance sample from each major cognitive domain.
Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.
Tsoy E, Erlhoff SJ, Goode CA, Dorsman KA, Kanjanapong S, Lindbergh CA, La Joie R, Strom A, Rabinovici GD, Lanata SC, Miller BL, Tomaszewski Farias SE, Kramer JH, Rankin KP, Possin KL. BHA-CS: A novel cognitive composite for Alzheimer’s disease and related disorders. Alzheimers Dement (Amst). 2020 Jun 21;12(1):e12042. doi: 10.1002/dad2.12042. PMID: 32582835; PMCID: PMC7306517.
a composite score combining results of only the two TabCAT required tests (Favorites, Match), calulated as: BHA CS-Short = ((1.753 + 0.946FavRegZ + 0.995MatRegZ) - 1.751)/1.509, where FavRegZ is the demographically adjusted regression-based z-score for Favorites Total Recall and MatRegZ is the demographically adjusted regression-based z-score for Match Total Correct
| Variable Name | Type |
|---|---|
| composite_bha_cs_short.tabcat_bha | numeric |
Favorites is a test of multimodal associative memory for visual and verbal information in which examinees are asked to remember faces paired with a food and animal word. The task consists of 2 Learning Trials, each followed by an Immediate Recall Trial, and a 10-minute Delayed Recall and Delayed Recognition trials.
Z-score of the total number of correct responses
| Variable Name | Type |
|---|---|
| fav_delay_total_correct_z.tabcat_fav | numeric |
total number of correct responses given
| Variable Name | Type |
|---|---|
| fav_delay_total_correct.tabcat_fav | numeric |
total number of “DK”: don’t know, where the examinee did not give a response
| Variable Name | Type |
|---|---|
| fav_delay_total_dk.tabcat_fav | numeric |
total number of “INT”: intrusion, where the response given was not presented during the trial
| Variable Name | Type |
|---|---|
| fav_delay_total_intrusions.tabcat_fav | numeric |
total number of “SME”: source memory error, where the response given was incorrectly matched
| Variable Name | Type |
|---|---|
| fav_delay_total_sme.tabcat_fav | numeric |
Recall 1 Animal 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_animal1score.tabcat_fav | correct, DK, INT, SME | character |
Recall 1 Animal 2 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_animal2score.tabcat_fav | correct, DK, INT, SME | character |
Recall 1 Animal 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_animal3score.tabcat_fav | correct, DK, INT, SME | character |
Recall 1 Animal 4 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_animal4score.tabcat_fav | correct, DK, INT, SME | character |
Recall 1 Food 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_food1score.tabcat_fav | correct, DK, INT, SME | character |
Recall 1 Food 2 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_food2score.tabcat_fav | correct, DK, INT, SME | character |
Recall 1 Food 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_food3score.tabcat_fav | correct, DK, INT, SME | character |
Recall 1 Food 4 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_food4score.tabcat_fav | correct, DK, INT, SME | character |
Z-score of total number of correct responses across Recall 1
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_correct_z.tabcat_fav | numeric |
Total number of correct responses across Recall 1
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_correct.tabcat_fav | numeric |
Total number of Don’t Know responses across Recall 1, i.e., giving no response
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_dk.tabcat_fav | numeric |
Total number of Intrusion responses across Recall 1, i.e., giving a food/animal that was not presented during the trial
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_intrusions.tabcat_fav | numeric |
Total number of SME responses across Recall 1, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_sme.tabcat_fav | numeric |
Recall 2 Animal 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_animal1score.tabcat_fav | correct, DK, INT, SME | character |
Recall 2 Animal 2 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_animal2score.tabcat_fav | correct, DK, INT, SME | character |
Recall 2 Animal 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_animal3score.tabcat_fav | correct, DK, INT, SME | character |
Recall 2 Animal 4 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_animal4score.tabcat_fav | correct, DK, INT, SME | character |
Recall 2 Food 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_food1score.tabcat_fav | correct, DK, INT, SME | character |
Recall 2 Food 2 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_food2score.tabcat_fav | correct, DK, INT, SME | character |
Recall 2 Food 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_food3score.tabcat_fav | correct, DK, INT, SME | character |
Recall 2 Food 4 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_food4score.tabcat_fav | correct, DK, INT, SME | character |
Z-score of total number of correct responses across Recall 2
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_correct_z.tabcat_fav | numeric |
Total number of correct responses across Recall 2
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_correct.tabcat_fav | numeric |
Total number of Don’t Know responses across Recall 2, i.e., giving no response
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_dk.tabcat_fav | numeric |
Total number of Intrusion responses across Recall 2, i.e., giving a food/animal that was not presented during the trial
