primary_language
Description :
Primary language the participant speaks and prefers to communicate in
| Variable Name | Type |
|---|---|
| primary_language.demographics | character |
Data Dictionary
general
age_at_DCDate
Description :
Age of participant at time of data collection
| Variable Name | Type |
|---|---|
| age_at_DCDate.general | numeric |
date_diff
Description :
The difference in days between one instrument and the date of a participants neuropsych appointment
| Variable Name |
|---|
| date_diff.general |
DCDate
Description :
Date instrument was administered
| Variable Name | Type |
|---|---|
| DCDate.general | Date |
instr_type
| Variable Name |
|---|
| instr_type.general |
PIDN
Description :
Participant ID
| Variable Name | Type |
|---|---|
| PIDN.general | numeric |
source
| Variable Name |
|---|
| source.general |
UnQID
| Variable Name | Type |
|---|---|
| UnQID.general | numeric |
1back
Description :
NIH-EXAMINER N-back task. The n-back paradigm is a widely used measure of working memory that requires flexible updating capabilities. NIH-EXAMINER includes spatial 1-back and 2-back tasks to assess spatial working memory. The 1-back requires maintaining and updating 1 location at a time, whereas the more difficult 2-back requires maintaining and updating 2 locations.
References :
- Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., … & Widmeyer, M. (2014). NIH EXAMINER: conceptualization and development of an executive function battery. Journal of the international neuropsychological society, 20(1), 11-19.
nb1dprime
Description :
Discrimination (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb1dprime.1back | numeric | -Infinity | Infinity |
nb1FalseAlarms
Description :
Number of false positive errors (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb1FalseAlarms.1back | numeric | 0 | Infinity |
nb1Hits
Description :
Number of correct hits (raw)
| Variable Name | Type |
|---|---|
| nb1Hits.1back | numeric |
nb1TotalNo
Description :
Total number of items completed?
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb1TotalNo.1back | numeric | 0 | Infinity |
nb1ZFA
Description :
Number of false positive errors (z-score)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb1ZFA.1back | numeric | -Infinity | Infinity |
nb1ZHIT
Description :
Number of correct hits (z-score)
| Variable Name | Type |
|---|---|
| nb1ZHIT.1back | numeric |
task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| task.1back | 1-Back, AgingCog_1Back | character |
version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.1back | 1, 1.0.1, 1.0.2, 2 | character |
2back
Description :
NIH-EXAMINER N-back task. The n-back paradigm is a widely used measure of working memory that requires flexible updating capabilities. NIH-EXAMINER includes spatial 1-back and 2-back tasks to assess spatial working memory. The 1-back requires maintaining and updating 1 location at a time, whereas the more difficult 2-back requires maintaining and updating 2 locations.
References :
- Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., … & Widmeyer, M. (2014). NIH EXAMINER: conceptualization and development of an executive function battery. Journal of the international neuropsychological society, 20(1), 11-19.
nb2bias
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2bias.2back | numeric | 0.007 | -0.731 |
nb2dprime
Description :
Discrimination (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2dprime.2back | numeric | 0.007 | -1.749 |
nb2FalseAlarms
Description :
Number of false positive errors (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2FalseAlarms.2back | numeric | 0.025 | 0.992 |
nb2Hits
Description :
Number of correct hits (raw)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2Hits.2back | numeric | 0.177 | 0.984 |
nb2TotalNo
Description :
Total number of items completed?
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2TotalNo.2back | numeric | 0 | 59 |
nb2ZFA
Description :
Number of false positive errors (z-score)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2ZFA.2back | numeric | 0.000 | -1.967 |
nb2ZHIT
Description :
Number of correct hits (z-score)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nb2ZHIT.2back | numeric | 0.000 | -0.925 |
task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| task.2back | 2-Back, AgingCog_2-Back, AgingCog_2Back | character |
version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.2back | 1, 1.0.1, 1.0.2, 2 | character |
adrcneuroexam
Description :
Summary rating scores for parkinsonian motor symtpoms and PSP supranuclear ocular, limb, and gait function from ADRC research visit neurological exam
References :
Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.
Movement Disorder Society Task Force on Rating Scales for Parkinson’s Disease. (2003). The unified Parkinson’s disease rating scale (UPDRS): status and recommendations. Movement Disorders, 18(7), 738-750.
psp_gait
Description :
PSP Gait Rating Scale
References :
- Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| psp_gait.adrcneuroexam | numeric | 0 | 20 |
psp_limb
Description :
PSP Limb Rating Scale
References :
- Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| psp_limb.adrcneuroexam | numeric | 0 | 16 |
psp_oc
Description :
PSP Supranuclear Ocular Motor Rating Scale
References :
- Golbe, L. I., & Ohman-Strickland, P. A. (2007). A clinical rating scale for progressive supranuclear palsy. Brain, 130(6), 1552-1565.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| psp_oc.adrcneuroexam | numeric | 0 | 16 |
updrs
Description :
The Unified Parkinson’s Disease Rating Scale (UPDRS) Motor Score
References :
- Movement Disorder Society Task Force on Rating Scales for Parkinson’s Disease. (2003). The unified Parkinson’s disease rating scale (UPDRS): status and recommendations. Movement Disorders, 18(7), 738-750.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| updrs.adrcneuroexam | numeric | 0 | 77 |
apnea
Description :
ApneaLink records the following data: patient respiratory nasal airflow, snoring, blood oxygen saturation, pulse and respiratory effort during sleep.
apnea_hypopnea_index
Description :
Mean number of all apnea classes (unclassified, central, mixed, obstructive) and hypopneas per hour in the evaluation period, high AHI (>5) = high likelihood of OSA, low AHI (<5) = lower likelihood of OSA
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| apnea_hypopnea_index.apnea | numeric | 0.3 | 37.0 |
oxygen_desaturation_index
Description :
Mean value that shows the number of desaturations within the SpO2 evaluation period, high ODI (>5)= more desaturation events (more risk of OSA), low ODI (<5) = few desaturation events (lower risk of OSA)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| oxygen_desaturation_index.apnea | numeric | 0.0 | 34.5 |
bedside
Description :
The bedside cognitive screen was developed at the UCSF Memory & Aging Center (MAC). This battery of 21 measures has been designed to probe multiple cognitive domains (e.g., memory, executive function, language, visual-spatial function, and mood) in a time-limited fashion (typically 60 minutes). The specific tests utilized in the bedside have been developed to assist with the differential diagnosis of the most common referral questions at the MAC (e.g., Alzheimer’s Disease vs. Frontotemporal Dementia). The level of difficulty has been tailored to patients/research participants presenting with substantial cognitive deficits. Thus, the bedside screen may have low sensitivity to subtle cognitive deficits, especially for participants with high levels of education.
Animals
an_corr
Description :
Animals is a verbal fluency/generativity task requiring the participant to generate as many words as they can think of that belong to the semantic category ‘Animals’ in one minute. This variable captures the number of correct responses.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| an_corr.bedside | numeric | 0 | Infinity |
an_reps
Description :
Number of word repetitions on the semantic verbal fluency task (Animals)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| an_reps.bedside | numeric | 0 | Infinity |
an_rule_v
Description :
Number of rule violations on the semantic verbal fluency task (Animals) e.g., words that do not belong to the correct semantic category
| Variable Name | Type |
|---|---|
| an_rule_v.bedside | numeric |
Benson Figure
bensonrecall
Description :
The Benson figure is a simplified version of the Rey-Osterrieth complex figure. The participant is asked to make a copy of the figure, which they are asked to draw again from memory after a 10 minute delay. The recalled figure is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total). The recall condition is viewed as a task of visual memory. However, it should be noted that recall performance can be impacted by difficulties with visuo-constructional ability and/or a poorly organised approach (executive dysfunction) on the initial copy condition of the task.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bensonrecall.bedside | numeric | 0 | 17 |
bensonrecallz
Description :
Z-score for Benson Figure recall condition performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bensonrecallz.bedside | numeric | Infinity | Infinity |
mod_rey_b
Description :
An alternative version of the Benson figure (version B) is used. In this condition, the participant is asked to make a copy of the figure. The figure copy is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total).
| Variable Name | Type |
|---|---|
| mod_rey_b.bedside | numeric |
mod_rey
Description :
The Benson figure is a simplified version of the Rey-Osterrieth complex figure. In this condition the participant is asked to make a copy of the figure. The figure copy is scored for accuray (one point) and placement (one point) of eight different elements, with a bonus point given for a perfect copy (17 points total).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mod_rey.bedside | numeric | 0 | 17 |
rey_b_recg
Description :
Participant is asked to recognize the original benson figure (version B) they were presented with from 4 options. This score indicates whether they were able to accurately recognise the figure
| Label | Value |
|---|---|
| 0 | Incorrect |
| 1 | correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| rey_b_recg.bedside | 0, 1 | numeric | Incorrect, correct |
rey_b10m
Description :
Participant is asked to draw the benson figure (version B) from memory after a delay of 10-15 minutes. The drawing is scores for the accuracy (1 point) and placement (1 point) of 8 different elements, along with a bonus point given for a perfect copy (17 points total)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rey_b10m.bedside | numeric | 0 | 17 |
rey_recg
Description :
Participant is asked to recognize the original benson figure they were presented with from 4 options. This score indicates whether they were able to accurately recognise the figure
| Label | Value |
|---|---|
| 0 | Incorrect |
| 1 | correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| rey_recg.bedside | 0, 1 | numeric | Incorrect, correct |
rey10m
Description :
Participant is asked to draw the benson figure from memory after a delay of 10-15 minutes. The drawing is scores for the accuracy (1 point) and placement (1 point) of 8 different elements, along with a bonus point given for a perfect copy (17 points total)
References :
- *Duplicate of Bensonrecall.bedside. Delete?
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rey10m.bedside | numeric | 0 | 17 |
Boston Naming-15
bnt_corr
Description :
The 15-item version of the Boston Naiming Test (BNT) is a task which examines confrontational naming. The participant is required to name 15 different items presented as pictures, one at a time. This varibale represents the number of correct spontaneously named items (without any cueing).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bnt_corr.bedside | numeric | 0 | 15 |
bnt_mult
Description :
Number of correct items named following a multiple choice cue (e.g., is it a bed, bell or bear?) on the 15-item version of the Boston Naming Test (BNT)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bnt_mult.bedside | numeric | 0 | 15 |
bnt_num_s
Description :
Number of semantic cues given (e.g., it’s a piece of furniture) on the 15-item version of the Boston Naming Test (BNT)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bnt_num_s.bedside | numeric | 0 | 15 |
bnt_phon
Description :
Number of correct items named following a phonemic cue (e.g., it starts with “be”) on the 15-item version of the Boston Naming Test (BNT)
| Variable Name | Type |
|---|---|
| bnt_phon.bedside | numeric |
bnt_stim
Description :
Number of correct items named following a semantic cue (e.g., it’s a piece of furniture) on the 15-item version of the Boston Naming Test (BNT)
| Variable Name | Type |
|---|---|
| bnt_stim.bedside | numeric |
bnt_tot
Description :
The total score for the 15-item version of the Boston Naming Test (BNT) is the number of correct spontaneously named items (uncued) + the number of correctly named items with a semantic cue.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bnt_tot.bedside | numeric | 0 | 15 |
Composites
bsexzscore
Description :
A composite z-score for executive functioning tasks in the bedside battery. This composite includes 1) total number of items recalled on the interference condition of the Stroop task (strp_cor.bedside), Digits Backwards span (digit_bw.bedside), Modified Trails total completion time (mt_time.bedside), total number of correct words generated in D Words (d_corr.bedside), and total correct designs generated in Design Fluency (df_corr.bedside).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bsexzscore.bedside | numeric | Infinity | Infinity |
memoryzscore
Description :
A composite z-score for memory tasks in the bedside battery. This composite includes 1) Summed total of words recalled across all five learning trails of the CVLT-II, 2) words spontaneously recalled following a long delay on the CVLT-II (cv2lfrc.bedside), 3) CVLT-II recognition discriminability (cv2rd.bedside), 4) recall score for the Benson figure following a long delay (bensonrecall.bedside).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| memoryzscore.bedside | numeric | Infinity | Infinity |
CVLT-BF
corr_long
Description :
An optional sub-measure indicating total correct words spontaeously recalled following a long (unspecified) delay. If administered, this is usually collected upon the completion of the testing session.
| Variable Name | Type |
|---|---|
| corr_long.bedside | numeric |
corr10
Description :
Total correct words spontaeously recalled following a 10-minute delay
| Variable Name | Type |
|---|---|
| corr10.bedside | numeric |
corr30
Description :
Total correct words spontaeously recalled following a 30 second delay (with distractor task)
| Variable Name | Type |
|---|---|
| corr30.bedside | numeric |
cue_intr
Description :
Total number of intrusion errors (incorrect words) recalled following a 10-minute delay with the provision of category cues (e.g., “tell me all of the words from the list that are fruits”)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cue_intr.bedside | numeric | 0 | Infinity |
cued_cor
Description :
Total number of correct words recalled following a 10-minute delay with the provision of category cues (e.g., “tell me all of the words from the list that are fruits”)
| Variable Name | Type |
|---|---|
| cued_cor.bedside | numeric |
intr_long
Description :
An optional sub-measure indicating total number of intrusion errors (incorrect words) spontaeously recalled following a long (unspecified) delay. If administered, this is usually collected upon the completion of the testing session.
| Variable Name | Type |
|---|---|
| intr_long.bedside | numeric |
intr10
Description :
Total number of intrusion errors (incorrect words) spontaeously recalled following a 10-minute delay
| Variable Name | Type |
|---|---|
| intr10.bedside | numeric |
intr30
Description :
Total number of intrusion errors (incorrect words) spontaeously recalled following a 30-second delay (with distractor task).
| Variable Name | Type |
|---|---|
| intr30.bedside | numeric |
recog_fp
Description :
Total number of false positive errors (incorrect words recalled) when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| recog_fp.bedside | numeric | 0 | 18 |
recog_np
Description :
Total number of ‘novel prototype’ words (e.g., novel words belonging to the same category) incorrectly recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.
| Variable Name | Type |
|---|---|
| recog_np.bedside | numeric |
recog_nu
Description :
Total number of ‘novel unrelated’ words (e.g., novel words unrelated to those on the original list) incorrectly recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.
| Variable Name | Type |
|---|---|
| recog_nu.bedside | numeric |
recog
Description :
Total number of correct words recalled when the participant is presented with a recognition (Yes/No) format. Administered at the end of the CVLT-SF task.
| Variable Name | Type |
|---|---|
| recog.bedside | numeric |
t1corr
Description :
The California Verbal Learning Test, Brief Form (CVLT-BF) is a 9-item list learning task. Four learning trails are first administered where the examiner reads the word list out loud and the participant is asked to recall as many words as they can from the list following each repetition. Following the learning trials, a distractor task requires the participant to count backwards from 100 for 30 seconds. Immediatley following the distractor task the participant is then asked to recall as many items from the list as they can. Then, following a 10-minute delay, the participant is again asked to recall as many words from the list as they can, following by a cued recall condition (i.e., “tell me all the owrds from the list that were fruits”) and a recognition (Yes/No) condition. The task also includes an optional long delay condition (timing unspecified) where the participant is again asked to recall as many words from the list as they can at the conclusion of the testing session. This variable represents the total correct words recalled on learning trial 1.
| Variable Name | Type |
|---|---|
| t1corr.bedside | numeric |
t1intr
Description :
Total intrusions (incorrect words) incorrectly recalled on learning trial 1
| Variable Name | Type |
|---|---|
| t1intr.bedside | numeric |
t2corr
Description :
Total correct words recalled on learning trial 2
| Variable Name | Type |
|---|---|
| t2corr.bedside | numeric |
t2intr
Description :
Total intrusions (incorrect words) incorrectly recalled on learning trial 2
| Variable Name | Type |
|---|---|
| t2intr.bedside | numeric |
t3corr
Description :
Total correct words recalled on learning trial 3
| Variable Name | Type |
|---|---|
| t3corr.bedside | numeric |
t3intr
Description :
Total intrusions (incorrect words) incorrectly recalled on learning trial 3
| Variable Name | Type |
|---|---|
| t3intr.bedside | numeric |
t4corr
Description :
Total correct words recalled on learning trial 4
| Variable Name | Type |
|---|---|
| t4corr.bedside | numeric |
t4intr
Description :
Total intrusions (incorrect words) incorrectly recalled on learning trial 4
| Variable Name | Type |
|---|---|
| t4intr.bedside | numeric |
tr_co_tot
Description :
Sum of total correct words recalled across learning trails 1-4
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tr_co_tot.bedside | numeric | 0 | 36 |
CVLT-II
cv2b_r
Description :
Distractor list (list B) related false positives
| Variable Name | Type |
|---|---|
| cv2b_r.bedside | numeric |
cv2b_u
Description :
Distractor list (list B) unrelated false positives
| Variable Name | Type |
|---|---|
| cv2b_u.bedside | numeric |
cv2bias
References :
- *Unclear what this refers to
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2bias.bedside | numeric | 0.000 | -1.863 |
cv2dprime
References :
- *Unclear what this refers to
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2dprime.bedside | numeric | 0.000 | -0.384 |
cv2dprimez
References :
- *Unclear what this refers to
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2dprimez.bedside | numeric | 0.021 | -4.917 |
cv2form
Description :
Indicates the form of the CVLT2 that was administered (Form A or B)
| Label | Value |
|---|---|
| A | A |
| B | B |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| cv2form.bedside | A, B | character | A, B |
cv2fptot
Description :
Total false positive responses for List A when participant is presented with a recognition (Yes/No) format
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2fptot.bedside | numeric | 0 | 16 |
cv2hit
Description :
Total correct words recalled from List A when participant is presented with a recognition (Yes/No) format
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2hit.bedside | numeric | 0 | 16 |
cv2lcc
Description :
Total correct words recalled from List A following a long delay (20 min) in cued condition i.e., “Tell me all the words from the list that are furniture”.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2lcc.bedside | numeric | 0 | 16 |
cv2lci
Description :
Total intrusions (incorrect words) recalled for List A following a long delay (20 min) in cued condition i.e., “Tell me all the words from the list that are furniture”.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2lci.bedside | numeric | 0 | Infinity |
cv2lfrc
Description :
Total correct words spontaneously recalled from List A following a long delay (20 min)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2lfrc.bedside | numeric | 0 | 16 |
cv2lfrcz
Description :
Z-score for correct words spontaneously recalled from List A following a long delay (20 min)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2lfrcz.bedside | numeric | Infinity | Infinity |
cv2lfri
Description :
Total intrusions (incorrect words) spontaneously recalled for List A following a long delay (20 min)
| Variable Name | Type |
|---|---|
| cv2lfri.bedside | numeric |
cv2np
Description :
Total ‘novel prototype’ words (e.g., novel words belonging to the same category) incorrectly recalled when the participant is presented with a recognition (Yes/No) format for List A.
| Variable Name | Type |
|---|---|
| cv2np.bedside | numeric |
cv2nu
Description :
Total ‘novel unrelated’ words (e.g., novel words unrelated to those on List A) incorrectly recalled when the participant is presented with a recognition (Yes/No) format.
| Variable Name | Type |
|---|---|
| cv2nu.bedside | numeric |
cv2pfp
References :
- *Unclear what this refers to
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2pfp.bedside | numeric | 0.016 | 0.969 |
cv2phit
References :
- *Unclear what this refers to
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2phit.bedside | numeric | 0.031 | 0.969 |
cv2rd
Description :
Recognition discriminibility (d’) for List A = z(hits) - z(false positive errors).
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2rd.bedside | 0, 3, 4 | numeric |
cv2sdcc
Description :
Total correct words recalled from List A following a short delay (immediatley after distractor trial B) in cued condition i.e., “Tell me all the words from the list that are furniture”.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2sdcc.bedside | numeric | 0 | 16 |
cv2sdci
Description :
Total intrusions (incorrect words) recalled for List A following a short delay (immedatley after distractor trial B) in cued condition i.e., “Tell me all the words from the list that are furniture”.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2sdci.bedside | numeric | 0 | Infinity |
cv2sfrc
Description :
Total correct words from List A recalled spontaneously following a short delay (immediatley after distractor trial B)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2sfrc.bedside | numeric | 0 | 16 |
cv2sfri
Description :
Total intrusions (incorrect words) spontaeously recalled following a short delay (immediatley after distractor trial B)
| Variable Name | Type |
|---|---|
| cv2sfri.bedside | numeric |
cv2t1c
Description :
The California Verbal Learning Test, second edition (CVLT-II) is a 16-item list learning task. Five learning trails are first administered where the examiner reads a word list (List A) out loud and the participant is asked to recall as many words as they can from the list following each repetition. Following the learning trials, a distractor list (List B) is read allowed by the examiner and the participant is asked to recall as many words as they can from List B only. Immediatley following this task (short delay), the participant is again required to recall as many words as they can from List A only. A cued condition following the short delay is also administered (i.e., “tell me all the words from the list that are furniture”). Then, following a 20-minute delay (long delay), the participant is again asked to recall as many words from List A as they can, following by the cued recall condition (i.e., “tell me all the words from the list that are furniture”) and a recognition (Yes/No) condition. This variable represents the total correct words recalled on learning trial 1 (List A).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t1c.bedside | numeric | 0 | 16 |
cv2t1i
Description :
Total intrusions (incorrect words) recalled on learning trial 1 (List A)
| Variable Name | Type |
|---|---|
| cv2t1i.bedside | numeric |
cv2t2c
Description :
Total correct words recalled on learning trial 2 (List A)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t2c.bedside | numeric | 0 | 16 |
cv2t2i
Description :
Total intrusions (incorrect words) recalled on learning trial 2 (List A)
| Variable Name | Type |
|---|---|
| cv2t2i.bedside | numeric |
cv2t3c
Description :
Total correct words recalled on learning trial 3 (List A)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t3c.bedside | numeric | 0 | 16 |
cv2t3i
Description :
Total intrusions (incorrect words) recalled on learning trial 3 (List A)
| Variable Name | Type |
|---|---|
| cv2t3i.bedside | numeric |
cv2t4c
Description :
Total correct words recalled on learning trial 4 (List A)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t4c.bedside | numeric | 0 | 16 |
cv2t4i
Description :
Total intrusions (incorrect words) recalled on learning trial 4 (List A)
| Variable Name | Type |
|---|---|
| cv2t4i.bedside | numeric |
cv2t5c
Description :
Total correct words recalled on learning trial 5 (List A)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2t5c.bedside | numeric | 0 | 16 |
cv2t5i
Description :
Total intrusions (incorrect words) recalled on learning trial 5 (List A)
| Variable Name | Type |
|---|---|
| cv2t5i.bedside | numeric |
cv2tb_c
Description :
Total correct words recalled from List B
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2tb_c.bedside | numeric | 0 | 16 |
cv2tb_i
Description :
Total intrusions (incorrect words) recalled from List B
| Variable Name | Type |
|---|---|
| cv2tb_i.bedside | numeric |
cv2zfp
Description :
Z-score for total false positive responses for List A when participant is presented with a recognition (Yes/No) format
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2zfp.bedside | numeric | Infinity | Infinity |
cv2zhit
Description :
Z-score for total correct words recalled for List A when participant is presented with a recognition (Yes/No) format
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2zhit.bedside | numeric | Infinity | Infinity |
D Words
d_corr
Description :
A verbal fluency/generativity task requiring the participant to generate as many words as they can think of that begin with the letter ‘D’ (a phonemic category) in one minute. Participants are not permitted to give names of people or places, and must not give the same word with different endings (e.g., bake, baked, baking). This variable captures the number of correct responses generated.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| d_corr.bedside | numeric | 0 | Infinity |
d_reps
Description :
Number of word repetitions on the phonemic verbal fluency task (d words)
| Variable Name | Type |
|---|---|
| d_reps.bedside | numeric |
d_rule_v
Description :
Number of rule violations on the phonemic verbal fluency task (d words). Rule violations include giving words that do not start with the letter ‘D’, giving the names of people or places, or repeating a word with different endings (e.g., bake, baked, baking).
| Variable Name | Type |
|---|---|
| d_rule_v.bedside | numeric |
dcorrz
Description :
Z-score for D Words performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dcorrz.bedside | numeric | Infinity | Infinity |
Design Fluency
df_co_rep
Description :
Number of repeated correct designs
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| df_co_rep.bedside | numeric | 0 | 34 |
df_corr
Description :
Design Fluency is the Filled Dots condition from the Delis-Kaplan Executive Function Scale (DKEFS), measuring visual generativity. Participants are asked to generate as many different designs as they can in one minute by connecting dots with four straight lines. This task involves the ability to generate novel designs, remember the rules, accurately monitor for repetitions, and perform necessary shifting. Decreased processing speed may also cause poor performance.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| df_corr.bedside | numeric | 0 | 35 |
df_rule_v
Description :
Total number of unique rule violations
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| df_rule_v.bedside | numeric | 0 | 35 |
DFCorrz
Description :
Z-score for Design Fluency performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| DFCorrz.bedside | numeric | Infinity | Infinity |
dfrv_rep
Description :
Number of repeated rule violations
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dfrv_rep.bedside | numeric | 0 | 34 |
Digit Span
digit_bw
Description :
Digits Backwards was adapted from the version present in the WAIS-III and is considered a task of working memory. The examiner reads a string of numbers and the participant is asked to repeat them in backwards order. The length of the number string increases until the participant can no longer complete the task correctly. The bedside version of this task is focused on recording span length (number of digits that can be reversed correctly), rather than total number of items correct. This task requires both the adequate short-term store of verbal information (i.e., representing the presented digits forward) and the ability to manipulate that information within working memory (i.e., the backwards transform).
| Variable Name | Type |
|---|---|
| digit_bw.bedside | numeric |
digit_fw
Description :
Digits Forwards was adapted from the version present in the WAIS-III and is considered a task of basic attention span. The examiner reads a string of numbers and the participant is asked to repeat them in the same order. The length of the number string increases until the participant can no longer complete the task correctly. The bedside version of this task is focused on recording span length (number of digits that can be recalled correctly), rather than total number of items correct. Patients with reduced levels of attention (e.g., delirium) or reduced short-term auditory store (e.g., logopenic PPA) will do poorly on this task. Patients with reduced forward span will likely due poorly on many other tasks due to an inability to effectively maintain auditorily-presented instructions and/or more general difficulties with attention.
| Variable Name | Type |
|---|---|
| digit_fw.bedside | numeric |
DigitBWz
Description :
Z-score for Digits Backwards performance
| Variable Name | Type |
|---|---|
| DigitBWz.bedside | numeric |
Geriatric Depression Scale
gds_tot
Description :
Sum of scores for all 30 items of the GDS
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gds_tot.bedside | numeric | 0 | 30 |
gds1
Description :
The GDS is a self-reported scale of current depressive symptoms. Participants are asked to rate a series of 30 statements as ‘Yes’ or ‘No’ regarding how they have been feeling in the previous two weeks. GDS item 1: “Are you basically satisfied with your life?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds1.bedside | 0, 1 | numeric | Yes, No |
gds10
Description :
GDS item 10: “Do you often feel helpless?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds10.bedside | 0, 1 | numeric | Yes, No |
gds11
Description :
GDS item 11: “Do you often get restless and fidgety?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds11.bedside | 0, 1 | numeric | Yes, No |
gds12
Description :
GDS item 12: “Do you prefer to stay at home rather than go out and do things?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds12.bedside | 0, 1 | numeric | Yes, No |
gds13
Description :
GDS item 13: “Do you frequently worry about the future?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds13.bedside | 0, 1 | numeric | Yes, No |
gds14
Description :
GDS item 14: “Do you feel you have problems with memory more than most?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds14.bedside | 0, 1 | numeric | Yes, No |
gds15
Description :
GDS item 15: “Do you think it is wonderful to be alive now?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds15.bedside | 0, 1 | numeric | Yes, No |
gds15to
Description :
Sum of scores for the 15 items included in the Geriatric Depression Scale, short form (15-items)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gds15to.bedside | numeric | 0 | 15 |
gds16
Description :
GDS item 16: “Do you feel downhearted and blue?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds16.bedside | 0, 1 | numeric | Yes, No |
gds17
Description :
GDS item 17: “Do you feel pretty worthless the way you are now?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds17.bedside | 0, 1 | numeric | Yes, No |
gds18
Description :
GDS item 18: “Do you worry a lot about the past?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds18.bedside | 0, 1 | numeric | Yes, No |
gds19
Description :
GDS item 19: “Do you find life very exciting?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds19.bedside | 0, 1 | numeric | Yes, No |
gds2
Description :
GDS item 2: “Have you dropped many of your activities and interests?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds2.bedside | 0, 1 | numeric | Yes, No |
gds20
Description :
GDS item 20: “Is it hard for you to get started on new projects?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds20.bedside | 0, 1 | numeric | Yes, No |
gds21
Description :
GDS item 21: “Do you feel full of energy?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds21.bedside | 0, 1 | numeric | Yes, No |
gds22
Description :
GDS item 22: “Do you feel that your situation is hopeless?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds22.bedside | 0, 1 | numeric | Yes, No |
gds23
Description :
GDS item 23: “Do you think that most people are better off than you are?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds23.bedside | 0, 1 | numeric | Yes, No |
gds24
Description :
GDS item 24: “Do you frequently get upset over little things?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds24.bedside | 0, 1 | numeric | Yes, No |
gds25
Description :
GDS item 25: “Do you frequently feel like crying?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds25.bedside | 0, 1 | numeric | Yes, No |
gds26
Description :
GDS item 26: “Do you have trouble concentrating?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds26.bedside | 0, 1 | numeric | Yes, No |
gds27
Description :
GDS item 27: “Do you enjoy getting up in the morning?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds27.bedside | 0, 1 | numeric | Yes, No |
gds28
Description :
GDS item 28: “Do you prefer to avoid social occasions?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds28.bedside | 0, 1 | numeric | Yes, No |
gds29
Description :
GDS item 29: “Is it easy for you to make decisions?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds29.bedside | 0, 1 | numeric | Yes, No |
gds3
Description :
GDS item 3: “Do you feel that your life is empty?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds3.bedside | 0, 1 | numeric | Yes, No |
gds30
Description :
GDS item 30: “Is your mind as clear as it used to be?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds30.bedside | 0, 1 | numeric | Yes, No |
gds4
Description :
GDS item 4: “Do you often get bored?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds4.bedside | 0, 1 | numeric | Yes, No |
gds5
Description :
GDS item 5: “Are you hopeful about the future?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds5.bedside | 0, 1 | numeric | Yes, No |
gds6
Description :
GDS item 6: “Are you bothered by thoughts you can’t get out of your head?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds6.bedside | 0, 1 | numeric | Yes, No |
gds7
Description :
GDS item 7: “Are you in good spirits most of the time?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds7.bedside | 0, 1 | numeric | Yes, No |
gds8
Description :
GDS item 8: “Are you afraid that something bad is going to happen to you?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds8.bedside | 0, 1 | numeric | Yes, No |
gds9
Description :
GDS item 9: “Do you feel happy most of the time?”