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_intrusions.tabcat_fav | numeric |
Total number of SME responses across Recall 2, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_sme.tabcat_fav | numeric |
Total amount of time spent on the learning tasks, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_learn_task_duration.tabcat_fav | numeric | 0 | Infinity |
The task form chosen
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_task_form.tabcat_fav | A, B, C, D | character |
Testing language used during the task
| Variable Name | Type |
|---|---|
| fav_learn_task_language.tabcat_fav | character |
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_task_version.tabcat_fav | 1.0.0, 3.0.0 | character |
Score that reflects the response bias across all Favorites Recognition trials. Higher scores reflect worse performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_bias.tabcat_fav | numeric | (-) Infinity | Infinity |
Score that reflects the recognition discriminability accuracy across all Favorites Recognition trials. Higher scores reflect better performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_d_prime.tabcat_fav | numeric | (-) Infinity | Infinity |
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_task_duration.tabcat_fav | numeric | 0 | Infinity |
The task form chosen
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_rec_task_form.tabcat_fav | A, B, C, D | character |
Testing language used during the task
| Variable Name | Type |
|---|---|
| fav_rec_task_language.tabcat_fav | character |
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_rec_task_version.tabcat_fav | 1.0.0, 3.0.0 | character |
Total number of false negative scores across all 24 trials
| Variable Name | Type |
|---|---|
| fav_rec_total_false_negative.tabcat_fav | numeric |
Total number of false positive scores across all 24 trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_total_false_positive.tabcat_fav | numeric | 0 | 16 |
Total number of true negative scores across all 24 trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_total_true_negative.tabcat_fav | numeric | 0 | 16 |
Total number of true positive scores across all 24 trials
| Variable Name | Type |
|---|---|
| fav_rec_total_true_positive.tabcat_fav | numeric |
Z-score of the total number of correct responses across all three trials: Recall 1, Recall 2, and Delayed Recall
| Variable Name | Type |
|---|---|
| favorites_all_trials_total_correct_z.tabcat_fav | numeric |
Total number of correct responses across all three trials: Recall 1, Recall 2, and Delayed Recall
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_all_trials_total_correct.tabcat_fav | numeric | 0 | 24 |
Number of Don’t Know responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving no response
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_all_trials_total_dk.tabcat_fav | numeric | 0 | 24 |
Number of Intrusion responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving a food/animal that was not presented during the trial
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_all_trials_total_intrusions.tabcat_fav | numeric | 0 | 24 |
Number of SME responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_all_trials_total_sme.tabcat_fav | numeric | 0 | 24 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_congr_correct_median_rt.tabcat_flanker | numeric | 0.5671260 | 2.3457495 |
| Variable Name | Type |
|---|---|
| flanker_congr_correct_total.tabcat_flanker | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_correct_median_rt.tabcat_flanker | numeric | 0.6335810 | 2.3457495 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_correct_st_dev_rt.tabcat_flanker | numeric | 0.06286568 | 0.78552673 |
| Variable Name | Type |
|---|---|
| flanker_correct_total.tabcat_flanker | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_incongr_correct_median_rt.tabcat_flanker | numeric | 0.5144560 | 3.5945000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_incongr_correct_total.tabcat_flanker | numeric | 0 | 16 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| flanker_practice_trial_success.tabcat_flanker | FALSE, TRUE | logical |
| Variable Name | Type |
|---|---|
| flanker_pt_set1_total_correct.tabcat_flanker | numeric |
| Variable Name | Type |
|---|---|
| flanker_pt_set2_total_correct.tabcat_flanker | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_task_duration.tabcat_flanker | numeric | 0 | 291 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| flanker_task_language.tabcat_flanker | English, Spanish (Argentina, Uruguay), Spanish (MEX, ESP, Central America), Spanish-MEX | character |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| flanker_task_version.tabcat_flanker | 1.0.0, 1.1.0, 3.0.0 | character |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_total_score_z.tabcat_flanker | numeric | 0.924528 | -5.415094 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_total_score.tabcat_flanker | numeric | 0.313000 | 9.822000 |
Line Length is a test of visuospatial skills. Examinees are shown two parallel white lines of differing lengths on a navy background and asked to tap the longer line of the two lines. The difference in length between the two lines shortens with response accuracy and lengthens when an incorrect response is made. There are ten easy catch trials interspersed throughout the task to indicate task validity.