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gds9.bedside | 0, 1 | numeric | Yes, No |
Mini Mental State Exam
mmse_tot
Description :
The Mini Mental State Exam is a brief screening measure of global cognitive functioning (orientation, memory, language, executive function, visuospatial skills). Performance is scored out of a possible total of 30 points. The widely accepted cut off score to screening for cognitive impairment on the MMSE is <26.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mmse_tot.bedside | numeric | 0 | 30 |
Modified Trails
mt_corr
Description :
Total number of correct switches made on the Modified Trail Making Task
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mt_corr.bedside | numeric | 0 | 14 |
mt_error
Description :
Total number of switching errors made on the Modified Trail Making Test
| Variable Name | Type |
|---|---|
| mt_error.bedside | numeric |
mt_ln
References :
- *Unclear what this is - delete?
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mt_ln.bedside | numeric | Inf | 4.796 |
mt_ratio
Description :
A ratio measure representing number of correct lines per minute
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mt_ratio.bedside | numeric | Infinity | Infinity |
mt_time
Description :
The Modified Trail Making Test (MTT) is an adapted version of the traditional Trail Making Test (e.g., from the Delis-Kaplan Executive Function Scale), and is designed to be sensitive to problems with mentally manipulating information, including sequencing and cognitive flexibility. Numbers and days of the week are presented in an random pattern on an A4 sheet of paper and participants are asked to draw a line alternating between numbers and days of the week in order, as quickly as they can (maximum of 120 seconds allowed). Although classically thought of as a task of executive function, the MTT task requires multiple cognitive processes, including visual scanning, speed of processing, and set-shifting abilities. Thus, impairment on this task can be due to a variety of causes. This variable represents the total time (in seconds) taken to complete the task.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mt_time.bedside | numeric | 0 | 120 |
MTTimez
Description :
Z-score for Modified Trails performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| MTTimez.bedside | numeric | Infinity | Infinity |
Number Location
numb_loc
Description :
The Number Location test is a subtest on the Visual-Object Spatial Perception Test (VOSP). A box with the numbers 1-9 scattered in random positions is located above another box with a single dot that matches the location (within the box) of one on the numbers above. The participant is asked to identify the number that matches the position of the dot. A total of 10 trials are administered. This task is considered a measure of visuo-perception (dorsal visual stream function), however, patients can frequently demonstrate difficulties on this task due to an inability to understand the abstract nature of the task instructions and/or impulsivity regarding their decision-making.
| Variable Name | Type |
|---|---|
| numb_loc.bedside | numeric |
Stroop
strp_cn_cor
Description :
The Stroop task requires participants to state the colour of ink in which blocks of letters are printed in as quickly as they can. In the color naming condition, blocks of X’s are presented in either blue, green or red across a page. The participant is asked to state the color of the ink the blocks of letters are printed in as quickly as they can without making mistakes. A total of 60 seconds is allowed. This score represents the number of correctly named colors within 60 seconds. This task is considered a measure of information processing speed.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cn_cor.bedside | numeric | 0 | 126 |
strp_cn_err
Description :
Total number of errors made on Stroop (color naming condition)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cn_err.bedside | numeric | 0 | 126 |
strp_cor
Description :
The Stroop task requires participants to state the colour of ink in which blocks of letters are printed in as quickly as they can. In the interference condition, the blocks of letters spell the word of a colour that is different to the colour of the ink the word is printed in. This task is viewed as a measure of executive functioning because the patient has to inhibit the overlearned/automatic reading response, and instead focus on the perceptual attributes of the stimuli (i.e., name the color of the ink). Deficits in response inhibition can be subtle, reflected in disproportionate slowing in color naming on the interference condition relative to the color naming condition, or as frank errors (i.e., reading the words). Thus, comparative analysis of speed between the color naming condition and interference condition are helpful.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cor.bedside | numeric | 0 | 77 |
strp_err
Description :
Total number of uncorrected errors made on Stroop (interference condition)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_err.bedside | numeric | 0 | 77 |
strp_sce
Description :
Total number of self-corrected errors made on Stroop (interference condition)
| Variable Name | Type |
|---|---|
| strp_sce.bedside | numeric |
StrpCorz
Description :
Z-score for Stroop (interference condition) performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| StrpCorz.bedside | numeric | Infinity | Infinity |
WRAT
wrat_baseline_date
Description :
Date of the particpant’s baseline WRAT performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_baseline_date.bedside | Date | N/A | N/A |
wrat_baseline
Description :
This task is adapted from the Wide Range Achievement Test-Fourth Edition (WRAT-4) and provides an estimate of premorbid verbal skills and reading level. 55 words of increasing length/difficulty are presented on a page and the participant is asked to pronounce each one. The task is discontinued if the participant makes 10 consecutive errors. If the participant can not pronounce at least 5 words on the task, they are asked to identify 15 single letters (when administration of letters is not required, 15 points is added to the total score). The total possible score on this task is therefore 70 (55 + 15). This variable represents the participants WRAT score at their baseline research visit.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_baseline.bedside | numeric | 0 | 70 |
wrat_on_or_before_current_date
Description :
Stating whether current visit is on or before the baseline WRAT
References :
- *Possibly delete?
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wrat_on_or_before_current_date.bedside | FALSE, TRUE | logical |
wrat_tot
Description :
Total WRAT score on the current research assessment
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_tot.bedside | numeric | 0 | 70 |
wrat_baseline_date
Description :
Date of the particpant’s baseline WRAT performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_baseline_date.bedside | Date | N/A | N/A |
wrat_baseline
Description :
This task is adapted from the Wide Range Achievement Test-Fourth Edition (WRAT-4) and provides an estimate of premorbid verbal skills and reading level. 55 words of increasing length/difficulty are presented on a page and the participant is asked to pronounce each one. The task is discontinued if the participant makes 10 consecutive errors. If the participant can not pronounce at least 5 words on the task, they are asked to identify 15 single letters (when administration of letters is not required, 15 points is added to the total score). The total possible score on this task is therefore 70 (55 + 15). This variable represents the participants WRAT score at their baseline research visit.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_baseline.bedside | numeric | 0 | 70 |
wrat_on_or_before_current_date
Description :
Stating whether current visit is on or before the baseline WRAT
References :
- *Possibly delete?
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wrat_on_or_before_current_date.bedside | FALSE, TRUE | logical |
wrat_tot
Description :
Total WRAT score on the current research assessment
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wrat_tot.bedside | numeric | 0 | 70 |
berlin_sleep
Berlin_apneaRisk
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Berlin_apneaRisk.berlin_sleep | high risk, low risk | character |
brainhealthassessment
Description :
The Brain Health Assessment (BHA) battery is part of the Tablet-based Cognitive Assessment Tool (TabCAT). This battery includes two required tests (Favorites, Match), two optional tests (Line Orientation, Animal Fluency), and an optional informant survey (Brain Health Survey [BHS]).
References :
- Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.
digitsymbol_corr
Description :
Total correct score for Match, which follows a digit-symbol test paradigm. This task requires multiple cognitive processes, including processing speed, working memory, and visual scanning, and thus is sensitive to executive dysfunction.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digitsymbol_corr.brainhealthassessment | numeric | 0 | 200 |
digitsymbol_err
Description :
Total errors made during Match
| Variable Name | Type |
|---|---|
| digitsymbol_err.brainhealthassessment | numeric |
favorites_delay
Description :
Favorites is an associative memory test. This is the total correct at a 10-minute delay.
| Variable Name | Type |
|---|---|
| favorites_delay.brainhealthassessment | numeric |
favorites_recall1
Description :
Favorites is an associative memory test. This is the total correct at the first immediate recall trial.
| Variable Name | Type |
|---|---|
| favorites_recall1.brainhealthassessment | numeric |
favorites_recall2
Description :
Favorites is an associative memory test. This is the total correct at the second immediate recall trial.
| Variable Name | Type |
|---|---|
| favorites_recall2.brainhealthassessment | numeric |
favorites_recog_corr
Description :
Favorites is an associative memory test. This is the total correct at the 10-minute delay recognition trial.
| Variable Name | Type |
|---|---|
| favorites_recog_corr.brainhealthassessment | numeric |
favorites_recog_err
Description :
Favorites is an associative memory test. This is the number of intrusion errors at the 10-minute delay recognition trial (i.e., a previously learned face incorrectly paired with a novel food or animal).
| Variable Name | Type |
|---|---|
| favorites_recog_err.brainhealthassessment | numeric |
favorites_recog_sme
Description :
Favorites is an associative memory test. This is the number of source memory errors at the 10-minute delay recognition trial (i.e., a previously learned food or animal incorrectly paired with a difference face).
| Variable Name | Type |
|---|---|
| favorites_recog_sme.brainhealthassessment | numeric |
favorites_total
Description :
Favorites is an associative memory test. This is the Total Recall score, which is the total number correct summed across the two immediate recall and one 10-minute delayed recall trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_total.brainhealthassessment | numeric | 0 | 24 |
lo_catchtrial
Description :
TabCAT BHA Line Orientation is modeled after the Benton Judgment of Line Orientation Task. 10 easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicate that the Threshold Score may not be valid.
| Variable Name | Type |
|---|---|
| lo_catchtrial.brainhealthassessment | numeric |
lo_score
Description :
TabCAT BHA Line Orientation is modeled after the Benton Judgment of Line Orientation Task. This is the Threshold Score, which represents the average angle difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_score.brainhealthassessment | numeric | 1 | 90 |
par_line_catchtrial
Description :
TabCAT BHA Line Length is a visuospatial test in which examinees have to select the longer of two parallel lines. 10 very easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicates that the Threshold Score may not be valid.
| Variable Name | Type |
|---|---|
| par_line_catchtrial.brainhealthassessment | numeric |
par_line_score
Description :
TabCAT BHA Line Length is a visuospatial test in which examinees have to select the longer of two parallel lines. This is the Threshold Score, which represents the average length difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| par_line_score.brainhealthassessment | numeric | Anything > 0 | Infinity |
v_type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| v_type.brainhealthassessment | on-site | character |
bu_tbi
bu_amfball_yn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_amfball_yn.bu_tbi | 0, 1, 2 | numeric |
bu_amfball_yrs_ages
| Variable Name | Type |
|---|---|
| bu_amfball_yrs_ages.bu_tbi | numeric |
bu_boxing_yn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_boxing_yn.bu_tbi | 0, 1, 2 | numeric |
bu_boxing_yrs_selfreport
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_boxing_yrs_selfreport.bu_tbi | 1 | numeric |
bu_concussion_agelast
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bu_concussion_agelast.bu_tbi | numeric | 0 | -99 |
bu_concussiontotal_maxest
| Variable Name | Type |
|---|---|
| bu_concussiontotal_maxest.bu_tbi | numeric |
bu_icehockey_yn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_icehockey_yn.bu_tbi | 0, 1, 2 | numeric |
bu_icehockey_yrs_ages_all
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_icehockey_yrs_ages_all.bu_tbi | 0, 12 | numeric |
bu_military_blast100_total
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_military_blast100_total.bu_tbi | 0, 1, 2, 16, 44 | numeric |
bu_military_highrisk_yn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_military_highrisk_yn.bu_tbi | 0, 1 | numeric |
bu_military_yn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_military_yn.bu_tbi | 0, 1 | numeric |
bu_military_yrs
| Variable Name | Type |
|---|---|
| bu_military_yrs.bu_tbi | numeric |
bu_soccer_yn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bu_soccer_yn.bu_tbi | 0, 1, 2 | numeric |
bu_soccer_yrs_selfreport
| Variable Name | Type |
|---|---|
| bu_soccer_yrs_selfreport.bu_tbi | numeric |
cdr
Description :
The Clinical Dementia Rating is a 5-point scale used to characterize six domains of cognitive and functional performance applicable to Alzheimer disease and related dementias: Memory, Orientation, Judgment & Problem Solving, Community Affairs, Home & Hobbies, and Personal Care.
References :
- Morris, J. C. (1997). Clinical dementia rating: a reliable and valid diagnostic and staging measure for dementia of the Alzheimer type. International psychogeriatrics, 9(S1), 173-176.
cdr_box
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cdr_box.cdr | numeric | 0.0 | 18.0 |
cdr_global
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cdr_global.cdr | 0.0, 0.5, 1.0, 2.0, 3.0 | numeric |
ftld_cdr_box
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ftld_cdr_box.cdr | numeric | 0.0 | 24.0 |
ftld_cdr_global
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ftld_cdr_global.cdr | 0.0, 0.5, 1.0, 2.0, 3.0 | numeric |
champs
Description :
The Community Healthy Activities Model Program for Seniors physical activity questionnaire (CHAMPS) assesses the variety of physical activity that older adult participants may engage in, from less intensive forms such as walking or stretching to more vigorous exercise routine. The questionnaire includes 41 items to evaluate the frequency and duration of light, moderate, and vigorous activities that were performed weekly over the last four weeks. Individuals will select whether they participated in an activity during the four-week period and then select the hours per week spent participating in the activity, rating the duration on a 6-point scale from less than 1 hour to 9 or more hours. Each activity corresponds to a metabolic weight or MET value. Estimated caloric expenditure is then calculated by multiplying the estimated duration of each activity by the corresponding MET value.
References :
- Stewart, A. L., Mills, K. M., King, A. C., Haskell, W. L., Gillis, D., & Ritter, P. L. (2001). CHAMPS physical activity questionnaire for older adults: outcomes for interventions. Medicine and science in sports and exercise, 33(7), 1126–1141. https://doi.org/10.1097/00005768-200107000-00010
DCDate_physical
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| DCDate_physical.champs | Date | 2015-05-21 | 2023-04-26 |
METWeightcompleted
| Variable Name | Type |
|---|---|
| METWeightcompleted.champs | numeric |
METWeighted_Q13
Description :
MET weighted score for ch11 (Errands). Score is creating by taking the estimated duration of running errands (0.5 - 9.75)*met value of 2.5
| Variable Name | Type |
|---|---|
| METWeighted_Q13.champs | numeric |
METWeighted_Q15
Description :
MET weighted score for ch13 (golf). Score is creating by taking the estimated duration of time playing golf (0.5 - 9.75)*met value of 2.5
| Variable Name | Type |
|---|---|
| METWeighted_Q15.champs | numeric |
METWeighted_Q20
Description :
MET weighted score for ch18 (tennis). Score is creating by taking the estimated duration of time playing tennis (0.5 - 9.75)*met value of 5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q20.champs | 2.50, 8.75, 18.75, 28.75, 48.75 | numeric |
METWeighted_Q21
Description :
MET weighted score for ch19 (skateboarding). Score is creating by taking the estimated duration of time skateboarding (0.5 - 9.75)*met value of 4.5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q21.champs | 4 | numeric |
METWeighted_Q24
Description :
MET weighted score for ch22 (chores). Score is creating by taking the estimated duration of time doing chores (0.5 - 9.75)*met value of 2.75
| Variable Name | Type |
|---|---|
| METWeighted_Q24.champs | numeric |
METWeighted_Q25
Description :
MET weighted score for ch23 (gardening). Score is creating by taking the estimated duration of time gardening (0.5 - 9.75)*met value of 3.125
| Variable Name | Type |
|---|---|
| METWeighted_Q25.champs | numeric |
METWeighted_Q26
Description :
MET weighted score for ch24 (car). Score is creating by taking the estimated duration of time working on car/lawn/machinery (0.5 - 9.75)*met value of 3
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q26.champs | 1.50, 5.25, 11.25, 29.25 | numeric |
METWeighted_Q27
Description :
MET weighted score for ch25 (jogrun). Score is creating by taking the estimated duration of time jogging or running (0.5 - 9.75)*met value of 7
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q27.champs | 3.50, 12.25, 26.25, 40.25, 68.25 | numeric |
METWeighted_Q28
Description :
MET weighted score for ch26 (briskwalk). Score is creating by taking the estimated duration of time brisk walking (0.5 - 9.75)*met value of 3.5
| Variable Name | Type |
|---|---|
| METWeighted_Q28.champs | numeric |
METWeighted_Q29
Description :
MET weighted score for ch27 (leisure walk). Score is creating by taking the estimated duration of time leisurely walking (0.5 - 9.75)*met value of 2.5
| Variable Name | Type |
|---|---|
| METWeighted_Q29.champs | numeric |
METWeighted_Q30
Description :
MET weighted score for ch28 (bike ). Score is creating by taking the estimated duration of time riding a bike (0.5 - 9.75)*met value of 4
| Variable Name | Type |
|---|---|
| METWeighted_Q30.champs | numeric |
METWeighted_Q31
Description :
MET weighted score for ch29 (aero). Score is creating by taking the estimated duration of time doing aerobics, rowing, step machines (not treadmill or stationary bike)!! (0.5 - 9.75)*met value of 5
| Variable Name | Type |
|---|---|
| METWeighted_Q31.champs | numeric |
METWeighted_Q32
Description :
MET weighted score for ch30 (swim). Score is creating by taking the estimated duration of time swimming (not treadmill or stationary bike)!! (0.5 - 9.75)*met value of 3.66
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q32.champs | 1.8330, 6.4155, 13.7475, 21.0795 | numeric |
METWeighted_Q33
Description :
MET weighted score for ch31 (flexb). Score is creating by taking the estimated duration of time doing stretching or flexibility exercises (not yoga or tai chi)!! (0.5 - 9.75)*met value of 2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q33.champs | 1.0, 3.5, 7.5, 11.5, 15.5 | numeric |
METWeighted_Q34
Description :
MET weighted score for ch32 (yoga). Score is creating by taking the estimated duration of time doing yoga, barre, tai chi, pilates (0.5 - 9.75)*met value of 2
| Variable Name | Type |
|---|---|
| METWeighted_Q34.champs | numeric |
METWeighted_Q35
Description :
MET weighted score for ch33 (danceb). Score is creating by taking the estimated duration of time doing dance (such as square, folk, line, ballroom), not aerobic dance (0.5 - 9.75)*met value of 4.5
| Variable Name | Type |
|---|---|
| METWeighted_Q35.champs | numeric |
METWeighted_Q36
Description :
MET weighted score for ch34 (danceb). Score is creating by taking the estimated duration of time doing aerobics or aerobic dance (0.5 - 9.75)*met value of 3.5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q36.champs | 1.750, 6.125, 13.125, 20.125, 27.125 | numeric |
METWeighted_Q37
Description :
MET weighted score for ch35 (strength). Score is creating by taking the estimated duration of time doing strength training (0.5 - 9.75)*met value of 3.33
| Variable Name | Type |
|---|---|
| METWeighted_Q37.champs | numeric |
METWeighted_Q38
Description :
MET weighted score for ch36 (sport). Score is creating by taking the estimated duration of time playing sports (0.5 - 9.75)*met value of 5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| METWeighted_Q38.champs | 2.50, 8.75, 18.75, 48.75 | numeric |
New_ALL
Description :
Number of new activities that were began in the past year (irrespective of activity type). Value is calculated by summing the total number of new cognitive, physical, and social activities. **Not 36 because movies is not included in these categories
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| New_ALL.champs | numeric | 0 | 35 |
New_Cog
Description :
Number of new cognitive activities that were began in the past year (“ch6emailc”,“ch7financc”,“ch8workc”,“ch9cookc”,“ch10medicc”,“ch12craftc”,“ch14attendc”,“ch20instrumc”,“ch21readc”,“ch24carc”)
| Variable Name | Type |
|---|---|
| New_Cog.champs | numeric |
New_Phys
Description :
Number of new physical activities that were began in the past year (ch11errandc”,“ch13golfc”,“ch18tennisc”,“ch19skatec”,“ch22chorec”,“ch23gardenc”,“ch25jogrunc”,“ch26briskwalkc”,“ch27leiswalkc”,“ch28bikec”,“ch29aerobothc”,“ch30swimc”,“ch31flexc”,“ch32yogac”,“ch33dancec”,“ch34aerobc”,“ch35strengthc”,“ch36sportc”)
| Variable Name | Type |
|---|---|
| New_Phys.champs | numeric |
New_Soc
Description :
Number of new social activities that were began in the past year (“ch1friendsc”,“ch2srcenterc”,“ch3volunc”,“ch4worshc”,“ch5clubc”,“ch15gamec”,“ch17billiardc”)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| New_Soc.champs | 0, 1, 2, 3, 4 | numeric |
TotalCaloricExpenditure
Description :
Sum of all METweighted variables (19) * (weight*0.4539)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| TotalCaloricExpenditure.champs | numeric | 0 | 12528.99 |
TotalNum_ALL
Description :
Total # of activities completed in the last 4 weeks, on a typical week (irrespective of activity type). Value is calculated by summing the total number of cognitive, physical, and social activities.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| TotalNum_ALL.champs | numeric | 0 | 35 |
TotalNum_Cog
Description :
Total # of cognitive activities completed in the last 4 weeks, on a typical week (“ch6emailc”,“ch7financc”,“ch8workc”,“ch9cookc”,“ch10medicc”,“ch12craftc”,“ch14attendc”,“ch20instrumc”,“ch21readc”,“ch24carc”)
| Variable Name | Type |
|---|---|
| TotalNum_Cog.champs | numeric |
TotalNum_Phys
Description :
Total # of physical activities completed in the last 4 weeks, on a typical week (ch11errandc”,“ch13golfc”,“ch18tennisc”,“ch19skatec”,“ch22chorec”,“ch23gardenc”,“ch25jogrunc”,“ch26briskwalkc”,“ch27leiswalkc”,“ch28bikec”,“ch29aerobothc”,“ch30swimc”,“ch31flexc”,“ch32yogac”,“ch33dancec”,“ch34aerobc”,“ch35strengthc”,“ch36sportc”)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| TotalNum_Phys.champs | numeric | 0 | 18 |
TotalNum_Soc
Description :
Total # of social activities completed in the last 4 weeks, on a typical week (“ch1friendsc”,“ch2srcenterc”,“ch3volunc”,“ch4worshc”,“ch5clubc”,“ch15gamec”,“ch17billiardc”)
| Variable Name | Type |
|---|---|
| TotalNum_Soc.champs | numeric |
version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.champs | 2 | numeric |
weight
Description :
Participants weight. Max and min values are to provide very broad possible range
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| weight.champs | numeric | 98 | 400 |
WklyCount_ALL
Description :
Sum of the count for the times/week the participant completes a given activity (sum of cognitive, physical and social weekly hours variables)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyCount_ALL.champs | numeric | 0 | 2123.00 |
WklyCount_Cog
Description :
Sum of the count for the times/week the participant completes all cognitive activites
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyCount_Cog.champs | numeric | 0 | 2098.00 |
WklyCount_Phys
Description :
Sum of the count for the times/week the participant completes all physical activites
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyCount_Phys.champs | numeric | 0 | 68.00 |
WklyCount_Soc
Description :
Sum of the count for the times/week the participant completes all social activites
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyCount_Soc.champs | numeric | 0 | 35.00 |
WklyHrs_ALL
Description :
Sum of the hours spent on all activities per week (cognitive + physical + social weekly hours)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyHrs_ALL.champs | numeric | 0 | 341.25 |
WklyHrs_Cog
Description :
Sum of the hours spent on cognitive activities per week
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyHrs_Cog.champs | numeric | 0 | 97.5 |
WklyHrs_Phys
Description :
Sum of the hours spent on physical activities per week
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyHrs_Phys.champs | numeric | 0 | 175.5 |
WklyHrs_Soc
Description :
Sum of the hours spent on social activities per week
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| WklyHrs_Soc.champs | numeric | 0 | 68.25 |
clinical_labs
Description :
Our clinical labs capture routine labs. (Glucose, Hemoglobin, Insulin, Total Cholesterol, triglyceride, HDL, LDL, Choleterol HDL Ratio, NonHDL Cholesterol, hsCRP, and HOMA-IR).
cholesterol_hdl_ratio
Description :
Cholesterol HDL Ratio (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cholesterol_hdl_ratio.clinical_labs | numeric | 0.3 | 17.3 |
glucose_mg_d_l
Description :
Glucose (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| glucose_mg_d_l.clinical_labs | numeric | 37 | 222 |
hdl_mg_d_l
Description :
High density lipoprotein (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hdl_mg_d_l.clinical_labs | numeric | 10 | 131 |
hemoglobin_a1c_percent
Description :
Hemoglobin A1C (%)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hemoglobin_a1c_percent.clinical_labs | numeric | 4.1 | 9.1 |
homa_ir
Description :
Homeostatic Model Assessment of insulin resistance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| homa_ir.clinical_labs | numeric | 0.28 | 79.90 |
hs_crp_mg_l
Description :
High sensitivity C reactive protein test in mg/l
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hs_crp_mg_l.clinical_labs | numeric | 0.1 | 97.0 |
insulin_u_u_ml
Description :
Insulin levels (uU/ml)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| insulin_u_u_ml.clinical_labs | numeric | 1.5 | 70.6 |
ldl_mg_d_l
Description :
LDL (low density lipoprotein) levels (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ldl_mg_d_l.clinical_labs | numeric | 10 | 349 |
non_hdl_cholesterol
Description :
Non HDL(high density lipoprotein) cholesterol
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| non_hdl_cholesterol.clinical_labs | numeric | 25 | 277 |
total_cholesterol_mg_dl
Description :
Total cholesterol (mg/dl)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total_cholesterol_mg_dl.clinical_labs | numeric | 52 | 345 |
triglycerides
Description :
Triglyceride levels
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| triglycerides.clinical_labs | numeric | 16 | 411 |
cogntive_activity_scale
Description :
The Cognitive Activity Scale (CAS) assesses the frequency of cognitive stimulation throughout life. The CAS is a 25-item interview in which participants are asked to report how often they engaged in common cognitively demanding activities that depend minimally on socioeconomic status, such as reading books or newspapers, writing letters or e-mails, going to the library, and playing games, at 5 age epochs: 6, 12, 18, and 40 years and the current age. Responses for each item were made using a 5-point frequency scale: 5, every day or almost every day; 4, several times a week; 3, several times a month; 2, several times a year; and 1, once a year or less.
References :
Wilson, R., Barnes, L., & Bennett, D. (2003). Assessment of lifetime participation in cognitively stimulating activities. Journal of clinical and experimental neuropsychology, 25(5), 634–642. https://doi.org/10.1076/jcen.25.5.634.14572
Landau, S. M., Marks, S. M., Mormino, E. C., Rabinovici, G. D., Oh, H., O’Neil, J. P., Wilson, R. S., & Jagust, W. J. (2012). Association of lifetime cognitive engagement and low β-amyloid deposition. Archives of neurology, 69(5), 623–629. https://doi.org/10.1001/archneurol.2011.2748
cas_score
Description :
Final score: Total points/# of questions, not including value “9” which indicates don’t know
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| cas_score.cogntive_activity_scale | 1, 2, 3, 4, 5, 9 | categorical | 9= I don’t know, the rest of the values represent the total points/# of questions, where higher scores indicate greater cognitive activity |
cas_tot_pts
Description :
Total points for questions 1 through 25, inverse scoring
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cas_tot_pts.cogntive_activity_scale | numeric | 25 | 125 |
lca_reading
Description :
Reading total score (sum) from lifetime cognitive activities questions that ask about how many hours per day are spent reading newspapers (#3), magazines (#4), and books (#5), higher scores = more hours spent reading
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lca_reading.cogntive_activity_scale | numeric | 0 | 12 |
lca_total
Description :
Total score (sum) of lifetime cognitive activities questions (1, 1a, 2, 2a, 3, 4, 5, 5a, 6, 7, 8)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lca_total.cogntive_activity_scale | numeric | 2 | 51 |
cpt
Description :
The Continuous Performance Test (CPT) is an NIH-EXAMINER response inhibition task, which requires subjects to respond to a certain type of stimulus and withhold a response to another. The examinee is presented with different images and instructed to press a key for only the target image, responding as quickly and accurately as possible. The task consists of 100 experimental trials, 80% of which were the target image. The five non-target images that were presented were of a similar shape and size to the target.
References :
- Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., Bostrom, A., Sinha, L., Berhel, A., & Widmeyer, M. (2014). NIH EXAMINER: conceptualization and development of an executive function battery. Journal of the International Neuropsychological Society : JINS, 20(1), 11–19. https://doi.org/10.1017/S1355617713001094
total_corr
Description :
Total number of trials where the subject response/non-response was correct
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total_corr.cpt | numeric | 67 | 250 |
total_errors
Description :
Total number of trials where the subject response/non-response was incorrect
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total_errors.cpt | numeric | 0 | 33 |
csf
ab1_40_pg_m_l
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab1_40_pg_m_l.csf | numeric | 4445 | 20511 |
ab1_42_pg_m_l
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab1_42_pg_m_l.csf | numeric | 214 | 1942 |
csf_spec_id
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf_spec_id.csf | numeric | 775239 | 3452428 |
gap43_156_10000_pg_ml_csf
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gap43_156_10000_pg_ml_csf.csf | numeric | 1301.7 | 6394.2 |
ng36_pg_m_l
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ng36_pg_m_l.csf | numeric | 82.610 | 460.390 |
p_tau_pg_m_l
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| p_tau_pg_m_l.csf | numeric | 15.5 | 226.9 |
snap25long_p_m
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| snap25long_p_m.csf | numeric | 6.4 | 33.1 |
snap25tot_p_m
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| snap25tot_p_m.csf | numeric | 16.8 | 88.0 |
syt1_p_m
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| syt1_p_m.csf | numeric | 9.0 | 64.4 |
t_tau_pg_m_l
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| t_tau_pg_m_l.csf | numeric | 104 | 1140 |
demographics
Description :
The demeographic information collected on each participant comes as a self reported measure collected at their first visit, and updated thereafter with any changes that might occur.
deceased
Description :
Variable marking if participant is deceased or alive
| Label | Value |
|---|---|
| 0 | Alive |
| 1 | Deceased |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| deceased.demographics | 0, 1 | categorical | Alive, Deceased |
educ
Description :
Years of education a participant has
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| educ.demographics | numeric | 0 | 35 |
gender
Description :
Self-reported gender of the participant. 1 = Male, 2=Female
| Label | Value |
|---|---|
| 1 | Male |
| 2 | Female |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| gender.demographics | 1, 2 | categorical | Male, Female |
hand
Description :
Self-reported handiness of participant
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hand.demographics | AMBIDEXTROUS, LEFT, RIGHT | categorical |
if_span_or_country_text
Description :
Plain text version of which country themselves or their family report as their ethnicity if they are Hispanic/Latino
| Variable Name | Type |
|---|---|
| if_span_or_country_text.demographics | character |
if_span_or_ctry
Description :
If a participant is Hispanic/Latino, which country themselves or their family report as their ethnicity
| Variable Name | Type |
|---|---|
| if_span_or_ctry.demographics | categorical |
if_span_or_reg_text
Description :
Plain text version of Geographical region of Hispanic/Latin descent - automatically population from Spanish Origin: Country Variable
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| if_span_or_reg_text.demographics | North American, South American, Central American, Carribbean, Spain, Other Region, Unknown/Refused to Answer | character |
if_span_or_reg
Description :
Geographical region of Hispanic/Latin descent - automatically population from Spanish Origin: Country Variable
| Label | Value |
|---|---|
| 1 | North American |
| 2 | South American |
| 3 | Central American |
| 4 | Carribbean |
| 5 | Spain |
| 6 | Other Region |
| 99 | Unknown/Refused to Answer |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| if_span_or_reg.demographics | 1, 2, 3, 4, 5, 6, 99 | categorical | North American, South American, Central American, Carribbean, Spain, Other Region, Unknown/Refused to Answer |
if_span_or_text
Description :
Plain text version of older version of how Spanish origin was collected: General regions in which the participant may be from
| Variable Name | Type |
|---|---|
| if_span_or_text.demographics | character |
if_span_or
Description :
Older version of how Spanish origin was collected: General regions in which the participant may be from
| Variable Name | Type |
|---|---|
| if_span_or.demographics | categorical |
mult_rac
Description :
Self-reported measure of whether the participant identifies as multi-racial
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| mult_rac.demographics | 1, 2 | categorical | Yes, No |
race_simple_text
Description :
Plain text version of participant’s self reported race
| Variable Name | Type |
|---|---|
| race_simple_text.demographics | character |
race_simple
Description :
Self-reported race of participant
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| race_simple.demographics | categorical | 1 | 99 |
span_or_text
Description :
Whether the participant reports being of Hispanic/Latino descent
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| span_or_text.demographics | No, Yes | character |
span_or
Description :
Whether the participant reports being of Hispanic/Latino descent
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 9 | Unknown |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| span_or.demographics | 1, 2, 9 | categorical | Yes, No, Unknown |
testing_language
Description :
Language the participant is tested in
| Variable Name | Type |
|---|---|
| testing_language.demographics | character |
diagnosis
Description :
Clinical syndrome and research diagnoses assigned during case consensus conference review of all available data collected (e.g., history, neurologic exam, cognitive performance, neuroimaging) by a multidisciplinary team including neurologists and neuropsychologists.
clin_syn_best_est
Description :
Best estimate of clinical syndrome based on case consensus conference
| Variable Name | Type |
|---|---|
| clin_syn_best_est.diagnosis | character |
clin_syn_sec_est
Description :
Second best estimate of clinical syndrome based on case consensus conference
| Variable Name | Type |
|---|---|
| clin_syn_sec_est.diagnosis | character |
res_dx_a
Description :
Primary diagnosis per published research diagnostic criteria discussed based on case consensus conference review
| Variable Name | Type |
|---|---|
| res_dx_a.diagnosis | character |
res_dx_b
Description :
Secondary diagnosis per published research diagnostic criteria based on case consensus conference review
| Variable Name | Type |
|---|---|
| res_dx_b.diagnosis | character |
diagnosis_latest
Description :
All participants are given a diagnosis at each time point. These diagnoses are classified through a case consensus conference with board-certified neurologists and neuropsychologists, after a review of cognitive testing, informant interviews, and a thorough neurological exam. Participants are given a clinical syndrome, a research diagnosis, and an estimated predicted neuropathology given the data available at the time of the consensus conference. The diagnosis_latest variable is defined as the diagnosis most recent to a specified date.
clin_syn_best_est
Description :
Based on clinical features, the clinicians best estimate of the syndrome that best characterizes the patient’s CURRENT presentation.
| Variable Name | Type |
|---|---|
| clin_syn_best_est.diagnosis_latest | character |
clin_syn_sec_est
Description :
Based on clinical features, the clinicians secondary (optional) estimate of the syndrome that best characterizes the patient’s CURRENT presentation.
| Variable Name | Type |
|---|---|
| clin_syn_sec_est.diagnosis_latest | character |
res_dx_a
Description :
The subject meets established research criteria for this diagnosis [no priority of diagnosis implied by A,B,C,D,E]
| Variable Name | Type |
|---|---|
| res_dx_a.diagnosis_latest | character |
res_dx_b
Description :
The subject meets established research criteria for this diagnosis [no priority of diagnosis implied by A,B,C,D,E]
| Variable Name | Type |
|---|---|
| res_dx_b.diagnosis_latest | character |
diet
Description :
The diet score comes from the Mediterranean-DASH Diet Intervention for Neurodegenerative Delay (MIND) Diet: MIND Diet Score. The MIND diet score is based on a combination of 10 healthy food groups (leafy green vegetables, other vegetables, nuts, berries, beans, whole grains, fish, poultry, olive oil, and wine) and 5 unhealthy food groups (red meats, butter and stick margarine, cheese, pastries and sweets, fried food, and fast food). The frequency of consumption of each food item for a given score component is summed and then given a concordance score of 0, 0.5, or 1, where 1 represented the highest concordance. The final MIND diet score is the sum of the 15 component scores.
References :
Morris, M. C., Tangney, C. C., Wang, Y., Sacks, F. M., Barnes, L. L., Bennett, D. A., & Aggarwal, N. T. (2015). MIND diet slows cognitive decline with aging. Alzheimer’s & dementia : the journal of the Alzheimer’s Association, 11(9), 1015–1022. https://doi.org/10.1016/j.jalz.2015.04.011
Panagiotakos, D. B., Pitsavos, C., Arvaniti, F., & Stefanadis, C. (2007). Adherence to the Mediterranean food pattern predicts the prevalence of hypertension, hypercholesterolemia, diabetes and obesity, among healthy adults; the accuracy of the MedDietScore. Preventive medicine, 44(4), 335–340. https://doi.org/10.1016/j.ypmed.2006.12.009
dietq_mindscore
Description :
Total MIND Diet Score (Sum of Q1 - Q15); higher scores indicate greater diet concordance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dietq_mindscore.diet | numeric | 0 | 15 |
dot_counting
Description :
Dot Counting is a working memory task where participants are presented with a series of screens with an array of blue and green circles and squares. The participant is instructed to count the number of blue circles out loud, remembering the total for later recall. The task gets progressively more challenging as more screens are shown.
References :
Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., … Widmeyer, M. (2014). NIH EXAMINER: Conceptualization and Development of an Executive Function Battery. Journal of the International Neuropsychological Society, 20(1), 11–19. doi:10.1017/S1355617713001094
Bettcher, B. M., Mungas, D., Patel, N., Elofson, J., Dutt, S., Wynn, M., Watson, C. L., Stephens, M., Walsh, C. M., & Kramer, J. H. (2016). Neuroanatomical substrates of executive functions: Beyond prefrontal structures (-1st ed.). Neuropsychologia. https://www.sciencedirect.com/science/article/pii/S0028393216300665
dot_counting_lava
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dot_counting_lava.dot_counting | numeric | 0 | 27 |
dot_counting_t1
Description :
trial 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_t1.dot_counting | 0, 1, 2 | numeric |
dot_counting_t2
Description :
trial 2 scpre
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_t2.dot_counting | 0, 1, 2, 3 | numeric |
dot_counting_t3
Description :
trial 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_t3.dot_counting | 0, 1, 2, 3, 4 | numeric |
dot_counting_t4
Description :
trial 4 score
| Variable Name | Type |
|---|---|
| dot_counting_t4.dot_counting | numeric |
dot_counting_t5
Description :
trial 5 score
| Variable Name | Type |
|---|---|
| dot_counting_t5.dot_counting | numeric |
dot_counting_t6
Description :
trial 6 score
| Variable Name | Type |
|---|---|
| dot_counting_t6.dot_counting | numeric |
dot_counting_task_duration
Description :
time duration
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dot_counting_task_duration.dot_counting | numeric | 0 | 748 |
dot_counting_task_form
Description :
Form Version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_task_form.dot_counting | A, B, C | character |
dot_counting_task_language
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_task_language.dot_counting | English, Spanish (Argentina, Uruguay), Spanish (MEX, ESP, Central America), Spanish-MEX | character |
dot_counting_task_version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dot_counting_task_version.dot_counting | 1.0.0, 3.0.0 | character |
dot_counting_total_score_z
Description :
Z-score
| Variable Name | Type |
|---|---|
| dot_counting_total_score_z.dot_counting | numeric |
dot_counting_total_tabcat
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dot_counting_total_tabcat.dot_counting | numeric | 0 | 27 |
earlydevhistory
Description :
The Early Developmental History Screening Questionnaire is a comprehensive survey of early-childhood behavioral and cognitive performance. Individuals were asked to select Likert scale responses (never, sometimes, often, or always) to questions regarding early childhood development and scholastic performance across multiple cognitive domains.
References :
- Shwe, W., Allen, I., Welch, A. E., Chung, D. H., Pakvasa, M., Pham, J. Q., … & Miller, Z. A. (2019). The UCSF Memory and Aging Center: Early Developmental History Screening Questionnaire (P2. 1-029).
edh_anti
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_anti.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_anx
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_anx.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_art
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_art.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
edh_att
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_att.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_dep
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_dep.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_dys
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_dys.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_f_lan
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_f_lan.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
edh_hyp
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_hyp.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_imp
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_imp.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_lan
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_lan.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_math
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_math.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
edh_mech
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_mech.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
edh_mot
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_mot.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_music
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_music.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
edh_obs
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_obs.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_oth
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_oth.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_read
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_read.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
edh_shy
| Label | Value |
|---|---|
| 0 | Never |
| 1 | Sometimes |
| 2 | Often |
| 3 | Always |
| 9 | N/A |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_shy.earlydevhistory | 0, 1, 2, 3, 9 | numeric | Never, Sometimes, Often, Always, N/A |
edh_spell
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_spell.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
edh_sport
| Label | Value |
|---|---|
| 1 | Yes |
| 2 | No |
| 3 | I don’t know |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| edh_sport.earlydevhistory | 1, 2, 3 | numeric | Yes, No, I don’t know |
edinburgh_handedness
Description :
The Edinburgh Handedness Inventory is a questionnaire used to assess the handedness of a subject in activities of daily living (ADLs). The participant is asked to indicate their preference for using their left or right hand for a variety of daily tasks, on a scale of “Only use left hand”, “Prefer left hand”, “Indifferent”, “Prefer right hand”, and “Only use right hand”.
References :
- Oldfield R. C. (1971). The assessment and analysis of handedness: the Edinburgh inventory. Neuropsychologia, 9(1), 97–113. https://doi.org/10.1016/0028-3932(71)90067-4
ehi_tot
Description :
Total score
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ehi_tot.edinburgh_handedness | numeric | 2 | 60 |
ehi1
Description :
Hand preference for “Writing”
| Label | Value |
|---|---|
| 1 | Only use left hand |
| 2 | Prefer left hand |
| 3 | Indifferent |
| 4 | Prefer right hand |
| 5 | Only use right hand |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ehi1.edinburgh_handedness | 1, 2, 3, 4, 5 | numeric | Only use left hand, Prefer left hand, Indifferent, Prefer right hand, Only use right hand |
ehi10
Description :
Hand preference for “Opening Box (lid)”
| Variable Name | Type |
|---|---|
| ehi10.edinburgh_handedness | numeric |
ehi11
Description :
Which foot the subject prefers to kick with
| Variable Name | Type |
|---|---|
| ehi11.edinburgh_handedness | numeric |
ehi12
Description :
Which eye the subject uses when only needing one
| Variable Name | Type |
|---|---|
| ehi12.edinburgh_handedness | numeric |
ehi2
Description :
Hand preference for “Drawing”
| Variable Name | Type |
|---|---|
| ehi2.edinburgh_handedness | numeric |
ehi3
Description :
Hand preference for “Throwing”
| Variable Name | Type |
|---|---|
| ehi3.edinburgh_handedness | numeric |
ehi4
Description :
Hand preference for “Scissors”
| Variable Name | Type |
|---|---|
| ehi4.edinburgh_handedness | numeric |
ehi5
Description :
Hand preference for “Toothbrush”
| Variable Name | Type |
|---|---|
| ehi5.edinburgh_handedness | numeric |
ehi6
Description :
Hand preference for “Knife (without a fork)”
| Variable Name | Type |
|---|---|
| ehi6.edinburgh_handedness | numeric |
ehi7
Description :
Hand preference for “Spoon”
| Variable Name | Type |
|---|---|
| ehi7.edinburgh_handedness | numeric |
ehi8
Description :
Hand preference for “Broom (upper hand)”
| Variable Name | Type |
|---|---|
| ehi8.edinburgh_handedness | numeric |
ehi9
Description :
Hand preference for “Striking Match”
| Variable Name | Type |
|---|---|
| ehi9.edinburgh_handedness | numeric |
natural_l
Description :
Whether the subject was naturally left handed and taught (or forced) to switch handedness at a young age
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| natural_l.edinburgh_handedness | 0, 1 | numeric | Yes, No |
natural_r
Description :
Whether the subject was naturally right handed and taught (or forced) to switch handedness at a young age
| Label | Value |
|---|---|
| 0 | Yes |
| 1 | No |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| natural_r.edinburgh_handedness | 0, 1 | numeric | Yes, No |
enclosedflanker
flankerinc
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flankerinc.enclosedflanker | numeric | 0.666 | 10.109 |
flkincacc
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkincacc.enclosedflanker | numeric | 0.000 | 1.000 |
flkincaccscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkincaccscore.enclosedflanker | numeric | 0.000 | 5.000 |
flkinclog
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkinclog.enclosedflanker | numeric | 2.595 | 3.287 |
flkincrtscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkincrtscore.enclosedflanker | numeric | 0.032 | -6.369 |
flkincstem
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flkincstem.enclosedflanker | numeric | 0.014 | -0.022 |
task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| task.enclosedflanker | AgingCog_EnclosedFlanker, Flanker_RO1_Behavioral | character |
version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.enclosedflanker | 1, 1.0.1, 1.0.2 | character |
epworth_sleepiness
Description :
The Epworth Sleepiness Scale is widely used in the field of sleep medicine as a subjective measure of a patient’s sleepiness. The questionnaire is a list of eight situations in which you rate your tendency to become sleepy on a scale of 0, no chance of dozing, to 3, high chance of dozing. The scale estimates whether you are experiencing excessive sleepiness that possibly requires medical attention.
References :
- Johns, M. W. (1991). A new method for measuring daytime sleepiness: the Epworth sleepiness scale. sleep, 14(6), 540-545.
ESStotal
Description :
Total score on questionnaire. The higher the total the higher daytime sleepiness a participant experiences.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ESStotal.epworth_sleepiness | numeric | 0 | 21 |
everydaycogself
Description :
This is a 51-item self-report questionnaire combinining items from the Everyday Cognition (ECog) questionnaire and the Daily Function Questionnaire (DFQ). Participants are asked to rate whether they’ve experienced a change in their ability to do different domain-specific tasks compared to 10 years ago. Response options include: 1=Better or no change; 2=Questionable/occasionally worse; 3=Consistently a little worse; 4=Consistently much worse
References :
Farias, S. T., Mungas, D., Reed, B. R., Cahn-Weiner, D., Jagust, W., Baynes, K., & DeCarli, C. (2008). The measurement of everyday cognition (ECog): scale development and psychometric properties. Neuropsychology, 22(4), 531.
Farias, S. T., Mungas, D., & Jagust, W. (2005). Degree of discrepancy between self and other‐reported everyday functioning by cognitive status: dementia, mild cognitive impairment, and healthy elders. International Journal of Geriatric Psychiatry: A journal of the psychiatry of late life and allied sciences, 20(9), 827-834.
ec_attn_score
Description :
Executive Function/Attention composite score averaging the responses from 5 attention-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_attn_score.everydaycogself | numeric | 1 | 4 |
ec_concern
Description :
Single item asking about concern about memory or thinking problems (yes/no)
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ec_concern.everydaycogself | 0, 1 | categorical | No, Yes |
ec_lang_score
Description :
Language composite score averaging the responses from 9 language-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_lang_score.everydaycogself | numeric | 1 | 4 |
ec_mem_score
Description :
Memory composite score averaging the responses from 11 memory-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_mem_score.everydaycogself | numeric | 1 | 4 |
ec_org_score
Description :
Executive Function/Organization composite score averaging the responses from 7 organization-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_org_score.everydaycogself | numeric | 1 | 4 |
ec_other_score
Description :
Composite score averaging the responses from 7 “other” items
| Variable Name | Type |
|---|---|
| ec_other_score.everydaycogself | numeric |
ec_plan_score
Description :
Executive Function/Planning composite score averaging the responses from 5 planning-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_plan_score.everydaycogself | numeric | 1 | 4 |
ec_score
Description :
Total Score: Average of all item responses
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_score.everydaycogself | numeric | 1 | 4 |
ec_vis_score
Description :
Visuospatial composite score averaging the responses from 7 visuospatial-specific items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ec_vis_score.everydaycogself | numeric | 1 | 4 |
faq
Description :
The Functional Activities Questionnaire (FAQ) measures instrumental activities of daily living (IADLs), such as preparing balanced meals and managing personal finances
References :
Pfeffer, R.I., Kurosaki, T.T., Harrah, C.H. Jr., Chance, J.M., & Filos, S. (1982). Measurement of functional activities in older adults in the community. Journal of Gerontology, 37(3), 323-329. Reprinted with permission of Oxford University Press.
Mayo, A. M. (2016). Use of the Functional Activities Questionnaire in older adults with dementia. Hartford Inst Geriatr Nurs, 13(2).
faq_tot
Description :
10-item questionnaire in which patient is rated as follows on different activities of daily living (Dependent = 3 • Requires assistance = 2 • Has difficulty but does by self = 1 • Never did and would have difficulty now = 1, Normal = 0 • Never did [the activity] but could do now = 0). Total score ranges from 0-30 with higher numbers indicating more functional impairment.
References :
- Mayo, A. M. (2016). Use of the Functional Activities Questionnaire in older adults with dementia. Hartford Inst Geriatr Nurs, 13(2).
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| faq_tot.faq | numeric | 0 | 30 |
fishermanstory
Description :
The Fishermen Story is a 20-unit story that is read aloud to the examinee across a minimum of 5 learning trials. Additional learning trials are administered until the examinee reaches a 90% mastery criterion (18/20 units) to help control for initial learning levels. The examinee is then asked to recall the story 30 minutes after and one week later.
References :
- Lindbergh, C. A., Walker, N., La Joie, R., Weiner-Light, S., Staffaroni, A. M., Casaletto, K. B., … Kramer, J. H. (2021). Worth the Wait: Delayed Recall after 1 Week Predicts Cognitive and Medial Temporal Lobe Trajectories in Older Adults. Journal of the International Neuropsychological Society, 27(4), 382–388. doi:10.1017/S1355617720001009
total30min
Description :
How much of the story the participant recalls after 30 minutes.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total30min.fishermanstory | numeric | 0 | 20 |
totalweek
Description :
How much of the story the participants recalls after one week.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| totalweek.fishermanstory | numeric | 0 | 20 |
fitbit
Description :
Participants are asked to wear a Fitbit device for 30 days. Daily aggregate and minute-level information about step counts, sleep, and heart rate are collected. Step cadence metrics were based on published data summarized in Tudor-Locke et al., 2018.
References :
Paolillo, E. W., Lee, S. Y., VandeBunte, A., Djukic, N., Fonseca, C., Kramer, J. H., & Casaletto, K. B. (2022). Wearable use in an observational study among older adults: adherence, feasibility, and effects of clinicodemographic factors. Frontiers in Digital Health, 4, 884208.
Tudor-Locke, C., Han, H., Aguiar, E. J., Barreira, T. V., Schuna Jr, J. M., Kang, M., & Rowe, D. A. (2018). How fast is fast enough? Walking cadence (steps/min) as a practical estimate of intensity in adults: a narrative review. British journal of sports medicine, 52(12), 776-788
average_daily_calories
Description :
An average of the daily estimated total energy expenditure (in kilocalories) across study days.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_daily_calories.fitbit | numeric | 1 | Infinity |
average_mins_asleep
Description :
Average number of minutes classified as being asleep per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_mins_asleep.fitbit | numeric | 0 | 1440 |
average_mins_deep
Description :
Average number of minutes classified as being in deep sleep per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_mins_deep.fitbit | numeric | 0 | 1440 |
average_mins_light
Description :
Average number of minutes classified as being in light sleep per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_mins_light.fitbit | numeric | 0 | 1440 |
average_mins_REM
Description :
Average number of minutes classified as being in REM sleep per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_mins_REM.fitbit | numeric | 0 | 1440 |
average_time_awake
Description :
Average number of minutes classified as being in awake per night across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_time_awake.fitbit | numeric | 0 | 1440 |
average_time_in_bed
Description :
Average number of minutes classified as being in bed (including awake, light, deep, and REM sleep) during defined sleep periods across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| average_time_in_bed.fitbit | numeric | 0 | 1440 |
calorie_days
Description :
Number of days with Fitbit calorie data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| calorie_days.fitbit | numeric | 7 | 75 |
daily_days
Description :
Number of days with daily aggregate step count data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| daily_days.fitbit | numeric | 7 | 75 |
daily_step_variability_rmssd_daily
Description :
The Root Mean Square of Successive Differences (RMSSD) of total daily step counts across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| daily_step_variability_rmssd_daily.fitbit | numeric | 0 | Infinity |
daily_steps_avg_daily
Description :
Average number of steps taken per day across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| daily_steps_avg_daily.fitbit | numeric | 100 | Infinity |
end
Description :
End date of Fitbit monitoring period
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| end.fitbit | Date | 2017-10-25 | Infinity |
fitbit_model
Description :
Fitbit model used for monitoring
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fitbit_model.fitbit | Charge 2, Charge 4, Flex 2, Inspire 2 | character |
heartrate_days
Description :
Number of days with Fitbit daily aggregate heartrate data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| heartrate_days.fitbit | numeric | 7 | 75 |
HRV_average_daily_rmssd
Description :
The Root Mean Square of Successive Differences (RMSSD) between heart beats during sleep (i.e., all sleep stages). It measures short-term variability in the user’s heart rate in milliseconds (ms). This nightly value is then averaged across study days.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| HRV_average_daily_rmssd.fitbit | numeric | Anything >0 | Infinity |
HRV_average_deep_rmssd
Description :
The Root Mean Square of Successive Differences (RMSSD) between heart beats during deep sleep only. It measures short-term variability in the user’s heart rate in milliseconds (ms). This nightly value is then averaged across study days.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| HRV_average_deep_rmssd.fitbit | numeric | Anything >0 | Infinity |
HRV_days
Description :
Number of days with Fitbit HRV data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| HRV_days.fitbit | numeric | 7 | 75 |
max_10min_avg_per_day_across_days_average
Description :
Average steps/min of the maximum number of steps obtained over 10 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_10min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
max_20min_avg_per_day_across_days_average
Description :
Average steps/min of the maximum number of steps obtained over 20 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_20min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
max_30min_avg_per_day_across_days_average
Description :
Average steps/min of the maximum number of steps obtained over 30 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_30min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
max_5min_avg_per_day_across_days_average
Description :
Average steps/min of the maximum number of steps obtained over 5 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_5min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
max_60min_avg_per_day_across_days_average
Description :
Average steps/min of the maximum number of steps obtained over 60 continuous minutes each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| max_60min_avg_per_day_across_days_average.fitbit | numeric | Anything >0 | Infinity |
min_days
Description :
Number of days with minute-level step count data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| min_days.fitbit | numeric | 7 | 75 |
mins_per_day_high_across_days_average
Description :
Total minutes spent at >= 120 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_high_across_days_average.fitbit | numeric | 0 | Infinity |
mins_per_day_incidental_across_days_average
Description :
Total minutes spent at 1-39 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_incidental_across_days_average.fitbit | numeric | 0 | Infinity |
mins_per_day_moderate_across_days_average
Description :
Total minutes spent at 80-119 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_moderate_across_days_average.fitbit | numeric | 0 | Infinity |
mins_per_day_purposeful_across_days_average
Description :
Total minutes spent at 40-79 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_purposeful_across_days_average.fitbit | numeric | 0 | Infinity |
mins_per_day_sedentary_across_days_average
Description :
Total minutes spent at 0 steps/min each day (including likely periods of sleep), then averaged across days.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mins_per_day_sedentary_across_days_average.fitbit | numeric | 0 | Infinity |
peak_1min_steps_per_day_across_days_average
Description :
Steps/min recorded for the highest single minute in a day
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| peak_1min_steps_per_day_across_days_average.fitbit | numeric | 1 | Infinity |
peak30_steps_per_min_across_days_average
Description :
Average steps/min recorded for the 30 highest, but not necessarily consecutive, minutes in a day
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| peak30_steps_per_min_across_days_average.fitbit | numeric | Anything >0 | Infinity |
peak60_steps_per_min_across_days_average
Description :
Average steps/min recorded for the 60 highest, but not necessarily consecutive, minutes in a day
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| peak60_steps_per_min_across_days_average.fitbit | numeric | Anything >0 | Infinity |
project_type
Description :
Parent study from which participant was recruited
| Variable Name | Type |
|---|---|
| project_type.fitbit | character |
sleep_days
Description :
Number of days with Fitbit sleep data
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_days.fitbit | numeric | 7 | 75 |
start
Description :
Start date of Fitbit monitoring period
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| start.fitbit | Date | 2017-09-26 | 2023-08-03 |
steps_per_min_avg_across_days_average
Description :
Average steps/min across all minutes of each day, then averaged across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| steps_per_min_avg_across_days_average.fitbit | numeric | Anything >0 | Infinity |
sum_steps_per_day_high_across_days_average
Description :
Total number of steps taken during minutes spent at >= 120 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sum_steps_per_day_high_across_days_average.fitbit | numeric | 0 | Infinity |
sum_steps_per_day_incidental_across_days_average
Description :
Total number of steps taken during minutes spent at 1-39 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sum_steps_per_day_incidental_across_days_average.fitbit | numeric | 0 | Infinity |
sum_steps_per_day_moderate_across_days_average
Description :
Total number of steps taken during minutes spent at 80-119 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sum_steps_per_day_moderate_across_days_average.fitbit | numeric | 0 | Infinity |
sum_steps_per_day_purposeful_across_days_average
Description :
Total number of steps taken during minutes spent at 40-79 steps/min each day, then averaged across days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sum_steps_per_day_purposeful_across_days_average.fitbit | numeric | 0 | Infinity |
timepoint_average_heartrate
Description :
Average daily heartrate across study days
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| timepoint_average_heartrate.fitbit | numeric | Anything >0 | Infinity |
Timepoint
Description :
Fitbit visit number, e.g., if this is a participants’ second time completing a 30-day Fitbit monitoring period, their timepoint would be 2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Timepoint.fitbit | 1, 2, 3, 4 | numeric |
gad
Description :
The Generalised Anxiety Disorder Assessment (GAD-7) is a seven-item instrument that is used to measure or assess the severity of generalised anxiety disorder (GAD).
References :
- Spitzer, R. L., Kroenke, K., Williams, J. B., & Löwe, B. (2006). A brief measure for assessing generalized anxiety disorder: the GAD-7. Archives of internal medicine, 166(10), 1092-1097.
gad7_tot
Description :
Responses of how often bothered by a symptom in the last 2 weeks, rated as not at all,” “several days,” “more than half the days,” and “nearly every day,” and scored as 0, 1, 2, and 3, respectively. Total score is a sum across 7-items (range 0-21).