Mean reaction time across all task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_avg_time_per_trial.tabcat_ll | numeric | 0 | Infinity |
Percent of total correct catch trials, a Catch Trials score < 80 indicates that the Threshold Score may not be valid
| Variable Name | Type |
|---|---|
| ll_catch_trial_score.tabcat_ll | numeric |
Catch Trial 1: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial1.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 10: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial10.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 2: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial2.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 3: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial3.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 4: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial4.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 5: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial5.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 6: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial6.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 7: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial7.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 8: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial8.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Catch Trial 9: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial9.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
Highest consecutive number of trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_highest_consecutive_timed_out.tabcat_ll | 0, 3 | numeric |
Median reaction time across all task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_median_time_per_trial.tabcat_ll | numeric | 0 | Infinity |
Indication of whether the examinee completed the practice trial set successfully
| Label | Value |
|---|---|
| 0 | Incorrect |
| 1 | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_practice_trials_success.tabcat_ll | 0,1 | categorical | Incorrect, Correct |
Reversal 1: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r1.tabcat_ll | numeric | 1 | 50 |
Reversal 10: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r10.tabcat_ll | numeric | 1 | 50 |
Reversal 2: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r2.tabcat_ll | numeric | 1 | 50 |
Reversal 3: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r3.tabcat_ll | numeric | 1 | 50 |
Reversal 4: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r4.tabcat_ll | numeric | 1 | 50 |
Reversal 5: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r5.tabcat_ll | numeric | 1 | 50 |
Reversal 6: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r6.tabcat_ll | numeric | 1 | 50 |
Reversal 7: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r7.tabcat_ll | numeric | 1 | 50 |
Reversal 8: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r8.tabcat_ll | numeric | 1 | 50 |
Reversal 9: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r9.tabcat_ll | numeric | 1 | 50 |
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_task_duration.tabcat_ll | numeric | 0 | Infinity |
Testing language used during the task
| Variable Name | Type |
|---|---|
| ll_task_language.tabcat_ll | character |
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_task_version.tabcat_ll | 1.0.0, 1.1.0, 3.0.0 | character |
Z-score of the threshold score across reversals 3:10
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_threshold_score_3_10_z.tabcat_ll | 0.480469, 0.921875 | numeric |
Primary performance metric: Average intensity of the difference in line lengths at the time of reversal across reversals 3:10, i.e., mean of LL_R3:LL_R10. Otherwise explained as: the average length difference between the two lines at which the probability of the examinee responding accurately is 75%. Scores are reported on a continuous scale with higher scores indicating worse performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_threshold_score_3_10.tabcat_ll | numeric | 1 | Infinity |
Total number of catch trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_catch_trials_timed_out.tabcat_ll | 0, 1 | numeric |
Total number of correct responses given during practice trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_practice_trials_correct.tabcat_ll | 4 | numeric |
Total number of practice trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_practice_trials_timed_out.tabcat_ll | 0 | numeric |
Total number of practice trials completed
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_practice_trials.tabcat_ll | 4 | numeric |
Total number of task trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_task_trials_timed_out.tabcat_ll | 0, 5 | numeric |
Total number of task trials completed
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_total_trials.tabcat_ll | numeric | 0 | Infinity |
TabCAT BHA Line Orientation is a test of visuospatial skills modeled after the Benton Judgment of Line Orientation. Examinees are shown 3 lines on a dark background: 1 white line and 2 shorter orange lines. One orange line is parallel to the white line and the other orange line is presented at a different angle. Examinees are asked to tap the orange line that is parallel to the target white line. Trial difficulty is manipulated by varying the angle difference between the non-match orange line and the white line. Difficulty is staircased based on response accuracy.
Mean reaction time across all task trials. In March 2022, the task was modified such that trials were cutoff at a limit of 8 seconds.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_avg_time_per_trial.tabcat_lo | numeric | 0 | Infinity |
10 easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicate that the Threshold Score may not be valid.
| Variable Name | Type |
|---|---|
| lo_catch_trial_score.tabcat_lo | numeric |
Catch Trial 1: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial1.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 10: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial10.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 2: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial2.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 3: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial3.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 4: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial4.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 5: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial5.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 6: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial6.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 7: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial7.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 8: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial8.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Catch Trial 9: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial9.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Highest consecutive number of trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_highest_consecutive_timed_out.tabcat_lo | 0, 1, 2, 3 | numeric |
Median reaction time across all task trials. In March 2022, the task was modified such that trials were cutoff at a limit of 8 seconds.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_median_time_per_trial.tabcat_lo | numeric | 0.833000 | 12.417000 |
Indication of whether the examinee completed the practice trial set successfully
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_practice_trials_success.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
Reversal 1: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r1.tabcat_lo | numeric | 1 | 60 |
Reversal 10: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r10.tabcat_lo | numeric | 1 | 60 |
Reversal 2: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r2.tabcat_lo | numeric | 1 | 60 |
Reversal 3: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r3.tabcat_lo | numeric | 1 | 60 |
Reversal 4: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r4.tabcat_lo | numeric | 1 | 60 |
Reversal 5: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r5.tabcat_lo | numeric | 1 | 60 |
Reversal 6: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r6.tabcat_lo | numeric | 1 | 60 |
Reversal 7: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r7.tabcat_lo | numeric | 1 | 60 |
Reversal 8: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r8.tabcat_lo | numeric | 1 | 60 |
Reversal 9: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r9.tabcat_lo | numeric | 1 | 60 |
Total amount of time spent on the task, in seconds.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_task_duration.tabcat_lo | numeric | 0 | Infinity |
Testing language used during the task
| Variable Name | Type |
|---|---|
| lo_task_language.tabcat_lo | character |
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_task_version.tabcat_lo | 1.0.0, 1.1.0, 3.0.0 | character |
Z-score of the threshold score across reversals 3:10
| Variable Name | Type |
|---|---|
| lo_threshold_score_3_10_z.tabcat_lo | numeric |
Primary performance metric: Average angle between lines at the time of reversal across reversals 3:10, i.e., mean of LO_R3:LO_R10. Otherwise explained as: the average angle difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.. Scores are reported on a continuous scale with higher scores indicating worse performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_threshold_score_3_10.tabcat_lo | numeric | 1 | 90 |
Total number of catch trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_catch_trials_timed_out.tabcat_lo | 0, 1, 3, 4 | numeric |
Total number of correct responses given during practice trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_practice_trials_correct.tabcat_lo | 4, 6, 7 | numeric |
Total number of practice trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_practice_trials_timed_out.tabcat_lo | 0, 1, 3, 6 | numeric |
Total number of practice trials completed
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_practice_trials.tabcat_lo | 4, 5, 8, 9, 13 | numeric |
Total number of task trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_task_trials_timed_out.tabcat_lo | 0, 1, 2, 5 | numeric |
Total number of task trials completed
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_total_trials.tabcat_lo | numeric | 0 | Infinity |
Match is a test of processing speed and executive functions modeled after the WAIS-III Digit Symbol Coding paradigm. The examinee is shown a fixed legend of numbers 1 through 7 with corresponding simple, abstract pictures. Each time a number appears in the middle of the screen, the examinee must tap the corresponding picture at the bottom of the screen as quickly as possible. The task lasts for two minutes and the primary performance metrics are total correct and total errors.
Overall success of the total practice trial sets
| Label | Value |
|---|---|
| TRUE | Pass |
| FALSE | Fail |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| match_practice_trial_success.tabcat_match | TRUE, FALSE | character | Pass, Fail |
Success of the first practice trial set, 2 consecutive correct trials accomplished
| Label | Value |
|---|---|
| 0 | Fail |
| 1 | Pass |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| match_pt_set1_success.tabcat_match | 0,1 | categorical | Fail, Pass |
Total number of trials completed in the first practice trial set
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_pt_set1_total_trials.tabcat_match | 2, 3, 4, 6 | numeric |
Success of the second practice trial set, 2 consecutive correct trials accomplished
| Label | Value |
|---|---|
| 0 | Fail |
| 1 | Pass |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| match_pt_set2_success.tabcat_match | 0, 1 | categorical | Fail, Pass |
Total number of trials completed in the second practice trial set
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_pt_set2_total_trials.tabcat_match | 0 | numeric |
Success of the third practice trial set, 2 consecutive correct trials accomplished
| Label | Value |
|---|---|
| 0 | Fail |
| 1 | Pass |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| match_pt_set3_success.tabcat_match | 0, 1 | categorical | Fail, Pass |
Total number of trials completed in the third practice trial set
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_pt_set3_total_trials.tabcat_match | 0 | numeric |
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match_task_duration.tabcat_match | numeric | 0 | Infinity |
The task form chosen
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_task_form.tabcat_match | A, B, C, D | character |
Testing language used during the task
| Variable Name | Type |
|---|---|
| match_task_language.tabcat_match | character |
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_task_version.tabcat_match | 1.0.0, 3.0.0 | character |
Z-score of the total number of correct responses given during the full 2 minute duration of the task
| Variable Name | Type |
|---|---|
| match_total_correct_z.tabcat_match | numeric |
Total number of correct responses given during the full task duration, 2 minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match_total_correct.tabcat_match | numeric | 0 | Infinity |
Total number of incorrect responses given during the full task duration, 2 minutes
| Variable Name | Type |
|---|---|
| match_total_incorrect.tabcat_match | numeric |
Rapid Naming is a computerized, one-minute speeded visual naming test aimed at measuring subtle age-related word-finding decline.