References :
- Spitzer, R. L., Kroenke, K., Williams, J. B., & Löwe, B. (2006). A brief measure for assessing generalized anxiety disorder: the GAD-7. Archives of internal medicine, 166(10), 1092-1097.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gad7_tot.gad | numeric | 0 | 21 |
gait
Description :
A gait speed measure where participants are asked to walk a certain distance at their normal walking speed as well as a fast as they can walk without running.
gait_distance
Description :
The distance in meters the participant was asked to walk
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gait_distance.gait | 3, 6, 8 | numeric |
gait_leisure_avg
Description :
Calculated average in seconds, from three trials of a participant walking during the “leisure” conditions. Leisure conditions asks the participant to walk at their normal walking speed for a specified distance.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gait_leisure_avg.gait | numeric | 0 | infinity |
gait_speed_avg
Description :
Calculated average in seconds, from three trials of a participant walking during the “speed” condition. Speed condition asks the participant to walk as fast as they can without running
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gait_speed_avg.gait | numeric | 0 | infinity |
gait_version
Description :
Updated versions of the gait task throughout the years. Differences between versions is distance the participant is asked to walk, which is specified in the gait_distance.gait variable
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gait_version.gait | 1, 2, 3 | numeric |
genetics
9p21_plasmatau_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| 9p21_plasmatau_source.genetics | sequenom | character |
9p21_plasmatau
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| 9p21_plasmatau.genetics | C/C, C/T, T/T | character |
ABCA7_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ABCA7_source.genetics | sequenom | character |
ABCA7
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ABCA7.genetics | G/G, G/T, T/T | character |
ACE_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ACE_1_source.genetics | sequenom | character |
ACE_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ACE_1.genetics | A/A, A/G, G/G | character |
ADRA2B_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ADRA2B_source.genetics | sequenom | character |
ADRA2B
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ADRA2B.genetics | D/D, D/I, I/I | character |
ApoE_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ApoE_source.genetics | omni, sequenom, sequenom + omni | character |
ApoE
| Variable Name | Type |
|---|---|
| ApoE.genetics | character |
APP_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| APP_1_source.genetics | sequenom | character |
APP_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| APP_1.genetics | A/A | character |
APP_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| APP_source.genetics | sequenom | character |
APP
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| APP.genetics | Negative | character |
ATP2C2_1_rs11860694_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ATP2C2_1_rs11860694_source.genetics | sequenom | character |
ATP2C2_1_rs11860694
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ATP2C2_1_rs11860694.genetics | C/C, C/G, G/G | character |
ATP2C2_2_rs8053211_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ATP2C2_2_rs8053211_source.genetics | omni, sequenom, sequenom + omni | character |
ATP2C2_2_rs8053211
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ATP2C2_2_rs8053211.genetics | A/A, A/G, G/G | character |
AVPR1A_RS1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| AVPR1A_RS1_source.genetics | sequenom | character |
AVPR1A_RS1
| Variable Name | Type |
|---|---|
| AVPR1A_RS1.genetics | character |
BDNF_rs6265_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BDNF_rs6265_source.genetics | omni, sequenom, sequenom + omni | character |
BDNF_rs6265
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BDNF_rs6265.genetics | C/C, C/T, T/T | character |
BIN1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BIN1_source.genetics | sequenom | character |
BIN1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BIN1.genetics | A/A, A/G, G/G | character |
BRAF_V600E_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BRAF_V600E_source.genetics | sequenom | character |
BRAF_V600E
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| BRAF_V600E.genetics | A/A | character |
C2ORF3_rs917235_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C2ORF3_rs917235_source.genetics | omni, sequenom, sequenom + omni | character |
C2ORF3_rs917235
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C2ORF3_rs917235.genetics | A/A, A/G, G/A, G/G | character |
C9orf72_1_rs10757668_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C9orf72_1_rs10757668_source.genetics | omni, sequenom, sequenom + omni | character |
C9orf72_1_rs10757668
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C9orf72_1_rs10757668.genetics | C/C, C/T, T/T | character |
C9ORF72_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C9ORF72_source.genetics | sequenom | character |
C9ORF72
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| C9ORF72.genetics | negative, Negative | character |
CAMK2B_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CAMK2B_1_source.genetics | sequenom | character |
CAMK2B_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CAMK2B_1.genetics | C/C, C/T | character |
CCL11_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CCL11_source.genetics | sequenom | character |
CCL11
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CCL11.genetics | A/G, G/G | character |
CCR5_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CCR5_source.genetics | sequenom | character |
CCR5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CCR5.genetics | -/-, -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA, GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGG | character |
CD2AP_1_rs9349407_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CD2AP_1_rs9349407_source.genetics | sequenom | character |
CD2AP_1_rs9349407
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CD2AP_1_rs9349407.genetics | C/C, C/G, G/G | character |
CDC42BPA_rs1320490_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CDC42BPA_rs1320490_source.genetics | sequenom | character |
CDC42BPA_rs1320490
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CDC42BPA_rs1320490.genetics | C/C, C/G, G/G | character |
CETP_rs5882_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CETP_rs5882_source.genetics | omni, sequenom, sequenom + omni | character |
CETP_rs5882
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CETP_rs5882.genetics | A/A, A/G, G/A, G/G | character |
chr9_rs3849942_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| chr9_rs3849942_source.genetics | omni, sequenom, sequenom + omni | character |
chr9_rs3849942
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| chr9_rs3849942.genetics | C/C, C/T, T/C, T/T | character |
CLU_rs11136000_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CLU_rs11136000_source.genetics | omni, sequenom, sequenom + omni | character |
CLU_rs11136000
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CLU_rs11136000.genetics | C/C, C/T, T/C, T/T | character |
CMIP_1_rs6564903_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CMIP_1_rs6564903_source.genetics | sequenom | character |
CMIP_1_rs6564903
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CMIP_1_rs6564903.genetics | C/C, C/T, T/T | character |
CMIP_2_rs16955705_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CMIP_2_rs16955705_source.genetics | sequenom | character |
CMIP_2_rs16955705
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CMIP_2_rs16955705.genetics | A/A, A/C, C/C | character |
CNTNAP2_1_rs17236239_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CNTNAP2_1_rs17236239_source.genetics | sequenom | character |
CNTNAP2_1_rs17236239
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CNTNAP2_1_rs17236239.genetics | A/A, A/G, G/G | character |
CNTNAP2_2_rs4431523_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CNTNAP2_2_rs4431523_source.genetics | sequenom | character |
CNTNAP2_2_rs4431523
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CNTNAP2_2_rs4431523.genetics | C/C, C/T, T/T | character |
COMT_rs4680_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| COMT_rs4680_source.genetics | omni, sequenom, sequenom + omni | character |
COMT_rs4680
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| COMT_rs4680.genetics | A/A, A/G, G/A, G/G | character |
CPE_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CPE_source.genetics | sequenom | character |
CPE
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CPE.genetics | A/A, A/G, G/G | character |
CPEB3_rs11186856_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CPEB3_rs11186856_source.genetics | omni, sequenom + omni | character |
CPEB3_rs11186856
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CPEB3_rs11186856.genetics | A/A, A/G, G/G | character |
CR1_1_rs6701713_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CR1_1_rs6701713_source.genetics | omni, sequenom, sequenom + omni | character |
CR1_1_rs6701713
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CR1_1_rs6701713.genetics | A/A, A/G, G/G | character |
CR1_3_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CR1_3_source.genetics | sequenom | character |
CR1_3
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CR1_3.genetics | A/A, A/G, G/G | character |
CTNNA2_1_rs1446109_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_1_rs1446109_source.genetics | omni, sequenom, sequenom + omni | character |
CTNNA2_1_rs1446109
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_1_rs1446109.genetics | A/A, A/G, G/G | character |
CTNNA2_2_rs1007371_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_2_rs1007371_source.genetics | sequenom | character |
CTNNA2_2_rs1007371
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_2_rs1007371.genetics | A/A, A/T, T/T | character |
CTNNA2_3_rs723524_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_3_rs723524_source.genetics | omni, sequenom, sequenom + omni | character |
CTNNA2_3_rs723524
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CTNNA2_3_rs723524.genetics | G/G, G/T, T/T | character |
CUGBP2_1_rs201119_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CUGBP2_1_rs201119_source.genetics | omni, sequenom, sequenom + omni | character |
CUGBP2_1_rs201119
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CUGBP2_1_rs201119.genetics | C/C, C/T, T/C, T/T | character |
CYP46A1_1_rs754203_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CYP46A1_1_rs754203_source.genetics | sequenom | character |
CYP46A1_1_rs754203
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| CYP46A1_1_rs754203.genetics | A/A, A/G, G/G | character |
DCDC2_1_rs1419228_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_1_rs1419228_source.genetics | omni, sequenom, sequenom + omni | character |
DCDC2_1_rs1419228
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_1_rs1419228.genetics | A/A, A/G, G/A, G/G | character |
DCDC2_2_rs793862_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_2_rs793862_source.genetics | omni, sequenom, sequenom + omni | character |
DCDC2_2_rs793862
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_2_rs793862.genetics | A/A, A/G, G/G | character |
DCDC2_3_rs1091047_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_3_rs1091047_source.genetics | sequenom | character |
DCDC2_3_rs1091047
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DCDC2_3_rs1091047.genetics | C/C, C/G, G/G | character |
Do et al_1_rs356220_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Do et al_1_rs356220_source.genetics | omni, sequenom, sequenom + omni | character |
Do et al_1_rs356220
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Do et al_1_rs356220.genetics | C/C, C/T, T/C, T/T | character |
DPF3_rs2192595_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DPF3_rs2192595_source.genetics | sequenom | character |
DPF3_rs2192595
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DPF3_rs2192595.genetics | G/G, G/T, T/T | character |
DRD2_rs1800497_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DRD2_rs1800497_source.genetics | sequenom | character |
DRD2_rs1800497
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DRD2_rs1800497.genetics | A/A, A/G, G/G | character |
DRD4_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DRD4_source.genetics | sequenom | character |
DRD4
| Variable Name | Type |
|---|---|
| DRD4.genetics | character |
DYX1_1_rs17819126_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DYX1_1_rs17819126_source.genetics | omni, sequenom, sequenom + omni | character |
DYX1_1_rs17819126
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DYX1_1_rs17819126.genetics | C/C, C/T | character |
DYX1_2_rs57809907_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DYX1_2_rs57809907_source.genetics | omni, sequenom, sequenom + omni | character |
DYX1_2_rs57809907
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| DYX1_2_rs57809907.genetics | A/A, A/C, C/A, C/C | character |
EIF2AK3_1_rs7571971_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EIF2AK3_1_rs7571971_source.genetics | omni, sequenom, sequenom + omni | character |
EIF2AK3_1_rs7571971
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EIF2AK3_1_rs7571971.genetics | C/C, C/T, T/C, T/T | character |
ERBB4_rs839523_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ERBB4_rs839523_source.genetics | omni, sequenom, sequenom + omni | character |
ERBB4_rs839523
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ERBB4_rs839523.genetics | C/C, C/T, T/T | character |
EXT2_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_1_source.genetics | sequenom | character |
EXT2_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_1.genetics | C/C, C/T | character |
EXT2_2_rs143595300_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_2_rs143595300_source.genetics | sequenom | character |
EXT2_2_rs143595300
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_2_rs143595300.genetics | G/G, G/T | character |
EXT2_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2_source.genetics | sequenom | character |
EXT2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| EXT2.genetics | negative | character |
FAM47E_1_rs6812193_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FAM47E_1_rs6812193_source.genetics | omni, sequenom, sequenom + omni | character |
FAM47E_1_rs6812193
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FAM47E_1_rs6812193.genetics | C/C, C/T, T/T | character |
FIG4_1_rs121908287_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FIG4_1_rs121908287_source.genetics | sequenom | character |
FIG4_1_rs121908287
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FIG4_1_rs121908287.genetics | T/T | character |
FIG4_2_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FIG4_2_source.genetics | sequenom | character |
FIG4_2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FIG4_2.genetics | G/G | character |
FOXP2_rs17137124_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FOXP2_rs17137124_source.genetics | sequenom | character |
FOXP2_rs17137124
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FOXP2_rs17137124.genetics | C/C, C/T, T/T | character |
FUS_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FUS_source.genetics | sequenom | character |
FUS
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| FUS.genetics | Negative | character |
GRIN2A_1_rs4998386_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRIN2A_1_rs4998386_source.genetics | omni, sequenom, sequenom + omni | character |
GRIN2A_1_rs4998386
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRIN2A_1_rs4998386.genetics | C/C, C/T, T/T | character |
GRN_1_rs5848_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_1_rs5848_source.genetics | omni, sequenom | character |
GRN_1_rs5848
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_1_rs5848.genetics | C/C, C/T, G/G, G/T, T/T | character |
GRN_2_rs72824736_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_2_rs72824736_source.genetics | omni, sequenom, sequenom + omni | character |
GRN_2_rs72824736
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_2_rs72824736.genetics | A/A, A/G, G/A, G/G | character |
GRN_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN_source.genetics | sequenom | character |
GRN
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GRN.genetics | negative, Negative | character |
GSK3B_rs13312998_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GSK3B_rs13312998_source.genetics | sequenom | character |
GSK3B_rs13312998
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| GSK3B_rs13312998.genetics | C/C, C/T, T/T | character |
HFE_rs1799945_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HFE_rs1799945_source.genetics | omni, sequenom, sequenom + omni | character |
HFE_rs1799945
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HFE_rs1799945.genetics | C/C, C/G, G/G | character |
HSPA4_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HSPA4_1_source.genetics | sequenom | character |
HSPA4_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HSPA4_1.genetics | C/C | character |
HSPA8_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HSPA8_1_source.genetics | sequenom | character |
HSPA8_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| HSPA8_1.genetics | G/G | character |
IL2RA_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| IL2RA_source.genetics | sequenom | character |
IL2RA
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| IL2RA.genetics | C/C, C/T, T/T | character |
IL6_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| IL6_source.genetics | sequenom | character |
IL6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| IL6.genetics | C/C, C/G, G/G | character |
KCNQ_3_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KCNQ_3_source.genetics | sequenom | character |
KCNQ_3
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KCNQ_3.genetics | G/G, G/T, T/T | character |
KIAA0319_rs4504469_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KIAA0319_rs4504469_source.genetics | sequenom | character |
KIAA0319_rs4504469
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KIAA0319_rs4504469.genetics | C/C, C/T, T/T | character |
KIAA0319L_rs7523017_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KIAA0319L_rs7523017_source.genetics | sequenom | character |
KIAA0319L_rs7523017
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KIAA0319L_rs7523017.genetics | A/A, A/G, G/G | character |
KLOTHO_1_rs9536312_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_1_rs9536312_source.genetics | sequenom | character |
KLOTHO_1_rs9536312
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_1_rs9536312.genetics | C/C, C/T, T/T | character |
KLOTHO_2_rs9536314_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_2_rs9536314_source.genetics | omni, sequenom, sequenom + omni | character |
KLOTHO_2_rs9536314
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_2_rs9536314.genetics | G/G, G/T, T/G, T/T | character |
KLOTHO_3_rs9527025_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_3_rs9527025_source.genetics | omni, sequenom, sequenom + omni | character |
KLOTHO_3_rs9527025
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_3_rs9527025.genetics | C/C, C/G, G/C, G/G | character |
KLOTHO_4_rs7997728_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_4_rs7997728_source.genetics | sequenom | character |
KLOTHO_4_rs7997728
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KLOTHO_4_rs7997728.genetics | G/G, G/T, T/T | character |
KRAS_G13D_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KRAS_G13D_source.genetics | sequenom | character |
KRAS_G13D
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| KRAS_G13D.genetics | C/C | character |
LCMT1_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LCMT1_1_source.genetics | sequenom | character |
LCMT1_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LCMT1_1.genetics | A/A | character |
LPR_1_rs4251417_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LPR_1_rs4251417_source.genetics | omni, sequenom, sequenom + omni | character |
LPR_1_rs4251417
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LPR_1_rs4251417.genetics | C/C, C/T, T/T | character |
LPR_2_rs2020934_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LPR_2_rs2020934_source.genetics | sequenom | character |
LPR_2_rs2020934
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LPR_2_rs2020934.genetics | A/A, A/G, G/G | character |
LRRK2_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_1_source.genetics | sequenom | character |
LRRK2_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_1.genetics | A/A | character |
LRRK2_15_rs34637584_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_15_rs34637584_source.genetics | omni, sequenom, sequenom + omni | character |
LRRK2_15_rs34637584
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_15_rs34637584.genetics | A/G, G/G | character |
LRRK2_2_rs41286476_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_2_rs41286476_source.genetics | sequenom | character |
LRRK2_2_rs41286476
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_2_rs41286476.genetics | A/A | character |
LRRK2_3_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_3_source.genetics | sequenom | character |
LRRK2_3
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| LRRK2_3.genetics | C/C | character |
MAP1B_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_1_source.genetics | sequenom | character |
MAP1B_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_1.genetics | A/A, C/C | character |
MAP1B_2_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_2_source.genetics | sequenom | character |
MAP1B_2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_2.genetics | G/G | character |
MAP1B_3_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_3_source.genetics | sequenom | character |
MAP1B_3
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAP1B_3.genetics | C/C | character |
MAPT_2_rs116733906_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_2_rs116733906_source.genetics | omni, sequenom, sequenom + omni | character |
MAPT_2_rs116733906
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_2_rs116733906.genetics | G/G | character |
MAPT_A152T_rs143624519_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_A152T_rs143624519_source.genetics | omni, sequenom, sequenom + omni | character |
MAPT_A152T_rs143624519
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_A152T_rs143624519.genetics | A/G, G/G | character |
MAPT_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT_source.genetics | sequenom | character |
MAPT
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT.genetics | A/A, A/G, G/G | character |
MAPT3_UTR_1_rs1052590_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_1_rs1052590_source.genetics | omni, sequenom, sequenom + omni | character |
MAPT3_UTR_1_rs1052590
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_1_rs1052590.genetics | A/A, A/G, G/G | character |
MAPT3_UTR_2_rs8712_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_2_rs8712_source.genetics | omni, sequenom, sequenom + omni | character |
MAPT3_UTR_2_rs8712
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_2_rs8712.genetics | A/A, A/G, G/G | character |
MAPT3_UTR_3_rs17574040_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_3_rs17574040_source.genetics | omni, sequenom, sequenom + omni | character |
MAPT3_UTR_3_rs17574040
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MAPT3_UTR_3_rs17574040.genetics | A/A, A/C, C/C | character |
MCCC1_1_rs10513789_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MCCC1_1_rs10513789_source.genetics | omni, sequenom, sequenom + omni | character |
MCCC1_1_rs10513789
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MCCC1_1_rs10513789.genetics | G/G, G/T, T/G, T/T | character |
MOBP_1_rs1768208_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MOBP_1_rs1768208_source.genetics | omni, sequenom, sequenom + omni | character |
MOBP_1_rs1768208
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MOBP_1_rs1768208.genetics | C/C, C/T, T/C, T/T | character |
MS4A6A_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MS4A6A_source.genetics | sequenom | character |
MS4A6A
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| MS4A6A.genetics | G/G, G/T, T/T | character |
Naj et al_1_rs4938933_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_1_rs4938933_source.genetics | omni, sequenom, sequenom + omni | character |
Naj et al_1_rs4938933
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_1_rs4938933.genetics | C/C, C/T, T/T | character |
Naj et al_2_rs3865444_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_2_rs3865444_source.genetics | omni, sequenom, sequenom + omni | character |
Naj et al_2_rs3865444
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_2_rs3865444.genetics | A/A, A/C, C/A, C/C | character |
Naj et al_3_rs7561528_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_3_rs7561528_source.genetics | omni, sequenom, sequenom + omni | character |
Naj et al_3_rs7561528
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_3_rs7561528.genetics | A/A, A/G, G/A, G/G | character |
Naj et al_4_rs2588969_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_4_rs2588969_source.genetics | sequenom | character |
Naj et al_4_rs2588969
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Naj et al_4_rs2588969.genetics | A/A, A/C, C/C | character |
NRG_2_rs35753505_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| NRG_2_rs35753505_source.genetics | omni, sequenom, sequenom + omni | character |
NRG_2_rs35753505
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| NRG_2_rs35753505.genetics | C/C, C/T, T/C, T/T | character |
OGT_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| OGT_1_source.genetics | sequenom | character |
OGT_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| OGT_1.genetics | T/T | character |
OXTR_rs53576_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| OXTR_rs53576_source.genetics | omni, sequenom, sequenom + omni | character |
OXTR_rs53576
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| OXTR_rs53576.genetics | A/A, A/G, G/G | character |
PARK2_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PARK2_source.genetics | sequenom | character |
PARK2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PARK2.genetics | A/A, A/G, G/G | character |
PARK7_1_rs71653619_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PARK7_1_rs71653619_source.genetics | omni, sequenom, sequenom + omni | character |
PARK7_1_rs71653619
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PARK7_1_rs71653619.genetics | A/G, G/A, G/G | character |
PCDH11X_rs5984894_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PCDH11X_rs5984894_source.genetics | sequenom | character |
PCDH11X_rs5984894
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PCDH11X_rs5984894.genetics | A/A, A/G, G/G | character |
PICALM_rs3851179_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PICALM_rs3851179_source.genetics | omni, sequenom, sequenom + omni | character |
PICALM_rs3851179
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PICALM_rs3851179.genetics | C/C, C/T, T/C, T/T | character |
PIDN_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PIDN_source.genetics | sequenom | character |
PLCG1_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PLCG1_1_source.genetics | sequenom | character |
PLCG1_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PLCG1_1.genetics | C/C, C/T | character |
PLCG1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PLCG1_source.genetics | sequenom | character |
PLCG1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PLCG1.genetics | negative | character |
PPP3CA_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PPP3CA_1_source.genetics | sequenom | character |
PPP3CA_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PPP3CA_1.genetics | T/T | character |
PSEN1_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN1_1_source.genetics | sequenom | character |
PSEN1_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN1_1.genetics | T/T | character |
PSEN1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN1_source.genetics | sequenom | character |
PSEN1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN1.genetics | Negative | character |
PSEN2_1_rs58973334_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN2_1_rs58973334_source.genetics | omni, sequenom, sequenom + omni | character |
PSEN2_1_rs58973334
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN2_1_rs58973334.genetics | A/G, G/A, G/G | character |
PSEN2_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN2_source.genetics | sequenom | character |
PSEN2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PSEN2.genetics | Negative | character |
RAI1_1_rs11649804_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| RAI1_1_rs11649804_source.genetics | omni, sequenom, sequenom + omni | character |
RAI1_1_rs11649804
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| RAI1_1_rs11649804.genetics | A/A, A/C, C/A, C/C | character |
RIT2_1_rs4130047_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| RIT2_1_rs4130047_source.genetics | omni, sequenom, sequenom + omni | character |
RIT2_1_rs4130047
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| RIT2_1_rs4130047.genetics | C/C, C/T, T/C, T/T | character |
rs5848_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rs5848_source.genetics | sequenom | character |
rs5848
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rs5848.genetics | C/C, C/T, T/T | character |
rs9909184_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rs9909184_source.genetics | sequenom | character |
rs9909184
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rs9909184.genetics | A/A, A/T | character |
SERT_LPR_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SERT_LPR_source.genetics | sequenom | character |
SERT_LPR
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SERT_LPR.genetics | 14/14, 14/16, 16/16 | character |
SERT_VNTR_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SERT_VNTR_source.genetics | sequenom | character |
SERT_VNTR
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SERT_VNTR.genetics | 10/10, 10/12, 12/12, 12/9 | character |
SLC41A1_1_rs823156_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SLC41A1_1_rs823156_source.genetics | omni, sequenom | character |
SLC41A1_1_rs823156
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SLC41A1_1_rs823156.genetics | A/A, A/G, G/A, G/G | character |
SLC6A4_LPR_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SLC6A4_LPR_source.genetics | sequenom | character |
SLC6A4_LPR
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SLC6A4_LPR.genetics | 14/14, 14/16, 16/16 | character |
SNAP25_rs1051312_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNAP25_rs1051312_source.genetics | omni, sequenom, sequenom + omni | character |
SNAP25_rs1051312
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNAP25_rs1051312.genetics | C/C, C/T, T/C, T/T | character |
SNCA_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCA_1_source.genetics | sequenom | character |
SNCA_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCA_1.genetics | C/C | character |
SNCAIP_1_rs144384727_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_1_rs144384727_source.genetics | omni, sequenom, sequenom + omni | character |
SNCAIP_1_rs144384727
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_1_rs144384727.genetics | A/A | character |
SNCAIP_2_rs145038921_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_2_rs145038921_source.genetics | sequenom | character |
SNCAIP_2_rs145038921
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_2_rs145038921.genetics | G/G | character |
SNCAIP_3_rs140850272_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_3_rs140850272_source.genetics | omni, sequenom, sequenom + omni | character |
SNCAIP_3_rs140850272
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SNCAIP_3_rs140850272.genetics | A/G, G/A, G/G | character |
SOD1_1_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SOD1_1_source.genetics | sequenom | character |
SOD1_1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SOD1_1.genetics | A/A | character |
SORL1_1_rs62617129_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_1_rs62617129_source.genetics | omni, sequenom, sequenom + omni | character |
SORL1_1_rs62617129
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_1_rs62617129.genetics | A/A, A/G | character |
SORL1_10_rs2070045_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_10_rs2070045_source.genetics | omni, sequenom, sequenom + omni | character |
SORL1_10_rs2070045
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_10_rs2070045.genetics | G/G, G/T, T/G, T/T | character |
SORL1_11_rs3824968_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_11_rs3824968_source.genetics | omni, sequenom, sequenom + omni | character |
SORL1_11_rs3824968
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_11_rs3824968.genetics | A/A, A/T, T/A, T/T | character |
SORL1_2_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_2_source.genetics | sequenom | character |
SORL1_2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_2.genetics | G/G | character |
SORL1_3_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_3_source.genetics | sequenom | character |
SORL1_3
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_3.genetics | A/G | character |
SORL1_8_rs661057_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_8_rs661057_source.genetics | sequenom | character |
SORL1_8_rs661057
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_8_rs661057.genetics | C/C, C/T, T/T | character |
SORL1_9_rs12285364_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_9_rs12285364_source.genetics | sequenom | character |
SORL1_9_rs12285364
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SORL1_9_rs12285364.genetics | C/C, C/T | character |
SREBP1_1_rs11868035_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SREBP1_1_rs11868035_source.genetics | omni, sequenom, sequenom + omni | character |
SREBP1_1_rs11868035
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| SREBP1_1_rs11868035.genetics | A/A, A/G, G/A, G/G | character |
STX6_1_rs1411478_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| STX6_1_rs1411478_source.genetics | omni, sequenom, sequenom + omni | character |
STX6_1_rs1411478
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| STX6_1_rs1411478.genetics | A/A, A/G, G/G | character |
TARDBP_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TARDBP_source.genetics | sequenom | character |
TARDBP
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TARDBP.genetics | G/G | character |
TAU Haplotype_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TAU Haplotype_source.genetics | sequenom | character |
TAU Haplotype
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TAU Haplotype.genetics | H1/H1, H1/H2, H2/H2 | character |
TMEM106B_2_rs1020004_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM106B_2_rs1020004_source.genetics | sequenom | character |
TMEM106B_2_rs1020004
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM106B_2_rs1020004.genetics | C/T, T/T | character |
TMEM106B_rs1990622_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM106B_rs1990622_source.genetics | sequenom | character |
TMEM106B_rs1990622
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM106B_rs1990622.genetics | A/A, A/G, G/G | character |
TMEM175_1_rs6599389_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM175_1_rs6599389_source.genetics | omni, sequenom, sequenom + omni | character |
TMEM175_1_rs6599389
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TMEM175_1_rs6599389.genetics | A/A, A/G, G/A, G/G | character |
TOMM40_rs10524523_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TOMM40_rs10524523_source.genetics | sequenom | character |
TOMM40_rs10524523
| Variable Name | Type |
|---|---|
| TOMM40_rs10524523.genetics | character |
TPH1-S_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TPH1-S_source.genetics | sequenom | character |
TPH1-S
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TPH1-S.genetics | G/G, G/T, T/T | character |
TREM2_rs75932628_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TREM2_rs75932628_source.genetics | omni, sequenom, sequenom + omni | character |
TREM2_rs75932628
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TREM2_rs75932628.genetics | C/C, C/T | character |
TTRAP_rs2143340_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TTRAP_rs2143340_source.genetics | omni, sequenom, sequenom + omni | character |
TTRAP_rs2143340
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| TTRAP_rs2143340.genetics | A/A, A/G, G/G | character |
USP14_1_rs146959256_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| USP14_1_rs146959256_source.genetics | omni, sequenom, sequenom + omni | character |
USP14_1_rs146959256
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| USP14_1_rs146959256.genetics | C/C, C/T | character |
VNTR_1_rs2020942_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VNTR_1_rs2020942_source.genetics | sequenom | character |
VNTR_1_rs2020942
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VNTR_1_rs2020942.genetics | C/C, C/T, T/T | character |
VNTR_2_rs2066713_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VNTR_2_rs2066713_source.genetics | omni, sequenom, sequenom + omni | character |
VNTR_2_rs2066713
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VNTR_2_rs2066713.genetics | A/A, A/G, G/A, G/G | character |
Wijsman_1_rs7814569_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Wijsman_1_rs7814569_source.genetics | omni, sequenom, sequenom + omni | character |
Wijsman_1_rs7814569
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Wijsman_1_rs7814569.genetics | A/A, A/G, G/G | character |
Wijsman_2_rs4145454_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Wijsman_2_rs4145454_source.genetics | omni, sequenom, sequenom + omni | character |
Wijsman_2_rs4145454
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| Wijsman_2_rs4145454.genetics | C/C, C/T, T/T | character |
WWC1_rs17070145_source
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| WWC1_rs17070145_source.genetics | omni, sequenom, sequenom + omni | character |
WWC1_rs17070145
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| WWC1_rs17070145.genetics | C/C, C/T, T/T | character |
grit
Description :
The Short (8-item) Grit Scale (Grit-S; Duckworth & Quinn, 2009) is a self-report measure of trait-level perseverance and passion for long-term goals.
References :
Duckworth, A. L., & Quinn, P. D. (2009). Development and validation of the Short Grit Scale (GRIT–S). Journal of personality assessment, 91(2), 166-174.
Duckworth, A.L., Peterson, C., Matthews, M.D., & Kelly, D.R. (2007). Grit: Perseverance and passion for long-term goals. Journal of Personality and Social Psychology, 9, 1087-1101. http://www.sas.upenn.edu/~duckwort/images/Grit%20JPSP.pdf
grit_consistence_score
Description :
Consistency of Interest Subscale
References :
- Duckworth, A. L., & Quinn, P. D. (2009). Development and validation of the Short Grit Scale (GRIT–S). Journal of personality assessment, 91(2), 166-174.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| grit_consistence_score.grit | numeric | 1.00 | 5.00 |
grit_persev_eff_score
Description :
Perseverance of Effort Subscale
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| grit_persev_eff_score.grit | numeric | 1 | 5.00 |
grit_score
Description :
Total Grit Score - the maximum score on this scale is 5 (extremely gritty), and minimum score is 1 (not at all gritty)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| grit_score.grit | numeric | 1 | 5.000 |
health_history
abusothr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| abusothr.health_history | 0, 1, 2 | numeric |
abusx
| Variable Name | Type |
|---|---|
| abusx.health_history | character |
alcfreq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| alcfreq.health_history | 0, 1, 2, 3, 4 | numeric |
alcoccas
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| alcoccas.health_history | 0, 1 | numeric |
alcohol
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| alcohol.health_history | 0, 1, 2 | numeric |
anxiety
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anxiety.health_history | 0, 1, 2 | numeric |
apnea
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apnea.health_history | 0, 1, 2 | numeric |
arthloex
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthloex.health_history | 0, 1 | numeric |
arthrit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthrit.health_history | 0, 1, 2 | numeric |
arthspin
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthspin.health_history | 0, 1 | numeric |
arthtype
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthtype.health_history | 1, 2, 3 | numeric |
arthtypx
| Variable Name | Type |
|---|---|
| arthtypx.health_history | character |
arthunk
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthunk.health_history | 0, 1 | numeric |
arthupex
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| arthupex.health_history | 0, 1 | numeric |
b12def
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| b12def.health_history | 0, 1, 2 | numeric |
bipolar
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| bipolar.health_history | 0, 1, 2 | numeric |
cbothr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cbothr.health_history | 0, 1, 2 | numeric |
cbothrx
| Variable Name | Type |
|---|---|
| cbothrx.health_history | character |
cbstroke
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cbstroke.health_history | 0, 1, 2 | numeric |
cbtia
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cbtia.health_history | 0, 1, 2 | numeric |
cvafib
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvafib.health_history | 0, 1, 2 | numeric |
cvangina
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvangina.health_history | 0, 1, 2 | numeric |
cvangio
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvangio.health_history | 0, 1, 2 | numeric |
cvbypass
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvbypass.health_history | 0, 1, 2 | numeric |
cvchf
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvchf.health_history | 0, 1, 2 | numeric |
cvhatt
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvhatt.health_history | 0, 1, 2 | numeric |
cvhvalve
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvhvalve.health_history | 0, 1, 2 | numeric |
cvothr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvothr.health_history | 0, 1, 2 | numeric |
cvothrx
| Variable Name | Type |
|---|---|
| cvothrx.health_history | character |
cvpacdef
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvpacdef.health_history | 0, 1, 2 | numeric |
cvpace
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cvpace.health_history | 0, 1, 2 | numeric |
dep2yrs
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dep2yrs.health_history | 0, 1 | numeric |
depothr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| depothr.health_history | 0, 1 | numeric |
diabetes
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| diabetes.health_history | 0, 1, 2 | numeric |
diabtype
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| diabtype.health_history | 1, 2, 3 | numeric |
hattmult
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hattmult.health_history | 0, 1 | numeric |
hattyear
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hattyear.health_history | numeric | 1988 | 2018 |
hypercho
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hypercho.health_history | 0, 1, 2 | numeric |
hyperten
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hyperten.health_history | 0, 1, 2 | numeric |
incontf
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| incontf.health_history | 0, 1, 2 | numeric |
incontu
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| incontu.health_history | 0, 1, 2 | numeric |
insomn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| insomn.health_history | 0, 1, 2 | numeric |
ncothr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ncothr.health_history | 0, 1, 2 | numeric |
ncothrx
| Variable Name | Type |
|---|---|
| ncothrx.health_history | character |
npsydev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| npsydev.health_history | 0, 1, 2 | numeric |
ocd
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ocd.health_history | 0, 1, 2 | numeric |
othsleep
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| othsleep.health_history | 0, 1, 2 | numeric |
othsleex
| Variable Name | Type |
|---|---|
| othsleex.health_history | character |
packsper
| Variable Name | Type |
|---|---|
| packsper.health_history | numeric |
pd
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pd.health_history | 0, 1 | numeric |
pdothr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pdothr.health_history | 0, 1 | numeric |
pdothryr
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pdothryr.health_history | numeric | 1959 | 2022 |
pdyr
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pdyr.health_history | numeric | 2003 | 2020 |
psycdis
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| psycdis.health_history | 0, 1, 2 | numeric |
psycdisx
| Variable Name | Type |
|---|---|
| psycdisx.health_history | character |
ptsd
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptsd.health_history | 0, 1, 2 | numeric |
quitsmok
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| quitsmok.health_history | numeric | 0 | 1983 |
rbd
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rbd.health_history | 0, 1, 2 | numeric |
schiz
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| schiz.health_history | 0, 1, 2 | numeric |
seizures
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| seizures.health_history | 0, 1, 2 | numeric |
smokyrs
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| smokyrs.health_history | numeric | 0 | 80 |
strok1yr
| Variable Name | Type |
|---|---|
| strok1yr.health_history | numeric |
strok2yr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strok2yr.health_history | 2007 | numeric |
strokmul
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strokmul.health_history | 0, 1 | numeric |
strokyr
| Variable Name | Type |
|---|---|
| strokyr.health_history | numeric |
tbi
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tbi.health_history | 0, 1, 2 | numeric |
tbibrief
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tbibrief.health_history | 0, 1, 2 | numeric |
tbiexten
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tbiexten.health_history | 0, 1, 2 | numeric |
tbiwolos
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tbiwolos.health_history | 0, 1, 2 | numeric |
tbiyear
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tbiyear.health_history | numeric | 1938 | 2022 |
thyroid
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| thyroid.health_history | 0, 1, 2 | numeric |
tia1yr
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tia1yr.health_history | numeric | 1990 | 2014 |
tia2yr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia2yr.health_history | 2003, 2004, 2013 | numeric |
tia3yr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia3yr.health_history | 0, 2004, 2011 | numeric |
tia4yr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia4yr.health_history | 0 | numeric |
tia5yr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia5yr.health_history | 0 | numeric |
tia6yr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tia6yr.health_history | 0 | numeric |
tiamult
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tiamult.health_history | 0, 1 | numeric |
tiayear
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiayear.health_history | numeric | 1983 | 2020 |
tobac100
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tobac100.health_history | 0, 1 | numeric |
tobac30
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tobac30.health_history | 0, 1 | numeric |
traumbrf
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| traumbrf.health_history | 0, 1, 2 | numeric |
traumchr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| traumchr.health_history | 0, 1, 2 | numeric |
traumext
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| traumext.health_history | 0, 1, 2 | numeric |
imaging_dti_prisma_fa
Description :
Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Fractional anisotropy (FA) specifically assesses the directionality of the water diffusion. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Prisma scanner uses a multi-shell scheme where multiple b-values are used.
References :
- Basser, P. J., Mattiello, J., & LeBihan, D. (1994). Mr diffusion tensor spectroscopy and imaging. Biophysical Journal, 66(1), 259–267. https://doi.org/10.1016/s0006-3495(94)80775-1
anterior_corona_radiata_l
Description :
left anterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
anterior_corona_radiata_r
Description :
right anterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
anterior_limb_of_internal_capsule_r
Description :
right anterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
body_of_corpus_callosum
Description :
body of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| body_of_corpus_callosum.imaging_dti_prisma_fa | numeric | 0 | 1 |
cerebral_peduncle_l
Description :
left cerebral peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
cerebral_peduncle_r
Description :
right cerebral peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
cingulum_cingulate_gyrus_l
Description :
left cingulum cingulate gyrus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
cingulum_cingulate_gyrus_r
Description :
right cingulum cingulate gyrus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
corticospinal_tract_l
Description :
left corticospinal tract FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
corticospinal_tract_r
Description :
right corticospinal tract FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_dti_prisma_fa | numeric | 0 | infinity |
external_capsule_l
Description :
left external capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
external_capsule_r
Description :
right external capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
fornix_l
Description :
left fornix FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
fornix_r
Description :
right fornix FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
genu_of_corpus_callosum
Description :
genu of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| genu_of_corpus_callosum.imaging_dti_prisma_fa | numeric | 0 | 1 |
inferior_cerebellar_peduncle_l
Description :
left inferior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
inferior_cerebellar_peduncle_r
Description :
right inferior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
label
Description :
Calculation of FA in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_dti_prisma_fa | Mean | character |
medial_lemniscus_l
Description :
left medial lemniscus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
medial_lemniscus_r
Description :
right medial lemniscus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
middle_cerebellar_peduncle
Description :
middle cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| middle_cerebellar_peduncle.imaging_dti_prisma_fa | numeric | 0 | 1 |
pontine_crossing_tract_a_part_of_mcp
Description :
pontine crossing tract a part of mcp FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pontine_crossing_tract_a_part_of_mcp.imaging_dti_prisma_fa | numeric | 0 | 1 |
posterior_corona_radiata_l
Description :
left posterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
posterior_corona_radiata_r
Description :
right posterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
posterior_limb_of_internal_capsule_l
Description :
left posterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
posterior_limb_of_internal_capsule_r
Description :
right posterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
posterior_thalamic_radiation_l
Description :
left posterior thalamic radiation FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
posterior_thalamic_radiation_r
Description :
right posterior thalamic radiation FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
retrolenticular_part_of_internal_capsule_l
Description :
left retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
retrolenticular_part_of_internal_capsule_r
Description :
right retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
sagittal_stratum_l
Description :
left sagittal stratum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
sagittal_stratum_r
Description :
right sagittal stratum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
splenium_of_corpus_callosum
Description :
splenium of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| splenium_of_corpus_callosum.imaging_dti_prisma_fa | numeric | 0 | 1 |
superior_cerebellar_peduncle_l
Description :
left superior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
superior_cerebellar_peduncle_r
Description :
right superior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
superior_corona_radiata_l
Description :
left superior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
superior_corona_radiata_r
Description :
right superior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
superior_fronto_occipital_fasciculus_r
Description :
right superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
superior_longitudinal_fasciculus_l
Description :
left superior longitudinal fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
superior_longitudinal_fasciculus_r
Description :
right superior longitudinal fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_r.imaging_dti_prisma_fa | numeric | 0 | 1 |
tapetum_l
Description :
left tapetum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tapetum_l.imaging_dti_prisma_fa | numeric | 0 | 1 |
imaging_dti_prisma_md
Description :
Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Mean Diffusivity (MD) specifically assesses the number, size, or mylination of the tissue fibers in units of 10^-3 mm^2/s. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Prisma scanner uses a multi-shell scheme where multiple b-values are used.
References :
- Basser, P. J., Mattiello, J., & LeBihan, D. (1994). Mr diffusion tensor spectroscopy and imaging. Biophysical Journal, 66(1), 259–267. https://doi.org/10.1016/s0006-3495(94)80775-1
anterior_corona_radiata_l
Description :
left anterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_l.imaging_dti_prisma_md | numeric | 0 | 3 |
anterior_corona_radiata_r
Description :
right anterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_r.imaging_dti_prisma_md | numeric | 0 | 3 |
anterior_limb_of_internal_capsule_r
Description :
right anterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_r.imaging_dti_prisma_md | numeric | 0 | 3 |
body_of_corpus_callosum
Description :
body of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| body_of_corpus_callosum.imaging_dti_prisma_md | numeric | 0 | 3 |
cerebral_peduncle_l
Description :
left cerebral peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_l.imaging_dti_prisma_md | numeric | 0 | 3 |
cerebral_peduncle_r
Description :
right cerebral peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_r.imaging_dti_prisma_md | numeric | 0 | 3 |
cingulum_cingulate_gyrus_l
Description :
left cingulum cingulate gyrus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_l.imaging_dti_prisma_md | numeric | 0 | 3 |
cingulum_cingulate_gyrus_r
Description :
right cingulum cingulate gyrus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_r.imaging_dti_prisma_md | numeric | 0 | 3 |
corticospinal_tract_l
Description :
left corticospinal tract MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_l.imaging_dti_prisma_md | numeric | 0 | 3 |
corticospinal_tract_r
Description :
right corticospinal tract MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_r.imaging_dti_prisma_md | numeric | 0 | 3 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_dti_prisma_md | numeric | 0 | infinity |
external_capsule_l
Description :
left external capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_l.imaging_dti_prisma_md | numeric | 0 | 3 |
external_capsule_r
Description :
right external capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_r.imaging_dti_prisma_md | numeric | 0 | 3 |
fornix_l
Description :
left fornix MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_l.imaging_dti_prisma_md | numeric | 0 | 3 |
fornix_r
Description :
right fornix MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_r.imaging_dti_prisma_md | numeric | 0 | 3 |
genu_of_corpus_callosum
Description :
genu of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| genu_of_corpus_callosum.imaging_dti_prisma_md | numeric | 0 | 3 |
inferior_cerebellar_peduncle_l
Description :
left inferior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_l.imaging_dti_prisma_md | numeric | 0 | 3 |
inferior_cerebellar_peduncle_r
Description :
right inferior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_r.imaging_dti_prisma_md | numeric | 0 | 3 |
label
Description :
Calculation of MD in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_dti_prisma_md | Mean | character |
medial_lemniscus_l
Description :
left medial lemniscus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_l.imaging_dti_prisma_md | numeric | 0 | 3 |
medial_lemniscus_r
Description :
right medial lemniscus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_r.imaging_dti_prisma_md | numeric | 0 | 3 |
middle_cerebellar_peduncle
Description :
middle cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| middle_cerebellar_peduncle.imaging_dti_prisma_md | numeric | 0 | 3 |
pontine_crossing_tract_a_part_of_mcp
Description :
pontine crossing tract a part of mcp MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pontine_crossing_tract_a_part_of_mcp.imaging_dti_prisma_md | numeric | 0 | 3 |
posterior_corona_radiata_l
Description :
left posterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_l.imaging_dti_prisma_md | numeric | 0 | 3 |
posterior_corona_radiata_r
Description :
right posterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_r.imaging_dti_prisma_md | numeric | 0 | 3 |
posterior_limb_of_internal_capsule_l
Description :
left posterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_l.imaging_dti_prisma_md | numeric | 0 | 3 |
posterior_limb_of_internal_capsule_r
Description :
right posterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_r.imaging_dti_prisma_md | numeric | 0 | 3 |
posterior_thalamic_radiation_l
Description :
left posterior thalamic radiation MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_l.imaging_dti_prisma_md | numeric | 0 | 3 |
posterior_thalamic_radiation_r
Description :
right posterior thalamic radiation MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_r.imaging_dti_prisma_md | numeric | 0 | 3 |
retrolenticular_part_of_internal_capsule_l
Description :
left retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_l.imaging_dti_prisma_md | numeric | 0 | 3 |
retrolenticular_part_of_internal_capsule_r
Description :
right retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_r.imaging_dti_prisma_md | numeric | 0 | 3 |
sagittal_stratum_l
Description :
left sagittal stratum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_l.imaging_dti_prisma_md | numeric | 0 | 3 |
sagittal_stratum_r
Description :
right sagittal stratum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_r.imaging_dti_prisma_md | numeric | 0 | 3 |
splenium_of_corpus_callosum
Description :
splenium of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| splenium_of_corpus_callosum.imaging_dti_prisma_md | numeric | 0 | 3 |
superior_cerebellar_peduncle_l
Description :
left superior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_l.imaging_dti_prisma_md | numeric | 0 | 3 |
superior_cerebellar_peduncle_r
Description :
right superior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_r.imaging_dti_prisma_md | numeric | 0 | 3 |
superior_corona_radiata_l
Description :
left superior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_l.imaging_dti_prisma_md | numeric | 0 | 3 |
superior_corona_radiata_r
Description :
right superior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_r.imaging_dti_prisma_md | numeric | 0 | 3 |
superior_fronto_occipital_fasciculus_r
Description :
right superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_r.imaging_dti_prisma_md | numeric | 0 | 3 |
superior_longitudinal_fasciculus_l
Description :
left superior longitudinal fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_l.imaging_dti_prisma_md | numeric | 0 | 3 |
superior_longitudinal_fasciculus_r
Description :
right superior longitudinal fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_r.imaging_dti_prisma_md | numeric | 0 | 3 |
tapetum_l
Description :
left tapetum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tapetum_l.imaging_dti_prisma_md | numeric | 0 | 3 |
imaging_dti_trio_fa
Description :
Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Fractional anisotropy (FA) specifically assesses the directionality of the water diffusion. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Trio scanner uses a single-shell scheme where one b-value is used.
References :
- Basser, P. J., Mattiello, J., & LeBihan, D. (1994). Mr diffusion tensor spectroscopy and imaging. Biophysical Journal, 66(1), 259–267. https://doi.org/10.1016/s0006-3495(94)80775-1
anterior_corona_radiata_l
Description :
left anterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_l.imaging_dti_trio_fa | numeric | 0 | 1 |
anterior_corona_radiata_r
Description :
right anterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_r.imaging_dti_trio_fa | numeric | 0 | 1 |
anterior_limb_of_internal_capsule_l
Description :
left anterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_l.imaging_dti_trio_fa | numeric | 0 | 1 |
anterior_limb_of_internal_capsule_r
Description :
right anterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_r.imaging_dti_trio_fa | numeric | 0 | 1 |
body_of_corpus_callosum
Description :
body of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| body_of_corpus_callosum.imaging_dti_trio_fa | numeric | 0 | 1 |
cerebral_peduncle_l
Description :
left cerebral peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_l.imaging_dti_trio_fa | numeric | 0 | 1 |
cerebral_peduncle_r
Description :
right cerebral peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_r.imaging_dti_trio_fa | numeric | 0 | 1 |
cingulum_cingulate_gyrus_l
Description :
left cingulum cingulate gyrus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
cingulum_cingulate_gyrus_r
Description :
right cingulum cingulate gyrus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
cingulum_hippocampus_l
Description :
left cingulum hippocampus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_hippocampus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
cingulum_hippocampus_r
Description :
right cingulum hippocampus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_hippocampus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
corticospinal_tract_l
Description :
left corticospinal tract FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_l.imaging_dti_trio_fa | numeric | 0 | 1 |
corticospinal_tract_r
Description :
right corticospinal tract FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_r.imaging_dti_trio_fa | numeric | 0 | 1 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_dti_trio_fa | numeric | 0 | infinity |
external_capsule_l
Description :
left external capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_l.imaging_dti_trio_fa | numeric | 0 | 1 |
external_capsule_r
Description :
right external capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_r.imaging_dti_trio_fa | numeric | 0 | 1 |
fornix_l
Description :
left fornix FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_l.imaging_dti_trio_fa | numeric | 0 | 1 |
fornix_r
Description :
right fornix FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_r.imaging_dti_trio_fa | numeric | 0 | 1 |
genu_of_corpus_callosum
Description :
genu of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| genu_of_corpus_callosum.imaging_dti_trio_fa | numeric | 0 | 1 |
inferior_cerebellar_peduncle_l
Description :
left inferior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_l.imaging_dti_trio_fa | numeric | 0 | 1 |
inferior_cerebellar_peduncle_r
Description :
right inferior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_r.imaging_dti_trio_fa | numeric | 0 | 1 |
label
Description :
Calculation of FA in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_dti_trio_fa | Mean | character |
medial_lemniscus_l
Description :
left medial lemniscus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
medial_lemniscus_r
Description :
right medial lemniscus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
middle_cerebellar_peduncle
Description :
middle cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| middle_cerebellar_peduncle.imaging_dti_trio_fa | numeric | 0 | 1 |
pontine_crossing_tract_a_part_of_mcp
Description :
pontine crossing tract a part of mcp FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pontine_crossing_tract_a_part_of_mcp.imaging_dti_trio_fa | numeric | 0 | 1 |
posterior_corona_radiata_l
Description :
left posterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_l.imaging_dti_trio_fa | numeric | 0 | 1 |
posterior_corona_radiata_r
Description :
right posterior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_r.imaging_dti_trio_fa | numeric | 0 | 1 |
posterior_limb_of_internal_capsule_l
Description :
left posterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_l.imaging_dti_trio_fa | numeric | 0 | 1 |
posterior_limb_of_internal_capsule_r
Description :
right posterior limb of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_r.imaging_dti_trio_fa | numeric | 0 | 1 |
posterior_thalamic_radiation_l
Description :
left posterior thalamic radiation FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_l.imaging_dti_trio_fa | numeric | 0 | 1 |
posterior_thalamic_radiation_r
Description :
right posterior thalamic radiation FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_r.imaging_dti_trio_fa | numeric | 0 | 1 |
retrolenticular_part_of_internal_capsule_l
Description :
left retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_l.imaging_dti_trio_fa | numeric | 0 | 1 |
retrolenticular_part_of_internal_capsule_r
Description :
right retrolenticular part of internal capsule FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_r.imaging_dti_trio_fa | numeric | 0 | 1 |
sagittal_stratum_l
Description :
left sagittal stratum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_l.imaging_dti_trio_fa | numeric | 0 | 1 |
sagittal_stratum_r
Description :
right sagittal stratum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_r.imaging_dti_trio_fa | numeric | 0 | 1 |
splenium_of_corpus_callosum
Description :
splenium of corpus callosum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| splenium_of_corpus_callosum.imaging_dti_trio_fa | numeric | 0 | 1 |
superior_cerebellar_peduncle_l
Description :
left superior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_l.imaging_dti_trio_fa | numeric | 0 | 1 |
superior_cerebellar_peduncle_r
Description :
right superior cerebellar peduncle FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_r.imaging_dti_trio_fa | numeric | 0 | 1 |
superior_corona_radiata_l
Description :
left superior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_l.imaging_dti_trio_fa | numeric | 0 | 1 |
superior_corona_radiata_r
Description :
right superior corona radiata FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_r.imaging_dti_trio_fa | numeric | 0 | 1 |
superior_fronto_occipital_fasciculus_l
Description :
left superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
superior_fronto_occipital_fasciculus_r
Description :
right superior fronto occipital fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
superior_longitudinal_fasciculus_l
Description :
left superior longitudinal fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_l.imaging_dti_trio_fa | numeric | 0 | 1 |
superior_longitudinal_fasciculus_r
Description :
right superior longitudinal fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
tapetum_l
Description :
left tapetum FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tapetum_l.imaging_dti_trio_fa | numeric | 0 | 1 |
uncinate_fasciculus_r
Description :
right uncinate fasciculus FA value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uncinate_fasciculus_r.imaging_dti_trio_fa | numeric | 0 | 1 |
imaging_dti_trio_md
Description :
Diffusion Tensor Imaging (DTI) measures white matter microstructural organization. Mean Diffusivity (MD) specifically assesses the number, size, or mylination of the tissue fibers in units of 10^-3 mm^2/s. The MR scanner acquisition method plays an important role in the resulting diffusion metrics. The Trio scanner uses a single-shell scheme where one b-value is used.
References :
- Basser, P. J., Mattiello, J., & LeBihan, D. (1994). Mr diffusion tensor spectroscopy and imaging. Biophysical Journal, 66(1), 259–267. https://doi.org/10.1016/s0006-3495(94)80775-1
anterior_corona_radiata_l
Description :
left anterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_l.imaging_dti_trio_md | numeric | 0 | 3 |
anterior_corona_radiata_r
Description :
right anterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_corona_radiata_r.imaging_dti_trio_md | numeric | 0 | 3 |
anterior_limb_of_internal_capsule_l
Description :
left anterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_l.imaging_dti_trio_md | numeric | 0 | 3 |
anterior_limb_of_internal_capsule_r
Description :
right anterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| anterior_limb_of_internal_capsule_r.imaging_dti_trio_md | numeric | 0 | 3 |
body_of_corpus_callosum
Description :
body of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| body_of_corpus_callosum.imaging_dti_trio_md | numeric | 0 | 3 |
cerebral_peduncle_l
Description :
left cerebral peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_l.imaging_dti_trio_md | numeric | 0 | 3 |
cerebral_peduncle_r
Description :
right cerebral peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cerebral_peduncle_r.imaging_dti_trio_md | numeric | 0 | 3 |
cingulum_cingulate_gyrus_l
Description :
left cingulum cingulate gyrus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_l.imaging_dti_trio_md | numeric | 0 | 3 |
cingulum_cingulate_gyrus_r
Description :
right cingulum cingulate gyrus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_cingulate_gyrus_r.imaging_dti_trio_md | numeric | 0 | 3 |
cingulum_hippocampus_l
Description :
left cingulum hippocampus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_hippocampus_l.imaging_dti_trio_md | numeric | 0 | 3 |
cingulum_hippocampus_r
Description :
right cingulum hippocampus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cingulum_hippocampus_r.imaging_dti_trio_md | numeric | 0 | 3 |
corticospinal_tract_l
Description :
left corticospinal tract MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_l.imaging_dti_trio_md | numeric | 0 | 3 |
corticospinal_tract_r
Description :
right corticospinal tract MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| corticospinal_tract_r.imaging_dti_trio_md | numeric | 0 | 3 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_dti_trio_md | numeric | 0 | infinity |
external_capsule_l
Description :
left external capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_l.imaging_dti_trio_md | numeric | 0 | 3 |
external_capsule_r
Description :
right external capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| external_capsule_r.imaging_dti_trio_md | numeric | 0 | 3 |
fornix_l
Description :
left fornix MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_l.imaging_dti_trio_md | numeric | 0 | 3 |
fornix_r
Description :
right fornix MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fornix_r.imaging_dti_trio_md | numeric | 0 | 3 |
genu_of_corpus_callosum
Description :
genu of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| genu_of_corpus_callosum.imaging_dti_trio_md | numeric | 0 | 3 |
inferior_cerebellar_peduncle_l
Description :
left inferior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_l.imaging_dti_trio_md | numeric | 0 | 3 |
inferior_cerebellar_peduncle_r
Description :
right inferior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| inferior_cerebellar_peduncle_r.imaging_dti_trio_md | numeric | 0 | 3 |
label
Description :
Calculation of MD in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_dti_trio_md | Mean | character |
medial_lemniscus_l
Description :
left medial lemniscus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_l.imaging_dti_trio_md | numeric | 0 | 3 |
medial_lemniscus_r
Description :
right medial lemniscus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_lemniscus_r.imaging_dti_trio_md | numeric | 0 | 3 |
middle_cerebellar_peduncle
Description :
middle cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| middle_cerebellar_peduncle.imaging_dti_trio_md | numeric | 0 | 3 |
pontine_crossing_tract_a_part_of_mcp
Description :
pontine crossing tract a part of mcp MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pontine_crossing_tract_a_part_of_mcp.imaging_dti_trio_md | numeric | 0 | 3 |
posterior_corona_radiata_l
Description :
left posterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_l.imaging_dti_trio_md | numeric | 0 | 3 |
posterior_corona_radiata_r
Description :
right posterior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_corona_radiata_r.imaging_dti_trio_md | numeric | 0 | 3 |
posterior_limb_of_internal_capsule_l
Description :
left posterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_l.imaging_dti_trio_md | numeric | 0 | 3 |
posterior_limb_of_internal_capsule_r
Description :
right posterior limb of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_limb_of_internal_capsule_r.imaging_dti_trio_md | numeric | 0 | 3 |
posterior_thalamic_radiation_l
Description :
left posterior thalamic radiation MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_l.imaging_dti_trio_md | numeric | 0 | 3 |
posterior_thalamic_radiation_r
Description :
right posterior thalamic radiation MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| posterior_thalamic_radiation_r.imaging_dti_trio_md | numeric | 0 | 3 |
retrolenticular_part_of_internal_capsule_l
Description :
left retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_l.imaging_dti_trio_md | numeric | 0 | 3 |
retrolenticular_part_of_internal_capsule_r
Description :
right retrolenticular part of internal capsule MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| retrolenticular_part_of_internal_capsule_r.imaging_dti_trio_md | numeric | 0 | 3 |
sagittal_stratum_l
Description :
left sagittal stratum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_l.imaging_dti_trio_md | numeric | 0 | 3 |
sagittal_stratum_r
Description :
right sagittal stratum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sagittal_stratum_r.imaging_dti_trio_md | numeric | 0 | 3 |
splenium_of_corpus_callosum
Description :
splenium of corpus callosum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| splenium_of_corpus_callosum.imaging_dti_trio_md | numeric | 0 | 3 |
superior_cerebellar_peduncle_l
Description :
left superior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_l.imaging_dti_trio_md | numeric | 0 | 3 |
superior_cerebellar_peduncle_r
Description :
right superior cerebellar peduncle MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_cerebellar_peduncle_r.imaging_dti_trio_md | numeric | 0 | 3 |
superior_corona_radiata_l
Description :
left superior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_l.imaging_dti_trio_md | numeric | 0 | 3 |
superior_corona_radiata_r
Description :
right superior corona radiata MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_corona_radiata_r.imaging_dti_trio_md | numeric | 0 | 3 |
superior_fronto_occipital_fasciculus_l
Description :
left superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_l.imaging_dti_trio_md | numeric | 0 | 3 |
superior_fronto_occipital_fasciculus_r
Description :
right superior fronto occipital fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_fronto_occipital_fasciculus_r.imaging_dti_trio_md | numeric | 0 | 3 |
superior_longitudinal_fasciculus_l
Description :
left superior longitudinal fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_l.imaging_dti_trio_md | numeric | 0 | 3 |
superior_longitudinal_fasciculus_r
Description :
right superior longitudinal fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| superior_longitudinal_fasciculus_r.imaging_dti_trio_md | numeric | 0 | 3 |
tapetum_l
Description :
left tapetum MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tapetum_l.imaging_dti_trio_md | numeric | 0 | 3 |
uncinate_fasciculus_r
Description :
right uncinate fasciculus MD value (JHU ICBM WM atlas)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uncinate_fasciculus_r.imaging_dti_trio_md | numeric | 0 | 3 |
imaging_noddi_ficv
Description :
Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: neurite density index (NDI) specifically quantifies the packing density of axons or dendrites and is typically known to decrease from middle to old age.