Mean reaction time across all correct trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_avg_reaction_time.tabcat_rapid_naming | numeric | ? | ? |
Median reaction time across all correct trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_median_reaction_time.tabcat_rapid_naming | numeric | ? | ? |
Standard deviation of reaction time across all correct trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_st_dev_reaction_time.tabcat_rapid_naming | numeric | ? | ? |
Language the task was administered in
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rapid_naming_task_language.tabcat_rapid_naming | English, Portuguese (Brazil), Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain) | character |
Indicates which verison of the TabCAT app was used during administration. Version revisions include task experience, scoring, mechanism, or format that may impact comparison with older data.
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rapid_naming_task_version.tabcat_rapid_naming | 1.0.0, 3.0.0 | character |
Total number of correct responses given across all trials (initial and self-corrected)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_total_correct.tabcat_rapid_naming | numeric | 0 | 60 |
Total number of incorrect responoses given across all trials
| Variable Name | Type |
|---|---|
| rapid_naming_total_incorrect.tabcat_rapid_naming | numeric |
Total number of initial correct responses given across all trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_total_initial_correct.tabcat_rapid_naming | numeric | 0 | 60 |
Total number of unseen trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_total_not_seen.tabcat_rapid_naming | numeric | 0 | 60 |
Total number of seen trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_total_seen.tabcat_rapid_naming | numeric | 0 | 60 |
Total number of self corrected responses given across all trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rapid_naming_total_self_corrected.tabcat_rapid_naming | 0, 1, 2 | numeric |
Total number of skipped trials
| Variable Name | Type |
|---|---|
| rapid_naming_total_skipped.tabcat_rapid_naming | numeric |
Running dots is an executive functioning/visuospatial working memory task where participants must watch a dot move across a grid and remember the pattern it moved in. As the trials continue, the number of dot placements the participant must remember in the sequence increases from 2 dot spaces to 3, 4, and 5 dot spaces.
Lindbergh, C. A., & Kramer, J. H. (2023). Measures of Executive Functions. The SAGE Handbook of Clinical Neuropsychology: Clinical Neuropsychological Assessment and Diagnosis, 179.
Tsoy E, Erlhoff SJ, Goode CA, et al. BHA-CS: A novel cognitive composite for Alzheimer’s disease and related disorders. Alzheimers Dement (Amst). 2020;12(1):e12042. Published 2020 Jun 21. doi:10.1002/dad2.12042
Percent of correct responses given across all trials in the 2 dot condition, regardless of order
| Variable Name | Type |
|---|---|
| running_dots_2dot_percent_correct.tabcat_running_dots | numeric |
Total number of correct responses given across all trials in the 2 dot condition, regardless of order
| Variable Name | Type |
|---|---|
| running_dots_2dot_total_correct.tabcat_running_dots | numeric |
For each trial in the 2 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_2dot_trial_score.tabcat_running_dots | numeric | 0 | 6 |
Percent of correct responses given across all trials in the 3 dot condition, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_3dot_percent_correct.tabcat_running_dots | numeric | 0 | 100 |
Total number of correct responses given across all trials in the 3 dot condition, regardless of order
| Variable Name | Type |
|---|---|
| running_dots_3dot_total_correct.tabcat_running_dots | numeric |
For each trial in the 3 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials
| Variable Name | Type |
|---|---|
| running_dots_3dot_trial_score.tabcat_running_dots | character |
Percent of correct responses given across all trials in the 4 dot condition, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_4dot_percent_correct.tabcat_running_dots | numeric | 0 | 100 |
Total number of correct responses given across all trials in the 4 dot condition, regardless of order
| Variable Name | Type |
|---|---|
| running_dots_4dot_total_correct.tabcat_running_dots | numeric |
For each trial in the 4 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_4dot_trial_score.tabcat_running_dots | numeric | 0 | 12 |
Percent of correct responses given across all trials in the 5 dot condition, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_5dot_percent_correct.tabcat_running_dots | numeric | 0 | 100 |
Total number of correct responses given across all trials in the 5 dot condition, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_5dot_total_correct.tabcat_running_dots | numeric | 0 | 15 |
For each trial in the 5 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_5dot_trial_score.tabcat_running_dots | numeric | 0 | 15 |
Percent of correct responses given across all trials, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_percent_correct.tabcat_running_dots | numeric | 0 | 100 |
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_task_duration.tabcat_running_dots | numeric | 0 | (Infinity) |
Testing language used during the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| running_dots_task_language.tabcat_running_dots | Arabic, Cantonese (Traditional), English, Filipino, Greek, Igbo, Mandarin (Simplified), Mandarin (Traditional), Portuguese (Brazil), Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain), Thai | character |
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| running_dots_task_version.tabcat_running_dots | 1.0.0, 1.1.0, 1.2.0, 1.2.1, 3.0.0 | character |
Total number of correct responses given across all trials, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_total_correct.tabcat_running_dots | numeric | 0 | 42 |
For each trial: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials and all dot number conditions
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_trial_score.tabcat_running_dots | numeric | 0 | 42 |
Set Shifting is a test of executive functioning and is modeled after the NIH EXAMINER Set Shifting task. Examinees are required to match a stimulus on the top of the screen to one of two stimuli in the lower corners of the screen, classifying shapes or classifying colors.