References :
Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908
Cox, S. R., Ritchie, S. J., Tucker-Drob, E. M., Liewald, D. C., Hagenaars, S. P., Davies, G., Wardlaw, J. M., Gale, C. R., Bastin, M. E., & Deary, I. J. (2016). Ageing and brain white matter structure in 3,513 UK Biobank participants. Nature Communications, 7(1). https://doi.org/10.1038/ncomms13629
dont_worry_abt_col_names:
- Kraguljac, N. V., Guerreri, M., Strickland, M. J., & Zhang, H. (2023). Neurite orientation dispersion and density imaging in psychiatric disorders: A systematic literature review and a technical note. Biological Psychiatry Global Open Science, 3(1), 10–21. https://doi.org/10.1016/j.bpsgos.2021.12.012
ad_meta_six_composite
Description :
ad meta six composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_noddi_ficv | numeric | 0 | 1 |
ad_meta_ten_composite
Description :
ad meta ten composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_noddi_ficv | numeric | 0 | 1 |
brain_stem
Description :
brain stem NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_noddi_ficv | numeric | 0 | 1 |
cc_anterior
Description :
anterior corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_noddi_ficv | numeric | 0 | 1 |
cc_central
Description :
central corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_noddi_ficv | numeric | 0 | 1 |
cc_mid_anterior
Description :
mid anterior corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_noddi_ficv | numeric | 0 | 1 |
cc_mid_posterior
Description :
mid posterior corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_noddi_ficv | numeric | 0 | 1 |
cc_posterior
Description :
posterior corpus callosum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_noddi_ficv | numeric | 0 | 1 |
csf
Description :
csf NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_bankssts
Description :
left bankssts NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_caudalanteriorcingulate
Description :
left caudalanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_caudalmiddlefrontal
Description :
left caudalmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_cuneus
Description :
left cuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_entorhinal
Description :
left entorhinal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_frontalpole
Description :
left frontalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_fusiform
Description :
left fusiform NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_inferiorparietal
Description :
left inferiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_inferiortemporal
Description :
left inferiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_insula
Description :
left insula NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_isthmuscingulate
Description :
left isthmuscingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_lateraloccipital
Description :
left lateraloccipital NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_lateralorbitofrontal
Description :
left lateralorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_lingual
Description :
left lingual NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_medialorbitofrontal
Description :
left medialorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_middletemporal
Description :
left middletemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_paracentral
Description :
left paracentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_parahippocampal
Description :
left parahippocampal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_parsopercularis
Description :
left parsopercularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_parsorbitalis
Description :
left parsorbitalis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_parstriangularis
Description :
left parstriangularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_pericalcarine
Description :
left pericalcarine NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_postcentral
Description :
left postcentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_posteriorcingulate
Description :
left posteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_precentral
Description :
left precentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_precuneus
Description :
left precuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_rostralanteriorcingulate
Description :
left rostralanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_rostralmiddlefrontal
Description :
left rostralmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_superiorfrontal
Description :
left superiorfrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_superiorparietal
Description :
left superiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_superiortemporal
Description :
left superiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_supramarginal
Description :
left supramarginal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_temporalpole
Description :
left temporalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_transversetemporal
Description :
left transversetemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_lh_unknown
Description :
left unknown NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_bankssts
Description :
right bankssts NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_caudalanteriorcingulate
Description :
right caudalanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_caudalmiddlefrontal
Description :
right caudalmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_cuneus
Description :
right cuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_entorhinal
Description :
right entorhinal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_frontalpole
Description :
right frontalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_fusiform
Description :
right fusiform NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_inferiorparietal
Description :
right inferiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_inferiortemporal
Description :
right inferiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_insula
Description :
right insula NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_isthmuscingulate
Description :
right isthmuscingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_lateraloccipital
Description :
right lateraloccipital NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_lateralorbitofrontal
Description :
right lateralorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_lingual
Description :
right lingual NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_medialorbitofrontal
Description :
right medialorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_middletemporal
Description :
right middletemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_paracentral
Description :
right paracentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_parahippocampal
Description :
right parahippocampal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_parsopercularis
Description :
right parsopercularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_parsorbitalis
Description :
right parsorbitalis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_parstriangularis
Description :
right parstriangularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_pericalcarine
Description :
right pericalcarine NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_postcentral
Description :
right postcentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_posteriorcingulate
Description :
right posteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_precentral
Description :
right precentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_precuneus
Description :
right precuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_rostralanteriorcingulate
Description :
right rostralanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_rostralmiddlefrontal
Description :
right rostralmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_superiorfrontal
Description :
right superiorfrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_superiorparietal
Description :
right superiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_superiortemporal
Description :
right superiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_supramarginal
Description :
right supramarginal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_temporalpole
Description :
right temporalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_transversetemporal
Description :
right transversetemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_noddi_ficv | numeric | 0 | 1 |
ctx_rh_unknown
Description :
right unknown NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_noddi_ficv | numeric | 0 | 1 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_noddi_ficv | numeric | 0 | infinity |
frontal_composite
Description :
frontal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_noddi_ficv | numeric | 0 | 1 |
gm
Description :
global grey matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_noddi_ficv | numeric | 0 | infinity |
label
Description :
Calculation of NDI in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_noddi_ficv | Mean | character |
left_accumbens_area
Description :
left accumbens area NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_noddi_ficv | numeric | 0 | 1 |
left_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_noddi_ficv | numeric | 0.4698577 | 0.8280393 |
left_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_noddi_ficv | numeric | 0.4846368 | 0.8365276 |
left_amygdala
Description :
left amygdala NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_noddi_ficv | numeric | 0 | 1 |
left_caudate
Description :
left caudate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_noddi_ficv | numeric | 0 | 1 |
left_cerebellum_cortex
Description :
left cerebellum cortex NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_noddi_ficv | numeric | 0 | 1 |
left_cerebellum_white_matter
Description :
left cerebellum white matter NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_noddi_ficv | numeric | 0 | 1 |
left_choroid_plexus
Description :
left choroid plexus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_noddi_ficv | numeric | 0 | 1 |
left_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_noddi_ficv | numeric | 0.4472082 | 0.9415706 |
left_hippocampus
Description :
left hippocampus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_noddi_ficv | numeric | 0 | 1 |
left_inf_lat_vent
Description :
left inf lat vent NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_noddi_ficv | numeric | 0 | 1 |
left_lateral_ventricle
Description :
left lateral ventricle NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_noddi_ficv | numeric | 0 | 1 |
left_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_noddi_ficv | numeric | 0.5325407 | 0.9499977 |
left_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_noddi_ficv | numeric | 0.4375480 | 0.9048434 |
left_pallidum
Description :
left pallidum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_noddi_ficv | numeric | 0 | 1 |
left_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_noddi_ficv | numeric | 0.4365152 | 0.8114024 |
left_putamen
Description :
left putamen NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_noddi_ficv | numeric | 0 | 1 |
left_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_noddi_ficv | numeric | 0.4934487 | 0.8373833 |
left_thalamus_proper
Description :
left thalamus proper NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_noddi_ficv | numeric | 0 | 1 |
left_unsegmented_white_matter
Description :
left unsegmented white matter NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_noddi_ficv | numeric | 0 | 1 |
left_ventral_dc
Description :
left ventral dc NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_noddi_ficv | numeric | 0 | 1 |
left_vessel
Description :
left vessel NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_noddi_ficv | numeric | 0 | 1 |
medial_temporal_composite
Description :
medial temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_noddi_ficv | numeric | 0 | 1 |
occipital_composite
Description :
occipital composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_noddi_ficv | numeric | 0 | 1 |
optic_chiasm
Description :
optic chiasm NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_noddi_ficv | numeric | 0 | 1 |
parietal_composite
Description :
parietal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_noddi_ficv | numeric | 0 | 1 |
right_accumbens_area
Description :
right accumbens area NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_noddi_ficv | numeric | 0 | 1 |
right_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_noddi_ficv | numeric | 0.4771932 | 0.8793782 |
right_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_noddi_ficv | numeric | 0.4776771 | 0.8796096 |
right_amygdala
Description :
right amygdala NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_noddi_ficv | numeric | 0 | 1 |
right_caudate
Description :
right caudate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_noddi_ficv | numeric | 0 | 1 |
right_cerebellum_cortex
Description :
right cerebellum cortex NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_noddi_ficv | numeric | 0 | 1 |
right_cerebellum_white_matter
Description :
right cerebellum white matter NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_noddi_ficv | numeric | 0 | 1 |
right_choroid_plexus
Description :
right choroid plexus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_noddi_ficv | numeric | 0 | 1 |
right_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_noddi_ficv | numeric | 0.4398425 | 0.9567229 |
right_hippocampus
Description :
right hippocampus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_noddi_ficv | numeric | 0 | 1 |
right_inf_lat_vent
Description :
right inf lat vent NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_noddi_ficv | numeric | 0 | 1 |
right_lateral_ventricle
Description :
right lateral ventricle NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_noddi_ficv | numeric | 0 | 1 |
right_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_noddi_ficv | numeric | 0.5349477 | 0.9731770 |
right_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_noddi_ficv | numeric | 0.4204730 | 0.9093815 |
right_pallidum
Description :
right pallidum NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_noddi_ficv | numeric | 0 | 1 |
right_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_noddi_ficv | numeric | 0.4361167 | 0.7980473 |
right_putamen
Description :
right putamen NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_noddi_ficv | numeric | 0 | 1 |
right_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_noddi_ficv | numeric | 0.4878995 | 0.8851367 |
right_thalamus_proper
Description :
right thalamus proper NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_noddi_ficv | numeric | 0 | 1 |
right_unsegmented_white_matter
Description :
right unsegmented white matter NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_noddi_ficv | numeric | 0 | 1 |
right_ventral_dc
Description :
right ventral dc NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_noddi_ficv | numeric | 0 | 1 |
right_vessel
Description :
right vessel NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_noddi_ficv | numeric | 0 | 1 |
temporal_composite
Description :
temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_noddi_ficv | numeric | 0 | 1 |
tiv
Description :
global total intracranial volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_noddi_ficv | numeric | 0 | infinity |
wm_hypointensities
Description :
white matter hypointensities NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_bankssts
Description :
white matter left bankssts NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_caudalanteriorcingulate
Description :
white matter left caudalanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_caudalmiddlefrontal
Description :
white matter left caudalmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_cuneus
Description :
white matter left cuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_entorhinal
Description :
white matter left entorhinal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_frontalpole
Description :
white matter left frontalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_fusiform
Description :
white matter left fusiform NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_inferiorparietal
Description :
white matter left inferiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_inferiortemporal
Description :
white matter left inferiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_insula
Description :
white matter left insula NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_isthmuscingulate
Description :
white matter left isthmuscingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_lateraloccipital
Description :
white matter left lateraloccipital NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_lateralorbitofrontal
Description :
white matter left lateralorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_lingual
Description :
white matter left lingual NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_medialorbitofrontal
Description :
white matter left medialorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_middletemporal
Description :
white matter left middletemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_paracentral
Description :
white matter left paracentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_parahippocampal
Description :
white matter left parahippocampal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_parsopercularis
Description :
white matter left parsopercularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_parsorbitalis
Description :
white matter left parsorbitalis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_parstriangularis
Description :
white matter left parstriangularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_pericalcarine
Description :
white matter left pericalcarine NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_postcentral
Description :
white matter left postcentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_posteriorcingulate
Description :
white matter left posteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_precentral
Description :
white matter left precentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_precuneus
Description :
white matter left precuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_rostralanteriorcingulate
Description :
white matter left rostralanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_rostralmiddlefrontal
Description :
white matter left rostralmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_superiorfrontal
Description :
white matter left superiorfrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_superiorparietal
Description :
white matter left superiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_superiortemporal
Description :
white matter left superiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_supramarginal
Description :
white matter left supramarginal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_temporalpole
Description :
white matter left temporalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_noddi_ficv | numeric | 0 | 1 |
wm_lh_transversetemporal
Description :
white matter left transversetemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_bankssts
Description :
white matter right bankssts NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_caudalanteriorcingulate
Description :
white matter right caudalanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_caudalmiddlefrontal
Description :
white matter right caudalmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_cuneus
Description :
white matter right cuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_entorhinal
Description :
white matter right entorhinal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_frontalpole
Description :
white matter right frontalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_fusiform
Description :
white matter right fusiform NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_inferiorparietal
Description :
white matter right inferiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_inferiortemporal
Description :
white matter right inferiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_insula
Description :
white matter right insula NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_isthmuscingulate
Description :
white matter right isthmuscingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_lateraloccipital
Description :
white matter right lateraloccipital NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_lateralorbitofrontal
Description :
white matter right lateralorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_lingual
Description :
white matter right lingual NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_medialorbitofrontal
Description :
white matter right medialorbitofrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_middletemporal
Description :
white matter right middletemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_paracentral
Description :
white matter right paracentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_parahippocampal
Description :
white matter right parahippocampal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_parsopercularis
Description :
white matter right parsopercularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_parsorbitalis
Description :
white matter right parsorbitalis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_parstriangularis
Description :
white matter right parstriangularis NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_pericalcarine
Description :
white matter right pericalcarine NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_postcentral
Description :
white matter right postcentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_posteriorcingulate
Description :
white matter right posteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_precentral
Description :
white matter right precentral NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_precuneus
Description :
white matter right precuneus NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_rostralanteriorcingulate
Description :
white matter right rostralanteriorcingulate NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_rostralmiddlefrontal
Description :
white matter right rostralmiddlefrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_superiorfrontal
Description :
white matter right superiorfrontal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_superiorparietal
Description :
white matter right superiorparietal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_superiortemporal
Description :
white matter right superiortemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_supramarginal
Description :
white matter right supramarginal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_temporalpole
Description :
white matter right temporalpole NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_noddi_ficv | numeric | 0 | 1 |
wm_rh_transversetemporal
Description :
white matter right transversetemporal NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_noddi_ficv | numeric | 0 | 1 |
wm
Description :
global white matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_noddi_ficv | numeric | 0 | infinity |
x3rd_ventricle
Description :
3rd ventricle NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_noddi_ficv | numeric | 0 | 1 |
x4th_ventricle
Description :
4th ventricle NDI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_noddi_ficv | numeric | 0 | 1 |
imaging_noddi_fiso
Description :
Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: free water fraction (FWF) estimates the extent of CSF contamination which points to a use as a marker for inflammation.
References :
Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908
Kraguljac, N. V., Guerreri, M., Strickland, M. J., & Zhang, H. (2023). Neurite orientation dispersion and density imaging in psychiatric disorders: A systematic literature review and a technical note. Biological Psychiatry Global Open Science, 3(1), 10–21. https://doi.org/10.1016/j.bpsgos.2021.12.012
ad_meta_six_composite
Description :
ad meta six composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_noddi_fiso | numeric | 0 | 1 |
ad_meta_ten_composite
Description :
ad meta ten composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_noddi_fiso | numeric | 0 | 1 |
brain_stem
Description :
brain stem free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_noddi_fiso | numeric | 0 | 1 |
cc_anterior
Description :
anterior corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_noddi_fiso | numeric | 0 | 1 |
cc_central
Description :
central corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_noddi_fiso | numeric | 0 | 1 |
cc_mid_anterior
Description :
mid anterior corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_noddi_fiso | numeric | 0 | 1 |
cc_mid_posterior
Description :
mid posterior corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_noddi_fiso | numeric | 0 | 1 |
cc_posterior
Description :
posterior corpus callosum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_noddi_fiso | numeric | 0 | 1 |
csf
Description :
csf free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_bankssts
Description :
left bankssts free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_caudalanteriorcingulate
Description :
left caudalanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_caudalmiddlefrontal
Description :
left caudalmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_cuneus
Description :
left cuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_entorhinal
Description :
left entorhinal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_frontalpole
Description :
left frontalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_fusiform
Description :
left fusiform free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_inferiorparietal
Description :
left inferiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_inferiortemporal
Description :
left inferiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_insula
Description :
left insula free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_isthmuscingulate
Description :
left isthmuscingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_lateraloccipital
Description :
left lateraloccipital free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_lateralorbitofrontal
Description :
left lateralorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_lingual
Description :
left lingual free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_medialorbitofrontal
Description :
left medialorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_middletemporal
Description :
left middletemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_paracentral
Description :
left paracentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_parahippocampal
Description :
left parahippocampal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_parsopercularis
Description :
left parsopercularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_parsorbitalis
Description :
left parsorbitalis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_parstriangularis
Description :
left parstriangularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_pericalcarine
Description :
left pericalcarine free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_postcentral
Description :
left postcentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_posteriorcingulate
Description :
left posteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_precentral
Description :
left precentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_precuneus
Description :
left precuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_rostralanteriorcingulate
Description :
left rostralanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_rostralmiddlefrontal
Description :
left rostralmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_superiorfrontal
Description :
left superiorfrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_superiorparietal
Description :
left superiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_superiortemporal
Description :
left superiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_supramarginal
Description :
left supramarginal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_temporalpole
Description :
left temporalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_transversetemporal
Description :
left transversetemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_lh_unknown
Description :
left unknown free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_bankssts
Description :
right bankssts free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_caudalanteriorcingulate
Description :
right caudalanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_caudalmiddlefrontal
Description :
right caudalmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_cuneus
Description :
right cuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_entorhinal
Description :
right entorhinal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_frontalpole
Description :
right frontalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_fusiform
Description :
right fusiform free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_inferiorparietal
Description :
right inferiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_inferiortemporal
Description :
right inferiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_insula
Description :
right insula free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_isthmuscingulate
Description :
right isthmuscingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_lateraloccipital
Description :
right lateraloccipital free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_lateralorbitofrontal
Description :
right lateralorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_lingual
Description :
right lingual free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_medialorbitofrontal
Description :
right medialorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_middletemporal
Description :
right middletemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_paracentral
Description :
right paracentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_parahippocampal
Description :
right parahippocampal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_parsopercularis
Description :
right parsopercularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_parsorbitalis
Description :
right parsorbitalis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_parstriangularis
Description :
right parstriangularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_pericalcarine
Description :
right pericalcarine free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_postcentral
Description :
right postcentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_posteriorcingulate
Description :
right posteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_precentral
Description :
right precentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_precuneus
Description :
right precuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_rostralanteriorcingulate
Description :
right rostralanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_rostralmiddlefrontal
Description :
right rostralmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_superiorfrontal
Description :
right superiorfrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_superiorparietal
Description :
right superiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_superiortemporal
Description :
right superiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_supramarginal
Description :
right supramarginal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_temporalpole
Description :
right temporalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_transversetemporal
Description :
right transversetemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_noddi_fiso | numeric | 0 | 1 |
ctx_rh_unknown
Description :
right unknown free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_noddi_fiso | numeric | 0 | 1 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_noddi_fiso | numeric | 0 | infinty |
frontal_composite
Description :
frontal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_noddi_fiso | numeric | 0 | 1 |
gm
Description :
global grey matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_noddi_fiso | numeric | 0 | infinty |
label
Description :
Calculation of free water fraction in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_noddi_fiso | Mean | character |
left_accumbens_area
Description :
left accumbens area free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_noddi_fiso | numeric | 0 | 1 |
left_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_noddi_fiso | numeric | 0.03746143 | 0.49354400 |
left_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_noddi_fiso | numeric | 0.03488694 | 0.48884290 |
left_amygdala
Description :
left amygdala free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_noddi_fiso | numeric | 0 | 1 |
left_caudate
Description :
left caudate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_noddi_fiso | numeric | 0 | 1 |
left_cerebellum_cortex
Description :
left cerebellum cortex free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_noddi_fiso | numeric | 0 | 1 |
left_cerebellum_white_matter
Description :
left cerebellum white matter free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_noddi_fiso | numeric | 0 | 1 |
left_choroid_plexus
Description :
left choroid plexus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_noddi_fiso | numeric | 0 | 1 |
left_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_noddi_fiso | numeric | 0.04986550 | 0.50509410 |
left_hippocampus
Description :
left hippocampus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_noddi_fiso | numeric | 0 | 1 |
left_inf_lat_vent
Description :
left inf lat vent free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_noddi_fiso | numeric | 0 | 1 |
left_lateral_ventricle
Description :
left lateral ventricle free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_noddi_fiso | numeric | 0 | 1 |
left_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_noddi_fiso | numeric | 0.06271857 | 0.49622000 |
left_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_noddi_fiso | numeric | 0.03683771 | 0.52225537 |
left_pallidum
Description :
left pallidum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_noddi_fiso | numeric | 0 | 1 |
left_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_noddi_fiso | numeric | 0.04079328 | 0.55622300 |
left_putamen
Description :
left putamen free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_noddi_fiso | numeric | 0 | 1 |
left_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_noddi_fiso | numeric | 0.03968512 | 0.48812327 |
left_thalamus_proper
Description :
left thalamus proper free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_noddi_fiso | numeric | 0 | 1 |
left_unsegmented_white_matter
Description :
left unsegmented white matter free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_noddi_fiso | numeric | 0 | 1 |
left_ventral_dc
Description :
left ventral dc free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_noddi_fiso | numeric | 0 | 1 |
left_vessel
Description :
left vessel free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_noddi_fiso | numeric | 0 | 1 |
medial_temporal_composite
Description :
medial temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_noddi_fiso | numeric | 0 | 1 |
occipital_composite
Description :
occipital composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_noddi_fiso | numeric | 0 | 1 |
optic_chiasm
Description :
optic chiasm free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_noddi_fiso | numeric | 0 | 1 |
parietal_composite
Description :
parietal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_noddi_fiso | numeric | 0 | 1 |
right_accumbens_area
Description :
right accumbens area free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_noddi_fiso | numeric | 0 | 1 |
right_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_noddi_fiso | numeric | 0.03734681 | 0.49804217 |
right_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_noddi_fiso | numeric | 0.03975091 | 0.48304460 |
right_amygdala
Description :
right amygdala free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_noddi_fiso | numeric | 0 | 1 |
right_caudate
Description :
right caudate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_noddi_fiso | numeric | 0 | 1 |
right_cerebellum_cortex
Description :
right cerebellum cortex free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_noddi_fiso | numeric | 0 | 1 |
right_cerebellum_white_matter
Description :
right cerebellum white matter free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_noddi_fiso | numeric | 0 | 1 |
right_choroid_plexus
Description :
right choroid plexus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_noddi_fiso | numeric | 0 | 1 |
right_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_noddi_fiso | numeric | 0.04790281 | 0.51155520 |
right_hippocampus
Description :
right hippocampus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_noddi_fiso | numeric | 0 | 1 |
right_inf_lat_vent
Description :
right inf lat vent free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_noddi_fiso | numeric | 0 | 1 |
right_lateral_ventricle
Description :
right lateral ventricle free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_noddi_fiso | numeric | 0 | 1 |
right_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_noddi_fiso | numeric | 0.07241590 | 0.51515600 |
right_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_noddi_fiso | numeric | 0.02757500 | 0.52851000 |
right_pallidum
Description :
right pallidum free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_noddi_fiso | numeric | 0 | 1 |
right_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_noddi_fiso | numeric | 0.03990878 | 0.55479617 |
right_putamen
Description :
right putamen free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_noddi_fiso | numeric | 0 | 1 |
right_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_noddi_fiso | numeric | 0.04204959 | 0.47913809 |
right_thalamus_proper
Description :
right thalamus proper free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_noddi_fiso | numeric | 0 | 1 |
right_unsegmented_white_matter
Description :
right unsegmented white matter free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_noddi_fiso | numeric | 0 | 1 |
right_ventral_dc
Description :
right ventral dc free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_noddi_fiso | numeric | 0 | 1 |
right_vessel
Description :
right vessel free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_noddi_fiso | numeric | 0 | 1 |
temporal_composite
Description :
temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_noddi_fiso | numeric | 0 | 1 |
tiv
Description :
global total intracranial volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_noddi_fiso | numeric | 0 | infinity |
wm_hypointensities
Description :
white matter hypointensities free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_bankssts
Description :
white matter left bankssts free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_caudalanteriorcingulate
Description :
white matter left caudalanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_caudalmiddlefrontal
Description :
white matter left caudalmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_cuneus
Description :
white matter left cuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_entorhinal
Description :
white matter left entorhinal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_frontalpole
Description :
white matter left frontalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_fusiform
Description :
white matter left fusiform free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_inferiorparietal
Description :
white matter left inferiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_inferiortemporal
Description :
white matter left inferiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_insula
Description :
white matter left insula free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_isthmuscingulate
Description :
white matter left isthmuscingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_lateraloccipital
Description :
white matter left lateraloccipital free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_lateralorbitofrontal
Description :
white matter left lateralorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_lingual
Description :
white matter left lingual free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_medialorbitofrontal
Description :
white matter left medialorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_middletemporal
Description :
white matter left middletemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_paracentral
Description :
white matter left paracentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_parahippocampal
Description :
white matter left parahippocampal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_parsopercularis
Description :
white matter left parsopercularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_parsorbitalis
Description :
white matter left parsorbitalis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_parstriangularis
Description :
white matter left parstriangularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_pericalcarine
Description :
white matter left pericalcarine free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_postcentral
Description :
white matter left postcentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_posteriorcingulate
Description :
white matter left posteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_precentral
Description :
white matter left precentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_precuneus
Description :
white matter left precuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_rostralanteriorcingulate
Description :
white matter left rostralanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_rostralmiddlefrontal
Description :
white matter left rostralmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_superiorfrontal
Description :
white matter left superiorfrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_superiorparietal
Description :
white matter left superiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_superiortemporal
Description :
white matter left superiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_supramarginal
Description :
white matter left supramarginal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_temporalpole
Description :
white matter left temporalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_noddi_fiso | numeric | 0 | 1 |
wm_lh_transversetemporal
Description :
white matter left transversetemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_bankssts
Description :
white matter right bankssts free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_caudalanteriorcingulate
Description :
white matter right caudalanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_caudalmiddlefrontal
Description :
white matter right caudalmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_cuneus
Description :
white matter right cuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_entorhinal
Description :
white matter right entorhinal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_frontalpole
Description :
white matter right frontalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_fusiform
Description :
white matter right fusiform free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_inferiorparietal
Description :
white matter right inferiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_inferiortemporal
Description :
white matter right inferiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_insula
Description :
white matter right insula free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_isthmuscingulate
Description :
white matter right isthmuscingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_lateraloccipital
Description :
white matter right lateraloccipital free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_lateralorbitofrontal
Description :
white matter right lateralorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_lingual
Description :
white matter right lingual free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_medialorbitofrontal
Description :
white matter right medialorbitofrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_middletemporal
Description :
white matter right middletemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_paracentral
Description :
white matter right paracentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_parahippocampal
Description :
white matter right parahippocampal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_parsopercularis
Description :
white matter right parsopercularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_parsorbitalis
Description :
white matter right parsorbitalis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_parstriangularis
Description :
white matter right parstriangularis free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_pericalcarine
Description :
white matter right pericalcarine free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_postcentral
Description :
white matter right postcentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_posteriorcingulate
Description :
white matter right posteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_precentral
Description :
white matter right precentral free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_precuneus
Description :
white matter right precuneus free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_rostralanteriorcingulate
Description :
white matter right rostralanteriorcingulate free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_rostralmiddlefrontal
Description :
white matter right rostralmiddlefrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_superiorfrontal
Description :
white matter right superiorfrontal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_superiorparietal
Description :
white matter right superiorparietal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_superiortemporal
Description :
white matter right superiortemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_supramarginal
Description :
white matter right supramarginal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_temporalpole
Description :
white matter right temporalpole free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_noddi_fiso | numeric | 0 | 1 |
wm_rh_transversetemporal
Description :
white matter right transversetemporal free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_noddi_fiso | numeric | 0 | 1 |
wm
Description :
global white matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_noddi_fiso | numeric | 0 | infinity |
x3rd_ventricle
Description :
3rd ventricle free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_noddi_fiso | numeric | 0 | 1 |
x4th_ventricle
Description :
4th ventricle free water fraction value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_noddi_fiso | numeric | 0 | 1 |
imaging_noddi_odi
Description :
Neurite orientation dispersion and density imaging (NODDI) is a biophysically inspired model that is thought to be more sensitive and specific to white matter (WM) microstructural abnormalities than other diffusion imaging modalitties. The NODDI metric: orientation dispersion index (ODI) assesses the orientational coherence of neurites and generally shows a nonlinear increase until around 60 years, followed by a decrease.