Median reaction time of all correct color block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_color_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
Total number of correct responses given across all color block task trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| set_shifting_color_correct_total.tabcat_set_shifting | 11, 13, 14, 15, 16 | numeric |
Median reaction time of all correct nonshifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_nonshifted_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
Total number of correct responses given across all nonshifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_nonshifted_correct_total.tabcat_set_shifting | numeric | 0 | 16 |
Median reaction time of all correct shape block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shape_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
Total number of correct responses given across all shape block task trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| set_shifting_shape_correct_total.tabcat_set_shifting | 7, 13, 14, 15, 16 | numeric |
Median reaction time of all correct shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shift_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
Total number of correct responses given across all shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shift_correct_total.tabcat_set_shifting | numeric | 0 | 32 |
Median reaction time of all correct shifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shifted_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
Standard deviation of reaction time of all correct shifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shifted_correct_st_dev_rt.tabcat_set_shifting | numeric | (-) Infinity | Infinity |
Total number of correct responses given across all shifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shifted_correct_total.tabcat_set_shifting | numeric | 0 | 16 |
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_task_duration.tabcat_set_shifting | numeric | 0 | Infinity |
Testing language used during the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| set_shifting_task_language.tabcat_set_shifting | Amharic, Arabic, Cantonese (Traditional), English, Filipino, French, Greek, Hebrew, Igbo, Italian, Mandarin (Simplified), Mandarin (Traditional), Portuguese (Brazil), Setswana, Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain), Swahili, Thai | character |
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| set_shifting_task_version.tabcat_set_shifting | 1.0.0, 1.1.0, 3.0.0 | character |
Z-score of the global score that combines accuracy and reaction time scores across all correct shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_total_score_z.tabcat_set_shifting | numeric | (-) Infinity | Infinity |
Global score that combines accuracy and reaction time scores across all correct shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_total_score.tabcat_set_shifting | numeric | 0 | 10 |
Participant self reported familiarity interacting with technology. Questionnaire developed in house as part of Fitbit study.
Do you have access to a computer or tablet at home?
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| access.tech_familiarity | 0, 1 | categorical | No, Yes |
How much difficulty do you have using computers?
| Label | Value |
|---|---|
| 0 | No difficulty |
| 1 | Some difficulty |
| 2 | Moderate difficulty |
| 3 | Quite a bit of difficulty |
| 4 | Extreme difficulty |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| computer_difficulty.tech_familiarity | 0, 1, 2, 3, 4 | categorical | No difficulty, Some difficulty, Moderate difficulty, Quite a bit of difficulty, Extreme difficulty |
On average, how many hours PER DAY do you spend on the internet?
| Label | Value |
|---|---|
| 0 | 0-1 |
| 1 | 2-4 |
| 2 | 5-8 |
| 3 | 9-15 |
| 4 | 15+ |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hours_internet_per_day.tech_familiarity | 0, 1, 2, 3, 4 | categorical | 0-1, 2-4, 5-8, 9-15, 15+ |
How anxious (or nervous) do you typically feel when using a computer, tablet, or
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| nervous_anxious_technology.tech_familiarity | 1, 2, 3, 4 | categorical | Not anxious, Somewhat anxious, Moderately anxious, Quite a bit anxious, Extremely anxious |
smartphone?