References :
Kamiya, K., Hori, M., & Aoki, S. (2020). Noddi in clinical research. Journal of Neuroscience Methods, 346, 108908. https://doi.org/10.1016/j.jneumeth.2020.108908
Kraguljac, N. V., Guerreri, M., Strickland, M. J., & Zhang, H. (2023). Neurite orientation dispersion and density imaging in psychiatric disorders: A systematic literature review and a technical note. Biological Psychiatry Global Open Science, 3(1), 10–21. https://doi.org/10.1016/j.bpsgos.2021.12.012
ad_meta_six_composite
Description :
ad meta six composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_noddi_odi | numeric | 0 | 1 |
ad_meta_ten_composite
Description :
ad meta ten composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_noddi_odi | numeric | 0 | 1 |
brain_stem
Description :
brain stem ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_noddi_odi | numeric | 0 | 1 |
cc_anterior
Description :
anterior corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_noddi_odi | numeric | 0 | 1 |
cc_central
Description :
central corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_noddi_odi | numeric | 0 | 1 |
cc_mid_anterior
Description :
mid anterior corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_noddi_odi | numeric | 0 | 1 |
cc_mid_posterior
Description :
mid posterior corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_noddi_odi | numeric | 0 | 1 |
cc_posterior
Description :
posterior corpus callosum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_noddi_odi | numeric | 0 | 1 |
csf
Description :
csf ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_bankssts
Description :
left bankssts ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_caudalanteriorcingulate
Description :
left caudalanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_caudalmiddlefrontal
Description :
left caudalmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_cuneus
Description :
left cuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_entorhinal
Description :
left entorhinal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_frontalpole
Description :
left frontalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_fusiform
Description :
left fusiform ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_inferiorparietal
Description :
left inferiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_inferiortemporal
Description :
left inferiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_insula
Description :
left insula ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_isthmuscingulate
Description :
left isthmuscingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_lateraloccipital
Description :
left lateraloccipital ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_lateralorbitofrontal
Description :
left lateralorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_lingual
Description :
left lingual ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_medialorbitofrontal
Description :
left medialorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_middletemporal
Description :
left middletemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_paracentral
Description :
left paracentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_parahippocampal
Description :
left parahippocampal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_parsopercularis
Description :
left parsopercularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_parsorbitalis
Description :
left parsorbitalis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_parstriangularis
Description :
left parstriangularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_pericalcarine
Description :
left pericalcarine ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_postcentral
Description :
left postcentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_posteriorcingulate
Description :
left posteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_precentral
Description :
left precentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_precuneus
Description :
left precuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_rostralanteriorcingulate
Description :
left rostralanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_rostralmiddlefrontal
Description :
left rostralmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_superiorfrontal
Description :
left superiorfrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_superiorparietal
Description :
left superiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_superiortemporal
Description :
left superiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_supramarginal
Description :
left supramarginal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_temporalpole
Description :
left temporalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_transversetemporal
Description :
left transversetemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_lh_unknown
Description :
left unknown ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_bankssts
Description :
right bankssts ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_caudalanteriorcingulate
Description :
right caudalanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_caudalmiddlefrontal
Description :
right caudalmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_cuneus
Description :
right cuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_entorhinal
Description :
right entorhinal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_frontalpole
Description :
right frontalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_fusiform
Description :
right fusiform ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_inferiorparietal
Description :
right inferiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_inferiortemporal
Description :
right inferiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_insula
Description :
right insula ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_isthmuscingulate
Description :
right isthmuscingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_lateraloccipital
Description :
right lateraloccipital ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_lateralorbitofrontal
Description :
right lateralorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_lingual
Description :
right lingual ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_medialorbitofrontal
Description :
right medialorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_middletemporal
Description :
right middletemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_paracentral
Description :
right paracentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_parahippocampal
Description :
right parahippocampal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_parsopercularis
Description :
right parsopercularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_parsorbitalis
Description :
right parsorbitalis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_parstriangularis
Description :
right parstriangularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_pericalcarine
Description :
right pericalcarine ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_postcentral
Description :
right postcentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_posteriorcingulate
Description :
right posteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_precentral
Description :
right precentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_precuneus
Description :
right precuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_rostralanteriorcingulate
Description :
right rostralanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_rostralmiddlefrontal
Description :
right rostralmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_superiorfrontal
Description :
right superiorfrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_superiorparietal
Description :
right superiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_superiortemporal
Description :
right superiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_supramarginal
Description :
right supramarginal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_temporalpole
Description :
right temporalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_transversetemporal
Description :
right transversetemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_noddi_odi | numeric | 0 | 1 |
ctx_rh_unknown
Description :
right unknown ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_noddi_odi | numeric | 0 | 1 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_noddi_odi | numeric | 0 | infinity |
frontal_composite
Description :
frontal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_noddi_odi | numeric | 0 | 1 |
gm
Description :
global grey matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_noddi_odi | numeric | 0 | infinity |
label
Description :
Calculation of ODI in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_noddi_odi | Mean | character |
left_accumbens_area
Description :
left accumbens area ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_noddi_odi | numeric | 0 | 1 |
left_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_noddi_odi | numeric | 0.5017342 | 0.6957600 |
left_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_noddi_odi | numeric | 0.5116984 | 0.6690579 |
left_amygdala
Description :
left amygdala ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_noddi_odi | numeric | 0 | 1 |
left_caudate
Description :
left caudate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_noddi_odi | numeric | 0 | 1 |
left_cerebellum_cortex
Description :
left cerebellum cortex ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_noddi_odi | numeric | 0 | 1 |
left_cerebellum_white_matter
Description :
left cerebellum white matter ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_noddi_odi | numeric | 0 | 1 |
left_choroid_plexus
Description :
left choroid plexus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_noddi_odi | numeric | 0 | 1 |
left_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_noddi_odi | numeric | 0.4978984 | 0.7251463 |
left_hippocampus
Description :
left hippocampus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_noddi_odi | numeric | 0 | 1 |
left_inf_lat_vent
Description :
left inf lat vent ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_noddi_odi | numeric | 0 | 1 |
left_lateral_ventricle
Description :
left lateral ventricle ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_noddi_odi | numeric | 0 | 1 |
left_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_noddi_odi | numeric | 0.5604377 | 0.7650453 |
left_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_noddi_odi | numeric | 0.5106432 | 0.6527217 |
left_pallidum
Description :
left pallidum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_noddi_odi | numeric | 0 | 1 |
left_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_noddi_odi | numeric | 0.4797904 | 0.6032680 |
left_putamen
Description :
left putamen ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_noddi_odi | numeric | 0 | 1 |
left_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_noddi_odi | numeric | 0.5279805 | 0.6823442 |
left_thalamus_proper
Description :
left thalamus proper ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_noddi_odi | numeric | 0 | 1 |
left_unsegmented_white_matter
Description :
left unsegmented white matter ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_noddi_odi | numeric | 0 | 1 |
left_ventral_dc
Description :
left ventral dc ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_noddi_odi | numeric | 0 | 1 |
left_vessel
Description :
left vessel ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_noddi_odi | numeric | 0 | 1 |
medial_temporal_composite
Description :
medial temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_noddi_odi | numeric | 0 | 1 |
occipital_composite
Description :
occipital composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_noddi_odi | numeric | 0 | 1 |
optic_chiasm
Description :
optic chiasm ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_noddi_odi | numeric | 0 | 1 |
parietal_composite
Description :
parietal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_noddi_odi | numeric | 0 | 1 |
right_accumbens_area
Description :
right accumbens area ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_noddi_odi | numeric | 0 | 1 |
right_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_noddi_odi | numeric | 0.5384152 | 0.7193815 |
right_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_noddi_odi | numeric | 0.5355784 | 0.6875598 |
right_amygdala
Description :
right amygdala ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_noddi_odi | numeric | 0 | 1 |
right_caudate
Description :
right caudate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_noddi_odi | numeric | 0 | 1 |
right_cerebellum_cortex
Description :
right cerebellum cortex ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_noddi_odi | numeric | 0 | 1 |
right_cerebellum_white_matter
Description :
right cerebellum white matter ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_noddi_odi | numeric | 0 | 1 |
right_choroid_plexus
Description :
right choroid plexus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_noddi_odi | numeric | 0 | 1 |
right_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_noddi_odi | numeric | 0.4878051 | 0.7193713 |
right_hippocampus
Description :
right hippocampus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_noddi_odi | numeric | 0 | 1 |
right_inf_lat_vent
Description :
right inf lat vent ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_noddi_odi | numeric | 0 | 1 |
right_lateral_ventricle
Description :
right lateral ventricle ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_noddi_odi | numeric | 0 | 1 |
right_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_noddi_odi | numeric | 0.5675093 | 0.7628787 |
right_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_noddi_odi | numeric | 0.4840530 | 0.6685028 |
right_pallidum
Description :
right pallidum ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_noddi_odi | numeric | 0 | 1 |
right_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_noddi_odi | numeric | 0.5051765 | 0.6119965 |
right_putamen
Description :
right putamen ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_noddi_odi | numeric | 0 | 1 |
right_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_noddi_odi | numeric | 0.5383616 | 0.6977409 |
right_thalamus_proper
Description :
right thalamus proper ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_noddi_odi | numeric | 0 | 1 |
right_unsegmented_white_matter
Description :
right unsegmented white matter ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_noddi_odi | numeric | 0 | 1 |
right_ventral_dc
Description :
right ventral dc ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_noddi_odi | numeric | 0 | 1 |
right_vessel
Description :
right vessel ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_noddi_odi | numeric | 0 | 1 |
temporal_composite
Description :
temporal composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_noddi_odi | numeric | 0 | 1 |
tiv
Description :
global total intracranial volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_noddi_odi | numeric | 0 | infinity |
wm_hypointensities
Description :
white matter hypointensities ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_bankssts
Description :
white matter left bankssts ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_caudalanteriorcingulate
Description :
white matter left caudalanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_caudalmiddlefrontal
Description :
white matter left caudalmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_cuneus
Description :
white matter left cuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_entorhinal
Description :
white matter left entorhinal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_frontalpole
Description :
white matter left frontalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_fusiform
Description :
white matter left fusiform ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_inferiorparietal
Description :
white matter left inferiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_inferiortemporal
Description :
white matter left inferiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_insula
Description :
white matter left insula ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_isthmuscingulate
Description :
white matter left isthmuscingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_lateraloccipital
Description :
white matter left lateraloccipital ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_lateralorbitofrontal
Description :
white matter left lateralorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_lingual
Description :
white matter left lingual ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_medialorbitofrontal
Description :
white matter left medialorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_middletemporal
Description :
white matter left middletemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_paracentral
Description :
white matter left paracentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_parahippocampal
Description :
white matter left parahippocampal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_parsopercularis
Description :
white matter left parsopercularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_parsorbitalis
Description :
white matter left parsorbitalis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_parstriangularis
Description :
white matter left parstriangularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_pericalcarine
Description :
white matter left pericalcarine ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_postcentral
Description :
white matter left postcentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_posteriorcingulate
Description :
white matter left posteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_precentral
Description :
white matter left precentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_precuneus
Description :
white matter left precuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_rostralanteriorcingulate
Description :
white matter left rostralanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_rostralmiddlefrontal
Description :
white matter left rostralmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_superiorfrontal
Description :
white matter left superiorfrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_superiorparietal
Description :
white matter left superiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_superiortemporal
Description :
white matter left superiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_supramarginal
Description :
white matter left supramarginal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_temporalpole
Description :
white matter left temporalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_noddi_odi | numeric | 0 | 1 |
wm_lh_transversetemporal
Description :
white matter left transversetemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_bankssts
Description :
white matter right bankssts ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_caudalanteriorcingulate
Description :
white matter right caudalanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_caudalmiddlefrontal
Description :
white matter right caudalmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_cuneus
Description :
white matter right cuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_entorhinal
Description :
white matter right entorhinal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_frontalpole
Description :
white matter right frontalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_fusiform
Description :
white matter right fusiform ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_inferiorparietal
Description :
white matter right inferiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_inferiortemporal
Description :
white matter right inferiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_insula
Description :
white matter right insula ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_isthmuscingulate
Description :
white matter right isthmuscingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_lateraloccipital
Description :
white matter right lateraloccipital ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_lateralorbitofrontal
Description :
white matter right lateralorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_lingual
Description :
white matter right lingual ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_medialorbitofrontal
Description :
white matter right medialorbitofrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_middletemporal
Description :
white matter right middletemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_paracentral
Description :
white matter right paracentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_parahippocampal
Description :
white matter right parahippocampal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_parsopercularis
Description :
white matter right parsopercularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_parsorbitalis
Description :
white matter right parsorbitalis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_parstriangularis
Description :
white matter right parstriangularis ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_pericalcarine
Description :
white matter right pericalcarine ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_postcentral
Description :
white matter right postcentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_posteriorcingulate
Description :
white matter right posteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_precentral
Description :
white matter right precentral ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_precuneus
Description :
white matter right precuneus ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_rostralanteriorcingulate
Description :
white matter right rostralanteriorcingulate ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_rostralmiddlefrontal
Description :
white matter right rostralmiddlefrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_superiorfrontal
Description :
white matter right superiorfrontal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_superiorparietal
Description :
white matter right superiorparietal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_superiortemporal
Description :
white matter right superiortemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_supramarginal
Description :
white matter right supramarginal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_temporalpole
Description :
white matter right temporalpole ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_noddi_odi | numeric | 0 | 1 |
wm_rh_transversetemporal
Description :
white matter right transversetemporal ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_noddi_odi | numeric | 0 | 1 |
wm
Description :
global white matter volume (mm^3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_noddi_odi | numeric | 0 | infinity |
x3rd_ventricle
Description :
3rd ventricle ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_noddi_odi | numeric | 0 | 1 |
x4th_ventricle
Description :
4th ventricle ODI value (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_noddi_odi | numeric | 0 | 1 |
imaging_pasl
Description :
PASL, or pulsed pseudocontinuous arterial spin labeling, is an MRI sequence used to non-invasively measure cerebral blood flow (CBF). Values in this sheet represent CBF in raw units of mL/100g tissues/min
References :
Dolui, S., Vidorreta, M., Wang, Z., Nasrallah, I. M., Alavi, A., Wolk, D. A., & Detre, J. A. (2017). Comparison of PASL, PCASL, and background‐suppressed 3D PCASL in mild cognitive impairment. Human brain mapping, 38(10), 5260-5273.
van Osch, M. J. P., Hendrikse, J., & van der Grond, J. (2006). Sensitivity comparison of multiple vs. single inversion time pulsed arterial spin labeling fmri. Journal of Magnetic Resonance Imaging, 25(1), 215–221. https://doi.org/10.1002/jmri.20823
ad_meta_six_composite
Description :
ad meta six composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_pasl | numeric | 0 | 42.905092 |
ad_meta_ten_composite
Description :
ad meta ten composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_pasl | numeric | 0 | 41.026320 |
brain_stem
Description :
brainstem CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_pasl | numeric | 0 | 5.838820 |
cbf
Description :
whole brain CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cbf.imaging_pasl | numeric | 0 | 48.597288 |
cc_anterior
Description :
anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_pasl | numeric | 0 | -0.34388400 |
cc_central
Description :
central corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_pasl | numeric | 0 | -1.07872000 |
cc_mid_anterior
Description :
mid anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_pasl | numeric | 0 | -9.82317e-02 |
cc_mid_posterior
Description :
mid posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_pasl | numeric | 0 | 10.2442000 |
cc_posterior
Description :
posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_pasl | numeric | 0 | -1.419870000 |
csf
Description :
csf CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_pasl | numeric | 0 | 26.611700 |
ctx_lh_bankssts
Description :
left banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_pasl | numeric | 0 | 96.08980 |
ctx_lh_caudalanteriorcingulate
Description :
left caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_pasl | numeric | 0 | 33.772300 |
ctx_lh_caudalmiddlefrontal
Description :
left caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_pasl | numeric | 0 | 36.34160 |
ctx_lh_cuneus
Description :
left cuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_pasl | numeric | 0 | 64.97480 |
ctx_lh_entorhinal
Description :
left entorhinal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_pasl | numeric | 0 | 55.218200 |
ctx_lh_frontalpole
Description :
left frontalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_pasl | numeric | 0 | -15.842900 |
ctx_lh_fusiform
Description :
left fusiform CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_pasl | numeric | 0 | 47.00600 |
ctx_lh_inferiorparietal
Description :
left inferiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_pasl | numeric | 0 | 45.894900 |
ctx_lh_inferiortemporal
Description :
left inferiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_pasl | numeric | 0 | 46.03040000 |
ctx_lh_insula
Description :
left insula CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_pasl | numeric | 0 | 49.18260 |
ctx_lh_isthmuscingulate
Description :
left isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_pasl | numeric | 0 | 61.85910 |
ctx_lh_lateraloccipital
Description :
left lateraloccipital CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_pasl | numeric | 0 | 64.02000 |
ctx_lh_lateralorbitofrontal
Description :
left lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_pasl | numeric | 0 | -25.1460000 |
ctx_lh_lingual
Description :
left lingual CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_pasl | numeric | 0 | 70.56480 |
ctx_lh_medialorbitofrontal
Description :
left medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_pasl | numeric | 0 | -21.63080 |
ctx_lh_middletemporal
Description :
left middletemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_pasl | numeric | 0 | 50.314700 |
ctx_lh_paracentral
Description :
left paracentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_pasl | numeric | 0 | 47.473400 |
ctx_lh_parahippocampal
Description :
left parahippocampal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_pasl | numeric | 0 | 62.15120 |
ctx_lh_parsopercularis
Description :
left parsopercularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_pasl | numeric | 0 | 50.13850 |
ctx_lh_parsorbitalis
Description :
left parsorbitalis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_pasl | numeric | 0 | -15.071500 |
ctx_lh_parstriangularis
Description :
left parstriangularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_pasl | numeric | 0 | 48.83140 |
ctx_lh_pericalcarine
Description :
left pericalcarine CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_pasl | numeric | 0 | 66.84170 |
ctx_lh_postcentral
Description :
left postcentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_pasl | numeric | 0 | 40.07190 |
ctx_lh_posteriorcingulate
Description :
left posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_pasl | numeric | 0 | 62.371700 |
ctx_lh_precentral
Description :
left precentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_pasl | numeric | 0 | 37.26010 |
ctx_lh_precuneus
Description :
left precuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_pasl | numeric | 0 | 50.5834000 |
ctx_lh_rostralanteriorcingulate
Description :
left rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_pasl | numeric | 0 | 36.757800 |
ctx_lh_rostralmiddlefrontal
Description :
left rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_pasl | numeric | 0 | 36.38880 |
ctx_lh_superiorfrontal
Description :
left superiorfrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_pasl | numeric | 0 | 31.87120 |
ctx_lh_superiorparietal
Description :
left superiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_pasl | numeric | 0 | 33.678600 |
ctx_lh_superiortemporal
Description :
left superiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_pasl | numeric | 0 | 58.68570 |
ctx_lh_supramarginal
Description :
left supramarginal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_pasl | numeric | 0 | 67.10780 |
ctx_lh_temporalpole
Description :
left temporalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_pasl | numeric | 0 | -42.085400 |
ctx_lh_transversetemporal
Description :
left transversetemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_pasl | numeric | 0 | 66.95150 |
ctx_lh_unknown
Description :
left unknown CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_pasl | numeric | 0 | 34.025700 |
ctx_rh_bankssts
Description :
right banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_pasl | numeric | 0 | 77.46440 |
ctx_rh_caudalanteriorcingulate
Description :
right caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_pasl | numeric | 0 | 67.18200 |
ctx_rh_caudalmiddlefrontal
Description :
right caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_pasl | numeric | 0 | 33.580500 |
ctx_rh_cuneus
Description :
right cuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_pasl | numeric | 0 | 64.531600 |
ctx_rh_entorhinal
Description :
right entorhinal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_pasl | numeric | 0 | -22.7758000 |
ctx_rh_frontalpole
Description :
right frontalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_pasl | numeric | 0 | -41.6373000 |
ctx_rh_fusiform
Description :
right fusiform CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_pasl | numeric | 0 | 47.688100 |
ctx_rh_inferiorparietal
Description :
right inferiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_pasl | numeric | 0 | 51.804300 |
ctx_rh_inferiortemporal
Description :
right inferiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_pasl | numeric | 0 | 42.0412000 |
ctx_rh_insula
Description :
right insula CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_pasl | numeric | 0 | 62.14270 |
ctx_rh_isthmuscingulate
Description :
right isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_pasl | numeric | 0 | 67.46070 |
ctx_rh_lateraloccipital
Description :
right lateraloccipital CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_pasl | numeric | 0 | 52.461400 |
ctx_rh_lateralorbitofrontal
Description :
right lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_pasl | numeric | 0 | -22.34480 |
ctx_rh_lingual
Description :
right lingual CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_pasl | numeric | 0 | 61.6776 |
ctx_rh_medialorbitofrontal
Description :
right medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_pasl | numeric | 0 | -18.0972000 |
ctx_rh_middletemporal
Description :
right middletemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_pasl | numeric | 0 | 58.4179000 |
ctx_rh_paracentral
Description :
right paracentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_pasl | numeric | 0 | 51.56490 |
ctx_rh_parahippocampal
Description :
right parahippocampal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_pasl | numeric | 0 | 64.62400 |
ctx_rh_parsopercularis
Description :
right parsopercularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_pasl | numeric | 0 | 60.06110 |
ctx_rh_parsorbitalis
Description :
right parsorbitalis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_pasl | numeric | 0 | -10.820600 |
ctx_rh_parstriangularis
Description :
right parstriangularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_pasl | numeric | 0 | 61.84620 |
ctx_rh_pericalcarine
Description :
right pericalcarine CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_pasl | numeric | 0 | 70.60640 |
ctx_rh_postcentral
Description :
right postcentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_pasl | numeric | 0 | 39.06360 |
ctx_rh_posteriorcingulate
Description :
right posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_pasl | numeric | 0 | 112.12600 |
ctx_rh_precentral
Description :
right precentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_pasl | numeric | 0 | 39.40180 |
ctx_rh_precuneus
Description :
right precuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_pasl | numeric | 0 | 52.44960 |
ctx_rh_rostralanteriorcingulate
Description :
right rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_pasl | numeric | 0 | -21.93730 |
ctx_rh_rostralmiddlefrontal
Description :
right rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_pasl | numeric | 0 | 35.3218000 |
ctx_rh_superiorfrontal
Description :
right superiorfrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_pasl | numeric | 0 | 38.76000 |
ctx_rh_superiorparietal
Description :
right superiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_pasl | numeric | 0 | 31.831100 |
ctx_rh_superiortemporal
Description :
right superiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_pasl | numeric | 0 | 75.75780 |
ctx_rh_supramarginal
Description :
right supramarginal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_pasl | numeric | 0 | 58.54960 |
ctx_rh_temporalpole
Description :
right temporalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_pasl | numeric | 0 | -28.388600 |
ctx_rh_transversetemporal
Description :
right transversetemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_pasl | numeric | 0 | 87.1071 |
ctx_rh_unknown
Description :
right unknown CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_pasl | numeric | 0 | 45.786800 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_pasl | numeric | 0 | infinity |
frontal_composite
Description :
frontal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_pasl | numeric | 0 | 36.435655 |
gm
Description :
global grey matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_pasl | numeric | 0 | infinity |
label
Description :
Calculation of CBF in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_pasl | Mean | character |
left_accumbens_area
Description :
left accumbens area CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_pasl | numeric | 0 | 46.98080 |
left_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_pasl | numeric | 4.7904724 | 47.5018000 |
left_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_pasl | numeric | 5.798903 | 41.755200 |
left_amygdala
Description :
left amygdala CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_pasl | numeric | 0 | 51.67600 |
left_caudate
Description :
left caudate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_pasl | numeric | 0 | 31.72720 |
left_cerebellum_cortex
Description :
left cerebellum cortex CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_pasl | numeric | 0 | 47.25200 |
left_cerebellum_white_matter
Description :
left cerebellum white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_pasl | numeric | 0 | 12.40110000 |
left_choroid_plexus
Description :
left choroid plexus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_pasl | numeric | 0 | 17.783600 |
left_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_pasl | numeric | 3.044970 | 37.126320 |
left_hippocampus
Description :
left hippocampus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_pasl | numeric | 0 | 49.95020 |
left_inf_lat_vent
Description :
left inf lat vent CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_pasl | numeric | 0 | 32.701100 |
left_lateral_ventricle
Description :
left lateral ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_pasl | numeric | 0 | 5.6376700 |
left_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_pasl | numeric | 2.539067 | 45.596400 |
left_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_pasl | numeric | 8.09869 | 53.71102 |
left_pallidum
Description :
left pallidum CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_pasl | numeric | 0 | 7.666590 |
left_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_pasl | numeric | 5.143659 | 41.692340 |
left_putamen
Description :
left putamen CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_pasl | numeric | 0 | 45.5755 |
left_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_pasl | numeric | 6.100476 | 45.025036 |
left_thalamus_proper
Description :
left thalamus proper CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_pasl | numeric | 0 | 35.39800 |
left_unsegmented_white_matter
Description :
left unsegmented white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_pasl | numeric | 0 | -0.1604700 |
left_ventral_dc
Description :
left ventral dc CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_pasl | numeric | 0 | 14.311000 |
left_vessel
Description :
left vessel CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_pasl | numeric | 0 | 52.05920 |
medial_temporal_composite
Description :
medial temporal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_pasl | numeric | 0 | 44.674817 |
occipital_composite
Description :
occipital composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_pasl | numeric | 0 | 53.71102 |
optic_chiasm
Description :
optic chiasm CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_pasl | numeric | 0 | 19.48280000 |
parietal_composite
Description :
parietal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_pasl | numeric | 0 | 41.876280 |
right_accumbens_area
Description :
right accumbens area CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_pasl | numeric | 0 | -13.87700 |
right_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_pasl | numeric | 1.579717 | 48.657500 |
right_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_pasl | numeric | 1.807209 | 44.149230 |
right_amygdala
Description :
right amygdala CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_pasl | numeric | 0 | 60.72200 |
right_caudate
Description :
right caudate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_pasl | numeric | 0 | 31.59500 |
right_cerebellum_cortex
Description :
right cerebellum cortex CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_pasl | numeric | 0 | 48.32400 |
right_cerebellum_white_matter
Description :
right cerebellum white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_pasl | numeric | 0 | 10.0875000 |
right_choroid_plexus
Description :
right choroid plexus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_pasl | numeric | 0 | 20.07650 |
right_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_pasl | numeric | 3.546092 | 38.628910 |
right_hippocampus
Description :
right hippocampus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_pasl | numeric | 0 | 55.71020 |
right_inf_lat_vent
Description :
right inf lat vent CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_pasl | numeric | 0 | 34.207700 |
right_lateral_ventricle
Description :
right lateral ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_pasl | numeric | 0 | 3.8153000 |
right_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_pasl | numeric | 2.834333 | 47.991533 |
right_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_pasl | numeric | 10.34520 | 54.98035 |
right_pallidum
Description :
right pallidum CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_pasl | numeric | 0 | 3.162990 |
right_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_pasl | numeric | 7.457093 | 42.538450 |
right_putamen
Description :
right putamen CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_pasl | numeric | 0 | 46.14060 |
right_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_pasl | numeric | 3.200217 | 49.025009 |
right_thalamus_proper
Description :
right thalamus proper CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_pasl | numeric | 0 | 39.32210 |
right_unsegmented_white_matter
Description :
right unsegmented white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_pasl | numeric | 0 | -0.0367542 |
right_ventral_dc
Description :
right ventral dc CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_pasl | numeric | 0 | 17.99840 |
right_vessel
Description :
right vessel CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_pasl | numeric | 0 | 51.976500 |
temporal_composite
Description :
temporal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_pasl | numeric | 0 | 47.025023 |
tiv
Description :
global total intracranial volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_pasl | numeric | 0 | 2039491 |
wm_hypointensities
Description :
white matter hypointensities CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_pasl | numeric | 0 | 40.00370 |
wm_lh_bankssts
Description :
white matter left bankssts CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_pasl | numeric | 0 | 20.277800 |
wm_lh_caudalanteriorcingulate
Description :
white matter left caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_pasl | numeric | 0 | -0.430474000 |
wm_lh_caudalmiddlefrontal
Description :
white matter left caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_pasl | numeric | 0 | 15.660400 |
wm_lh_cuneus
Description :
white matter left cuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_pasl | numeric | 0 | 34.145000 |
wm_lh_entorhinal
Description :
white matter left entorhinal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_pasl | numeric | 0 | 21.7266000 |
wm_lh_frontalpole
Description :
white matter left frontalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_pasl | numeric | 0 | 34.794000 |
wm_lh_fusiform
Description :
white matter left fusiform CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_pasl | numeric | 0 | 20.21880 |
wm_lh_inferiorparietal
Description :
white matter left inferiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_pasl | numeric | 0 | 23.8169000 |
wm_lh_inferiortemporal
Description :
white matter left inferiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_pasl | numeric | 0 | -10.3157000 |
wm_lh_insula
Description :
white matter left insula CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_pasl | numeric | 0 | 15.35160 |
wm_lh_isthmuscingulate
Description :
white matter left isthmuscingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_pasl | numeric | 0 | 9.338530 |
wm_lh_lateraloccipital
Description :
white matter left lateraloccipital CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_pasl | numeric | 0 | 32.155200 |
wm_lh_lateralorbitofrontal
Description :
white matter left lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_pasl | numeric | 0 | 14.602400 |
wm_lh_lingual
Description :
white matter left lingual CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_pasl | numeric | 0 | 30.39160 |
wm_lh_medialorbitofrontal
Description :
white matter left medialorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_pasl | numeric | 0 | 12.268100 |
wm_lh_middletemporal
Description :
white matter left middletemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_pasl | numeric | 0 | 27.03220 |
wm_lh_paracentral
Description :
white matter left paracentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_pasl | numeric | 0 | -1.1495800 |
wm_lh_parahippocampal
Description :
white matter left parahippocampal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_pasl | numeric | 0 | 19.84480 |
wm_lh_parsopercularis
Description :
white matter left parsopercularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_pasl | numeric | 0 | 12.92010 |
wm_lh_parsorbitalis
Description :
white matter left parsorbitalis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_pasl | numeric | 0 | 25.936900 |
wm_lh_parstriangularis
Description :
white matter left parstriangularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_pasl | numeric | 0 | 21.78530 |
wm_lh_pericalcarine
Description :
white matter left pericalcarine CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_pasl | numeric | 0 | 26.344000 |
wm_lh_postcentral
Description :
white matter left postcentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_pasl | numeric | 0 | 25.70490 |
wm_lh_posteriorcingulate
Description :
white matter left posteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_pasl | numeric | 0 | 11.2279000 |
wm_lh_precentral
Description :
white matter left precentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_pasl | numeric | 0 | 12.5106000 |
wm_lh_precuneus
Description :
white matter left precuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_pasl | numeric | 0 | 17.282800 |
wm_lh_rostralanteriorcingulate
Description :
white matter left rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_pasl | numeric | 0 | -0.173023000 |
wm_lh_rostralmiddlefrontal
Description :
white matter left rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_pasl | numeric | 0 | 16.281600 |
wm_lh_superiorfrontal
Description :
white matter left superiorfrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_pasl | numeric | 0 | -0.9617850 |
wm_lh_superiorparietal
Description :
white matter left superiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_pasl | numeric | 0 | 12.85440000 |
wm_lh_superiortemporal
Description :
white matter left superiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_pasl | numeric | 0 | 18.66070 |
wm_lh_supramarginal
Description :
white matter left supramarginal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_pasl | numeric | 0 | 23.49320 |
wm_lh_temporalpole
Description :
white matter left temporalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_pasl | numeric | 0 | -16.359100 |
wm_lh_transversetemporal
Description :
white matter left transversetemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_pasl | numeric | 0 | 23.83980 |
wm_rh_bankssts
Description :
white matter right bankssts CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_pasl | numeric | 0 | 10.97010 |
wm_rh_caudalanteriorcingulate
Description :
white matter right caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_pasl | numeric | 0 | 11.6144000 |
wm_rh_caudalmiddlefrontal
Description :
white matter right caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_pasl | numeric | 0 | 10.776900 |
wm_rh_cuneus
Description :
white matter right cuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_pasl | numeric | 0 | 34.01130 |
wm_rh_entorhinal
Description :
white matter right entorhinal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_pasl | numeric | 0 | 17.2635000 |
wm_rh_frontalpole
Description :
white matter right frontalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_pasl | numeric | 0 | -23.5439000 |
wm_rh_fusiform
Description :
white matter right fusiform CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_pasl | numeric | 0 | 22.23840 |
wm_rh_inferiorparietal
Description :
white matter right inferiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_pasl | numeric | 0 | 21.495800 |
wm_rh_inferiortemporal
Description :
white matter right inferiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_pasl | numeric | 0 | 21.1081000 |
wm_rh_insula
Description :
white matter right insula CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_pasl | numeric | 0 | 14.27250 |
wm_rh_isthmuscingulate
Description :
white matter right isthmuscingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_pasl | numeric | 0 | 12.413200 |
wm_rh_lateraloccipital
Description :
white matter right lateraloccipital CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_pasl | numeric | 0 | 31.23930 |
wm_rh_lateralorbitofrontal
Description :
white matter right lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_pasl | numeric | 0 | 17.22780 |
wm_rh_lingual
Description :
white matter right lingual CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_pasl | numeric | 0 | 30.72980 |
wm_rh_medialorbitofrontal
Description :
white matter right medialorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_pasl | numeric | 0 | 12.0676000 |
wm_rh_middletemporal
Description :
white matter right middletemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_pasl | numeric | 0 | 20.430700 |
wm_rh_paracentral
Description :
white matter right paracentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_pasl | numeric | 0 | -1.5267000 |
wm_rh_parahippocampal
Description :
white matter right parahippocampal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_pasl | numeric | 0 | 22.40610 |
wm_rh_parsopercularis
Description :
white matter right parsopercularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_pasl | numeric | 0 | 11.01320 |
wm_rh_parsorbitalis
Description :
white matter right parsorbitalis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_pasl | numeric | 0 | 28.303500 |
wm_rh_parstriangularis
Description :
white matter right parstriangularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_pasl | numeric | 0 | 20.13200 |
wm_rh_pericalcarine
Description :
white matter right pericalcarine CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_pasl | numeric | 0 | 33.77730 |
wm_rh_postcentral
Description :
white matter right postcentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_pasl | numeric | 0 | 17.440200 |
wm_rh_posteriorcingulate
Description :
white matter right posteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_pasl | numeric | 0 | 26.9787000 |
wm_rh_precentral
Description :
white matter right precentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_pasl | numeric | 0 | -0.4669170 |
wm_rh_precuneus
Description :
white matter right precuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_pasl | numeric | 0 | 15.30730 |
wm_rh_rostralanteriorcingulate
Description :
white matter right rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_pasl | numeric | 0 | 10.4125000 |
wm_rh_rostralmiddlefrontal
Description :
white matter right rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_pasl | numeric | 0 | 12.697700 |
wm_rh_superiorfrontal
Description :
white matter right superiorfrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_pasl | numeric | 0 | 10.041000 |
wm_rh_superiorparietal
Description :
white matter right superiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_pasl | numeric | 0 | 14.0930000 |
wm_rh_superiortemporal
Description :
white matter right superiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_pasl | numeric | 0 | 16.47790 |
wm_rh_supramarginal
Description :
white matter right supramarginal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_pasl | numeric | 0 | 17.23680 |
wm_rh_temporalpole
Description :
white matter right temporalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_pasl | numeric | 0 | 23.9682000 |
wm_rh_transversetemporal
Description :
white matter right transversetemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_pasl | numeric | 0 | 15.372000 |
wm
Description :
global white matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_pasl | numeric | 0 | 643893.3 |
x3rd_ventricle
Description :
3rd ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_pasl | numeric | 0 | 16.9449000 |
x4th_ventricle
Description :
4th ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_pasl | numeric | 0 | 19.7679000 |
imaging_pcasl
Description :
PCASL, or pseudocontinuous arterial spin labeling, is an MRI sequence used to non-invasively measure cerebral blood flow (CBF). PCASL is typically thought to have better signal-to-noise ratio and higher test-retest reliability than other ASL methods (e.g., pulsed ASL; continuous ASL). Values in this sheet represent CBF in raw units of mL/100g tissues/min
References :
Dai, W., Garcia, D., De Bazelaire, C., & Alsop, D. C. (2008). Continuous flow‐driven inversion for arterial spin labeling using pulsed radio frequency and gradient fields. Magnetic Resonance in Medicine: An Official Journal of the International Society for Magnetic Resonance in Medicine, 60(6), 1488-1497.