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| smartphone.tech_familiarity | 0, 1 | categorical | No, Yes |
Have you ever used a wearable tracking device
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| wearable.tech_familiarity | 0, 1 | categorical | No, Yes |
The neuropsychological testing battery from the Uniform Data Set (UDS) of the Alzheimer’s Disease Centers (ADC) program of the National Institute on Aging (NIA). This testing battery includes measures to test domains such as episodic memory, attention, processing speed, executive function, and language.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animals_zscore.uds_neuropsych | numeric | 0.018 | -3.981 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animals.uds_neuropsych | numeric | 0 | 52 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| boston_zscore.uds_neuropsych | numeric | 0.000 | -11.667 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| boston.uds_neuropsych | numeric | 0 | 30 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cogstat.uds_neuropsych | 0, 1, 2, 3, 4 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| craftdre.uds_neuropsych | numeric | 0 | 25 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| craftdvr.uds_neuropsych | numeric | 0 | 39 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| crafturs.uds_neuropsych | numeric | 0 | 25 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| craftvrs.uds_neuropsych | numeric | 0 | 41 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digbacct.uds_neuropsych | integer | 0 | 14 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digforct.uds_neuropsych | numeric | 0 | 14 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digib_zscore.uds_neuropsych | numeric | 0.045 | -3.364 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digib.uds_neuropsych | numeric | 0 | 12 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digiblen_zscore.uds_neuropsych | numeric | 0.000 | -4.333 |
| Variable Name | Type |
|---|---|
| digiblen.uds_neuropsych | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digif_zscore.uds_neuropsych | numeric | 0.095 | -4.550 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digif.uds_neuropsych | numeric | 0 | 12 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digiflen_zscore.uds_neuropsych | numeric | 0.091 | -6.273 |
| Variable Name | Type |
|---|---|
| digiflen.uds_neuropsych | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| logi_mem_zscore.uds_neuropsych | numeric | 0.000 | -4.086 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| logimem.uds_neuropsych | numeric | 0 | 23 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mem_units_zscore.uds_neuropsych | numeric | 0.000 | -3.500 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| memtime.uds_neuropsych | numeric | 0 | 35 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| memunits.uds_neuropsych | numeric | 0 | 23 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| minttots.uds_neuropsych | numeric | 0 | 32 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mmse_zscore.uds_neuropsych | numeric | 0.000 | -29.300 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mocatots.uds_neuropsych | numeric | 0 | 30 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pentagon.uds_neuropsych | 0, 1 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| SE_uds3_ef.uds_neuropsych | numeric | 0.3202755 | 0.9562837 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trail_a_zscore.uds_neuropsych | numeric | 0.021 | -11.207 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trail_b_zscore.uds_neuropsych | numeric | 0.003 | -6.803 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailA_ratio.uds_neuropsych | numeric | 0.000000 | 160.000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| traila.uds_neuropsych | numeric | 9 | 150 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailali.uds_neuropsych | numeric | 0 | 24 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailarr.uds_neuropsych | numeric | 0 | 40 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailB_ratio.uds_neuropsych | numeric | 0.200000 | 72.000000 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailb.uds_neuropsych | numeric | 17 | 300 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailbli.uds_neuropsych | numeric | 0 | 24 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailbrr.uds_neuropsych | numeric | 0 | 40 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uds3_ef_mean.adj.uds_neuropsych | numeric | 0.000092800 | -1.026420414 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uds3_ef_sd.adj.uds_neuropsych | numeric | 0.7280313 | 0.7615333 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uds3_ef_Z.uds_neuropsych | numeric | 0.0002432193 | -5.2101374529 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uds3_ef.uds_neuropsych | numeric | 0.0002508328 | -3.2307936664 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| udsbenrs.uds_neuropsych | 0, 1 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsbentc.uds_neuropsych | numeric | 0 | 17 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsbentd.uds_neuropsych | numeric | 0 | 17 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsverfc.uds_neuropsych | numeric | 0 | 33 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsverlc.uds_neuropsych | numeric | 0 | 34 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsvertn.uds_neuropsych | numeric | 0 | 62 |
| Variable Name | Type |
|---|---|
| v_type.uds_neuropsych | character |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| veg_zscore.uds_neuropsych | numeric | 0.043 | -3.585 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| veg.uds_neuropsych | numeric | 0 | 37 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wais_zscore.uds_neuropsych | numeric | 0.009 | -4.975 |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wais.uds_neuropsych | numeric | 0 | 98 |
The Vascular Burden Score (VBS) includes the sum of four possible Vascular Risk Factors (e.g., hypertension, diabetes, hyperlipidemia, sleep apnea) and four possible Vascular Diseases (cardiac arrythmias [atrial fibrillation, pacemaker and/or defibrillator], coronary artery disease [angina, angioplasty/endarterectomy/stent, cardiac bypass procedure, heart attack/cardiac arrest], congestive heart failure, and cerebrovascular disease [TIA, stroke]). Range is 0-8.
Takahashi, P. Y., Caldwell, C. R., & Targonski, P. V. (2012). Effect of vascular burden as measured by vascular indexes upon vascular dementia: a matched case-control study. Clinical interventions in aging, 7, 27–33. https://doi.org/10.2147/CIA.S28143
DeCarli, C., Villeneuve, S., Maillard, P., Harvey, D., Singh, B., Carmichael, O., Fletcher, E., Olichney, J., Farias, S., Jagust, W., Reed, B., & Mungas, D. (2019). Vascular Burden Score Impacts Cognition Independent of Amyloid PET and MRI Measures of Alzheimer’s Disease and Vascular Brain Injury. Journal of Alzheimer’s disease : JAD, 68(1), 187–196. https://doi.org/10.3233/JAD-180965
Sum of VDS + VRS
| Variable Name | Type |
|---|---|
| VBS.vasc_burden | numeric |
Sum of 4 possible vascular diseases: 1) cardiac arrythmias [atrial fibrillation, pacemaker and/or defibrillator], 2) coronary artery disease [angina, angioplasty/endarterectomy/stent, cardiac bypass procedure, heart attack/cardiac arrest], 3) congestive heart failure and 4) cerebrovascular disease [TIA, stroke])
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VDS.vasc_burden | 0, 1, 2, 3, 4 | numeric |
Sum of 4 possible vascular risk factors: hypertension, sleep apnea, diabetes, hyperlipidemia
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VRS.vasc_burden | 0, 1, 2, 3, 4 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav1.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav10.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav2.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav3.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav4.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav5.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav6.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav7.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav8.virtual_bedside | 0 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav9.virtual_bedside | 0 | numeric |
| Variable Name | Type |
|---|---|
| cv2b_r.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2b_u.virtual_bedside | 0, 1, 8 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2hit.virtual_bedside | 12, 13, 14, 15, 16 | numeric |
| Variable Name | Type |
|---|---|
| cv2ldcc.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2ldci.virtual_bedside | 0, 1, 2, 3, 4 | numeric |
| Variable Name | Type |
|---|---|
| cv2lfrc.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2lfri.virtual_bedside | 0, 1, 2, 3, 20 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2np.virtual_bedside | 0, 2, 6 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2nu.virtual_bedside | 0, 1 | numeric |
| Variable Name | Type |
|---|---|
| cv2sdcc.virtual_bedside | numeric |
| Variable Name | Type |
|---|---|
| cv2sdci.virtual_bedside | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2sfrc.virtual_bedside | numeric | 5 | 16 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2sfri.virtual_bedside | 0, 1, 2, 4 | numeric |
| Variable Name | Type |
|---|---|
| cv2t1c.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t1i.virtual_bedside | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| cv2t2c.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t2i.virtual_bedside | 0, 1, 3, 4, 9 | numeric |
| Variable Name | Type |
|---|---|
| cv2t3c.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t3i.virtual_bedside | 0, 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| cv2t4c.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t4i.virtual_bedside | 0, 1, 2 | numeric |
| Variable Name | Type |
|---|---|
| cv2t5c.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t5i.virtual_bedside | 0, 1, 2, 3 | numeric |
| Variable Name | Type |
|---|---|
| cv2tb_c.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2tb_i.virtual_bedside | 0, 1, 2, 8 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| d_rule_v.virtual_bedside | 0, 1, 2 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dcorr.virtual_bedside | numeric | 6 | 30 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dreps.virtual_bedside | 0, 1, 2, 4 | numeric |
| Variable Name | Type |
|---|---|
| mintpcnc.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mintpcng.virtual_bedside | 0, 1, 2, 8 | numeric |
| Variable Name | Type |
|---|---|
| mintscnc.virtual_bedside | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mintscng.virtual_bedside | 0, 1, 2 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| minttots.virtual_bedside | 24, 29, 30, 31, 32 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| minttotw.virtual_bedside | 24, 29, 30, 31, 32 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mocaclock.virtual_bedside | 3 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mocacube.virtual_bedside | 0, 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mocalanguage.virtual_bedside | 0, 2, 3 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mod_rey.virtual_bedside | 13, 14, 15, 16 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| numb_loc.virtual_bedside | 8, 9, 10 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| repeat.virtual_bedside | 3 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| repeat5.virtual_bedside | 4, 5 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| research_status.virtual_bedside | 1 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rey_recg.virtual_bedside | 0, 1 | numeric |
| Variable Name | Type |
|---|---|
| rey10m.virtual_bedside | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cn_cor.virtual_bedside | numeric | 63 | 114 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strp_cn_err.virtual_bedside | 0 | numeric |
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cor.virtual_bedside | numeric | 1 | 71 |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strp_err.virtual_bedside | 0, 1, 7, 50 | numeric |
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strp_sce.virtual_bedside | 0, 1, 2, 3 | numeric |
social_network_index
ExerciseFreq
ExerciseYN
SNI_HighContact
SNI_NumberPeople_socialmedia
SNI_NumberPeople