Dolui, S., Vidorreta, M., Wang, Z., Nasrallah, I. M., Alavi, A., Wolk, D. A., & Detre, J. A. (2017). Comparison of PASL, PCASL, and background‐suppressed 3D PCASL in mild cognitive impairment. Human brain mapping, 38(10), 5260-5273.
ad_meta_six_composite
Description :
ad meta six composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_pcasl | numeric | 0 | 34.446175 |
ad_meta_ten_composite
Description :
ad meta ten composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_pcasl | numeric | 0 | 37.677820 |
brain_stem
Description :
brainstem CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_pcasl | numeric | 0 | -1.4589800 |
cbf
Description :
whole brain CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cbf.imaging_pcasl | numeric | 0 | 54.31068 |
cc_anterior
Description :
anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_pcasl | numeric | 0 | -0.291158 |
cc_central
Description :
central corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_pcasl | numeric | 0 | 26.160800000 |
cc_mid_anterior
Description :
mid anterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_pcasl | numeric | 0 | -1.46639000 |
cc_mid_posterior
Description :
mid posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_pcasl | numeric | 0 | 16.3073000 |
cc_posterior
Description :
posterior corpus callosum CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_pcasl | numeric | 0 | -1.00238000 |
csf
Description :
csf CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_pcasl | numeric | 0 | 28.7916000 |
ctx_lh_bankssts
Description :
left banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_pcasl | numeric | 0 | 45.5427 |
ctx_lh_caudalanteriorcingulate
Description :
left caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_pcasl | numeric | 0 | 50.24070 |
ctx_lh_caudalmiddlefrontal
Description :
left caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_pcasl | numeric | 0 | 50.77770 |
ctx_lh_cuneus
Description :
left cuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_pcasl | numeric | 0 | 55.54520 |
ctx_lh_entorhinal
Description :
left entorhinal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_pcasl | numeric | 0 | -15.706400 |
ctx_lh_frontalpole
Description :
left frontalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_pcasl | numeric | 0 | 59.784000 |
ctx_lh_fusiform
Description :
left fusiform CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_pcasl | numeric | 0 | 37.176900 |
ctx_lh_inferiorparietal
Description :
left inferiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_pcasl | numeric | 0 | 51.12080 |
ctx_lh_inferiortemporal
Description :
left inferiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_pcasl | numeric | 0 | 43.02690 |
ctx_lh_insula
Description :
left insula CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_pcasl | numeric | 0 | 40.0207 |
ctx_lh_isthmuscingulate
Description :
left isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_pcasl | numeric | 0 | 49.29320 |
ctx_lh_lateraloccipital
Description :
left lateraloccipital CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_pcasl | numeric | 0 | 53.92090 |
ctx_lh_lateralorbitofrontal
Description :
left lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_pcasl | numeric | 0 | 46.69690 |
ctx_lh_lingual
Description :
left lingual CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_pcasl | numeric | 0 | 48.440400 |
ctx_lh_medialorbitofrontal
Description :
left medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_pcasl | numeric | 0 | 47.56020 |
ctx_lh_middletemporal
Description :
left middletemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_pcasl | numeric | 0 | 42.8341 |
ctx_lh_paracentral
Description :
left paracentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_pcasl | numeric | 0 | 43.13260 |
ctx_lh_parahippocampal
Description :
left parahippocampal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_pcasl | numeric | 0 | -10.716500 |
ctx_lh_parsopercularis
Description :
left parsopercularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_pcasl | numeric | 0 | 46.8145 |
ctx_lh_parsorbitalis
Description :
left parsorbitalis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_pcasl | numeric | 0 | 49.8189 |
ctx_lh_parstriangularis
Description :
left parstriangularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_pcasl | numeric | 0 | 44.2379 |
ctx_lh_pericalcarine
Description :
left pericalcarine CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_pcasl | numeric | 0 | 51.86560 |
ctx_lh_postcentral
Description :
left postcentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_pcasl | numeric | 0 | 41.01860 |
ctx_lh_posteriorcingulate
Description :
left posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_pcasl | numeric | 0 | 53.41060 |
ctx_lh_precentral
Description :
left precentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_pcasl | numeric | 0 | 44.60060 |
ctx_lh_precuneus
Description :
left precuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_pcasl | numeric | 0 | 52.83330 |
ctx_lh_rostralanteriorcingulate
Description :
left rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_pcasl | numeric | 0 | 47.2348 |
ctx_lh_rostralmiddlefrontal
Description :
left rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_pcasl | numeric | 0 | 52.43950 |
ctx_lh_superiorfrontal
Description :
left superiorfrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_pcasl | numeric | 0 | 48.60700 |
ctx_lh_superiorparietal
Description :
left superiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_pcasl | numeric | 0 | 46.262500 |
ctx_lh_superiortemporal
Description :
left superiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_pcasl | numeric | 0 | 41.6325 |
ctx_lh_supramarginal
Description :
left supramarginal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_pcasl | numeric | 0 | 43.4903 |
ctx_lh_temporalpole
Description :
left temporalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_pcasl | numeric | 0 | 33.212700 |
ctx_lh_transversetemporal
Description :
left transversetemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_pcasl | numeric | 0 | 56.4887 |
ctx_lh_unknown
Description :
left unknown CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_pcasl | numeric | 0 | 24.15610 |
ctx_rh_bankssts
Description :
right banks of the superior temporal sulcus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_pcasl | numeric | 0 | 47.9254 |
ctx_rh_caudalanteriorcingulate
Description :
right caudalanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_pcasl | numeric | 0 | 58.84400 |
ctx_rh_caudalmiddlefrontal
Description :
right caudalmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_pcasl | numeric | 0 | 52.74430 |
ctx_rh_cuneus
Description :
right cuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_pcasl | numeric | 0 | 56.27520 |
ctx_rh_entorhinal
Description :
right entorhinal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_pcasl | numeric | 0 | 36.82920000 |
ctx_rh_frontalpole
Description :
right frontalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_pcasl | numeric | 0 | 74.75130 |
ctx_rh_fusiform
Description :
right fusiform CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_pcasl | numeric | 0 | 33.80820 |
ctx_rh_inferiorparietal
Description :
right inferiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_pcasl | numeric | 0 | 58.18610 |
ctx_rh_inferiortemporal
Description :
right inferiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_pcasl | numeric | 0 | 45.07720 |
ctx_rh_insula
Description :
right insula CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_pcasl | numeric | 0 | 40.02420 |
ctx_rh_isthmuscingulate
Description :
right isthmuscingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_pcasl | numeric | 0 | 55.42110 |
ctx_rh_lateraloccipital
Description :
right lateraloccipital CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_pcasl | numeric | 0 | 50.08340 |
ctx_rh_lateralorbitofrontal
Description :
right lateralorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_pcasl | numeric | 0 | 49.3001 |
ctx_rh_lingual
Description :
right lingual CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_pcasl | numeric | 0 | 47.56860 |
ctx_rh_medialorbitofrontal
Description :
right medialorbitofrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_pcasl | numeric | 0 | 52.58100 |
ctx_rh_middletemporal
Description :
right middletemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_pcasl | numeric | 0 | 47.0305 |
ctx_rh_paracentral
Description :
right paracentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_pcasl | numeric | 0 | 43.71320 |
ctx_rh_parahippocampal
Description :
right parahippocampal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_pcasl | numeric | 0 | 32.96340 |
ctx_rh_parsopercularis
Description :
right parsopercularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_pcasl | numeric | 0 | 55.7225 |
ctx_rh_parsorbitalis
Description :
right parsorbitalis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_pcasl | numeric | 0 | 50.00450 |
ctx_rh_parstriangularis
Description :
right parstriangularis CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_pcasl | numeric | 0 | 47.3771 |
ctx_rh_pericalcarine
Description :
right pericalcarine CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_pcasl | numeric | 0 | 54.44980 |
ctx_rh_postcentral
Description :
right postcentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_pcasl | numeric | 0 | 46.15340 |
ctx_rh_posteriorcingulate
Description :
right posteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_pcasl | numeric | 0 | 61.4821 |
ctx_rh_precentral
Description :
right precentral CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_pcasl | numeric | 0 | 46.16800 |
ctx_rh_precuneus
Description :
right precuneus CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_pcasl | numeric | 0 | 49.34570 |
ctx_rh_rostralanteriorcingulate
Description :
right rostralanteriorcingulate CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_pcasl | numeric | 0 | 49.9981 |
ctx_rh_rostralmiddlefrontal
Description :
right rostralmiddlefrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_pcasl | numeric | 0 | 52.68880 |
ctx_rh_superiorfrontal
Description :
right superiorfrontal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_pcasl | numeric | 0 | 49.12480 |
ctx_rh_superiorparietal
Description :
right superiorparietal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_pcasl | numeric | 0 | 51.740000 |
ctx_rh_superiortemporal
Description :
right superiortemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_pcasl | numeric | 0 | 42.13770 |
ctx_rh_supramarginal
Description :
right supramarginal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_pcasl | numeric | 0 | 47.7366 |
ctx_rh_temporalpole
Description :
right temporalpole CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_pcasl | numeric | 0 | 36.77440 |
ctx_rh_transversetemporal
Description :
right transversetemporal CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_pcasl | numeric | 0 | 58.8117 |
ctx_rh_unknown
Description :
right unknown CBF in ml/100g/min (Freesurfer ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_pcasl | numeric | 0 | 35.05890 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_pcasl | numeric | 0 | infinity |
frontal_composite
Description :
frontal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_pcasl | numeric | 0 | 48.12895 |
gm
Description :
global grey matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_pcasl | numeric | 0 | infinity |
label
Description :
Calculation of CBF in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_pcasl | Mean | character |
left_accumbens_area
Description :
left accumbens area CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_pcasl | numeric | 0 | -10.63870 |
left_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_pcasl | numeric | 4.438522 | 32.782767 |
left_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_pcasl | numeric | 6.655443 | 36.260220 |
left_amygdala
Description :
left amygdala CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_pcasl | numeric | 0 | 38.310800 |
left_caudate
Description :
left caudate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_pcasl | numeric | 0 | 34.609600 |
left_cerebellum_cortex
Description :
left cerebellum cortex CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_pcasl | numeric | 0 | -18.807900 |
left_cerebellum_white_matter
Description :
left cerebellum white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_pcasl | numeric | 0 | 10.9110000 |
left_choroid_plexus
Description :
left choroid plexus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_pcasl | numeric | 0 | 17.153000 |
left_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_pcasl | numeric | 9.927425 | 46.137600 |
left_hippocampus
Description :
left hippocampus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_pcasl | numeric | 0 | 39.15720 |
left_inf_lat_vent
Description :
left inf lat vent CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_pcasl | numeric | 0 | 26.786200 |
left_lateral_ventricle
Description :
left lateral ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_pcasl | numeric | 0 | -1.269170 |
left_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_pcasl | numeric | 4.636722 | 32.794533 |
left_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_pcasl | numeric | 5.035354 | 52.166550 |
left_pallidum
Description :
left pallidum CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_pcasl | numeric | 0 | 10.300600 |
left_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_pcasl | numeric | 7.911658 | 45.570740 |
left_putamen
Description :
left putamen CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_pcasl | numeric | 0 | 37.9508 |
left_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_pcasl | numeric | 7.210142 | 35.655582 |
left_thalamus_proper
Description :
left thalamus proper CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_pcasl | numeric | 0 | 23.405500 |
left_unsegmented_white_matter
Description :
left unsegmented white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_pcasl | numeric | 0 | 0.976057 |
left_ventral_dc
Description :
left ventral dc CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_pcasl | numeric | 0 | 16.547900 |
left_vessel
Description :
left vessel CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_pcasl | numeric | 0 | 48.56790 |
medial_temporal_composite
Description :
medial temporal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_pcasl | numeric | 0 | 32.403400 |
occipital_composite
Description :
occipital composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_pcasl | numeric | 0 | 52.166550 |
optic_chiasm
Description :
optic chiasm CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_pcasl | numeric | 0 | 18.222700 |
parietal_composite
Description :
parietal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_pcasl | numeric | 0 | 47.658110 |
right_accumbens_area
Description :
right accumbens area CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_pcasl | numeric | 0 | 58.996200 |
right_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_pcasl | numeric | 6.218467 | 36.640817 |
right_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_pcasl | numeric | 6.887535 | 39.095420 |
right_amygdala
Description :
right amygdala CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_pcasl | numeric | 0 | 44.55870 |
right_caudate
Description :
right caudate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_pcasl | numeric | 0 | 38.284900 |
right_cerebellum_cortex
Description :
right cerebellum cortex CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_pcasl | numeric | 0 | 40.990800 |
right_cerebellum_white_matter
Description :
right cerebellum white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_pcasl | numeric | 0 | -1.80809000 |
right_choroid_plexus
Description :
right choroid plexus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_pcasl | numeric | 0 | 19.496800 |
right_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_pcasl | numeric | 11.75054 | 50.12029 |
right_hippocampus
Description :
right hippocampus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_pcasl | numeric | 0 | 45.89640 |
right_inf_lat_vent
Description :
right inf lat vent CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_pcasl | numeric | 0 | 27.167700 |
right_lateral_ventricle
Description :
right lateral ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_pcasl | numeric | 0 | -0.198145 |
right_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_pcasl | numeric | 3.896760 | 33.942733 |
right_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_pcasl | numeric | 3.522730 | 52.020400 |
right_pallidum
Description :
right pallidum CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_pcasl | numeric | 0 | -0.0905455 |
right_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_pcasl | numeric | 8.292881 | 49.204900 |
right_putamen
Description :
right putamen CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_pcasl | numeric | 0 | 35.08960 |
right_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_pcasl | numeric | 8.618654 | 38.444691 |
right_thalamus_proper
Description :
right thalamus proper CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_pcasl | numeric | 0 | 34.944900 |
right_unsegmented_white_matter
Description :
right unsegmented white matter CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_pcasl | numeric | 0 | 1.228620 |
right_ventral_dc
Description :
right ventral dc CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_pcasl | numeric | 0 | 20.313600 |
right_vessel
Description :
right vessel CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_pcasl | numeric | 0 | -10.61880 |
temporal_composite
Description :
temporal composite CBF in ml/100g/min
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_pcasl | numeric | 0 | 37.050136 |
tiv
Description :
global total intracranial volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_pcasl | numeric | 0 | 2075711 |
wm_hypointensities
Description :
white matter hypointensities CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_pcasl | numeric | 0 | 39.57300 |
wm_lh_bankssts
Description :
white matter left bankssts CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_pcasl | numeric | 0 | 10.71620 |
wm_lh_caudalanteriorcingulate
Description :
white matter left caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_pcasl | numeric | 0 | 6.347070 |
wm_lh_caudalmiddlefrontal
Description :
white matter left caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_pcasl | numeric | 0 | 20.83140 |
wm_lh_cuneus
Description :
white matter left cuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_pcasl | numeric | 0 | 30.12670 |
wm_lh_entorhinal
Description :
white matter left entorhinal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_pcasl | numeric | 0 | 15.934100 |
wm_lh_frontalpole
Description :
white matter left frontalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_pcasl | numeric | 0 | 38.151600 |
wm_lh_fusiform
Description :
white matter left fusiform CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_pcasl | numeric | 0 | 14.752100 |
wm_lh_inferiorparietal
Description :
white matter left inferiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_pcasl | numeric | 0 | 22.48270 |
wm_lh_inferiortemporal
Description :
white matter left inferiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_pcasl | numeric | 0 | 21.81510 |
wm_lh_insula
Description :
white matter left insula CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_pcasl | numeric | 0 | 15.73410 |
wm_lh_isthmuscingulate
Description :
white matter left isthmuscingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_pcasl | numeric | 0 | -0.0930159 |
wm_lh_lateraloccipital
Description :
white matter left lateraloccipital CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_pcasl | numeric | 0 | 26.091400 |
wm_lh_lateralorbitofrontal
Description :
white matter left lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_pcasl | numeric | 0 | 14.633500 |
wm_lh_lingual
Description :
white matter left lingual CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_pcasl | numeric | 0 | 21.51930 |
wm_lh_medialorbitofrontal
Description :
white matter left medialorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_pcasl | numeric | 0 | 13.53620 |
wm_lh_middletemporal
Description :
white matter left middletemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_pcasl | numeric | 0 | 23.55950 |
wm_lh_paracentral
Description :
white matter left paracentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_pcasl | numeric | 0 | -0.078523 |
wm_lh_parahippocampal
Description :
white matter left parahippocampal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_pcasl | numeric | 0 | 16.5060000 |
wm_lh_parsopercularis
Description :
white matter left parsopercularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_pcasl | numeric | 0 | 13.75780 |
wm_lh_parsorbitalis
Description :
white matter left parsorbitalis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_pcasl | numeric | 0 | 32.02480 |
wm_lh_parstriangularis
Description :
white matter left parstriangularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_pcasl | numeric | 0 | 18.67790 |
wm_lh_pericalcarine
Description :
white matter left pericalcarine CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_pcasl | numeric | 0 | 21.999200 |
wm_lh_postcentral
Description :
white matter left postcentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_pcasl | numeric | 0 | 24.49010 |
wm_lh_posteriorcingulate
Description :
white matter left posteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_pcasl | numeric | 0 | 10.79740 |
wm_lh_precentral
Description :
white matter left precentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_pcasl | numeric | 0 | 14.90210 |
wm_lh_precuneus
Description :
white matter left precuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_pcasl | numeric | 0 | 14.38330 |
wm_lh_rostralanteriorcingulate
Description :
white matter left rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_pcasl | numeric | 0 | 6.49873 |
wm_lh_rostralmiddlefrontal
Description :
white matter left rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_pcasl | numeric | 0 | 25.47280 |
wm_lh_superiorfrontal
Description :
white matter left superiorfrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_pcasl | numeric | 0 | 10.47840 |
wm_lh_superiorparietal
Description :
white matter left superiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_pcasl | numeric | 0 | 18.720000 |
wm_lh_superiortemporal
Description :
white matter left superiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_pcasl | numeric | 0 | 14.77530 |
wm_lh_supramarginal
Description :
white matter left supramarginal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_pcasl | numeric | 0 | 20.61580 |
wm_lh_temporalpole
Description :
white matter left temporalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_pcasl | numeric | 0 | 18.186500 |
wm_lh_transversetemporal
Description :
white matter left transversetemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_pcasl | numeric | 0 | 19.17270 |
wm_rh_bankssts
Description :
white matter right bankssts CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_pcasl | numeric | 0 | 8.78415 |
wm_rh_caudalanteriorcingulate
Description :
white matter right caudalanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_pcasl | numeric | 0 | 12.17120 |
wm_rh_caudalmiddlefrontal
Description :
white matter right caudalmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_pcasl | numeric | 0 | 20.23110 |
wm_rh_cuneus
Description :
white matter right cuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_pcasl | numeric | 0 | 30.9932000 |
wm_rh_entorhinal
Description :
white matter right entorhinal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_pcasl | numeric | 0 | 14.6136000 |
wm_rh_frontalpole
Description :
white matter right frontalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_pcasl | numeric | 0 | 41.71660 |
wm_rh_fusiform
Description :
white matter right fusiform CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_pcasl | numeric | 0 | 12.6659000 |
wm_rh_inferiorparietal
Description :
white matter right inferiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_pcasl | numeric | 0 | 25.08210 |
wm_rh_inferiortemporal
Description :
white matter right inferiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_pcasl | numeric | 0 | 18.30250 |
wm_rh_insula
Description :
white matter right insula CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_pcasl | numeric | 0 | 11.37480 |
wm_rh_isthmuscingulate
Description :
white matter right isthmuscingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_pcasl | numeric | 0 | 10.288100 |
wm_rh_lateraloccipital
Description :
white matter right lateraloccipital CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_pcasl | numeric | 0 | 28.29520 |
wm_rh_lateralorbitofrontal
Description :
white matter right lateralorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_pcasl | numeric | 0 | 17.68690 |
wm_rh_lingual
Description :
white matter right lingual CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_pcasl | numeric | 0 | 24.46320 |
wm_rh_medialorbitofrontal
Description :
white matter right medialorbitofrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_pcasl | numeric | 0 | 16.20200 |
wm_rh_middletemporal
Description :
white matter right middletemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_pcasl | numeric | 0 | 15.28800 |
wm_rh_paracentral
Description :
white matter right paracentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_pcasl | numeric | 0 | 6.137420 |
wm_rh_parahippocampal
Description :
white matter right parahippocampal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_pcasl | numeric | 0 | 14.485600 |
wm_rh_parsopercularis
Description :
white matter right parsopercularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_pcasl | numeric | 0 | 11.75570 |
wm_rh_parsorbitalis
Description :
white matter right parsorbitalis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_pcasl | numeric | 0 | 38.565100 |
wm_rh_parstriangularis
Description :
white matter right parstriangularis CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_pcasl | numeric | 0 | 16.30950 |
wm_rh_pericalcarine
Description :
white matter right pericalcarine CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_pcasl | numeric | 0 | 26.54310 |
wm_rh_postcentral
Description :
white matter right postcentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_pcasl | numeric | 0 | 19.30660 |
wm_rh_posteriorcingulate
Description :
white matter right posteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_pcasl | numeric | 0 | 18.44670 |
wm_rh_precentral
Description :
white matter right precentral CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_pcasl | numeric | 0 | 12.02330 |
wm_rh_precuneus
Description :
white matter right precuneus CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_pcasl | numeric | 0 | 12.77760 |
wm_rh_rostralanteriorcingulate
Description :
white matter right rostralanteriorcingulate CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_pcasl | numeric | 0 | 14.06790 |
wm_rh_rostralmiddlefrontal
Description :
white matter right rostralmiddlefrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_pcasl | numeric | 0 | 20.89920 |
wm_rh_superiorfrontal
Description :
white matter right superiorfrontal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_pcasl | numeric | 0 | 10.81920 |
wm_rh_superiorparietal
Description :
white matter right superiorparietal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_pcasl | numeric | 0 | 16.838300 |
wm_rh_superiortemporal
Description :
white matter right superiortemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_pcasl | numeric | 0 | 12.40050 |
wm_rh_supramarginal
Description :
white matter right supramarginal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_pcasl | numeric | 0 | 15.46090 |
wm_rh_temporalpole
Description :
white matter right temporalpole CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_pcasl | numeric | 0 | 12.1033000 |
wm_rh_transversetemporal
Description :
white matter right transversetemporal CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_pcasl | numeric | 0 | 11.481200 |
wm
Description :
global white matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_pcasl | numeric | 0 | 627774.2 |
x3rd_ventricle
Description :
3rd ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_pcasl | numeric | 0 | 39.8600000 |
x4th_ventricle
Description :
4th ventricle CBF in ml/100g/min (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_pcasl | numeric | 0 | -16.75690000 |
imaging_t1
Description :
Structural MRI is a technique that looks at the anatomical information of the gray and white matter structures of the brain. Brain volume is a widely used analysis that takes structural MRI to investigate volumetric changes in brain regions as it has been shown that aging, brain injury, and diseases like dementia can cause reductions in specific parts of the brain.
ad_meta_six_composite
Description :
ad meta six composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_six_composite.imaging_t1 | numeric | 23643.50 | 52917.30 |
ad_meta_ten_composite
Description :
ad meta ten composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ad_meta_ten_composite.imaging_t1 | numeric | 45128.22 | 100966.39 |
brain_stem
Description :
brain stem volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| brain_stem.imaging_t1 | numeric | 1435.455 | 4168.125 |
cc_anterior
Description :
anterior corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_anterior.imaging_t1 | numeric | 70.43119 | 191.56466 |
cc_central
Description :
central corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_central.imaging_t1 | numeric | 10.24154 | 112.58629 |
cc_mid_anterior
Description :
mid anterior corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_anterior.imaging_t1 | numeric | 6.072097 | 109.048275 |
cc_mid_posterior
Description :
mid posterior corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_mid_posterior.imaging_t1 | numeric | 20.94356 | 113.01053 |
cc_posterior
Description :
posterior corpus callosum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cc_posterior.imaging_t1 | numeric | 36.35516 | 171.35888 |
csf_22
Description :
global csf volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf_22.imaging_t1 | numeric | 275.3865 | 770.6576 |
csf_7
Description :
csf volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf_7.imaging_t1 | numeric | 165129.9 | 1105035.9 |
ctx_lh_bankssts
Description :
left bankssts volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_bankssts.imaging_t1 | numeric | 594.4286 | 1742.6408 |
ctx_lh_caudalanteriorcingulate
Description :
left caudalanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalanteriorcingulate.imaging_t1 | numeric | 284.4980 | 918.3881 |
ctx_lh_caudalmiddlefrontal
Description :
left caudalmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_caudalmiddlefrontal.imaging_t1 | numeric | 1519.796 | 4929.154 |
ctx_lh_cuneus
Description :
left cuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_cuneus.imaging_t1 | numeric | 627.3146 | 2009.4109 |
ctx_lh_entorhinal
Description :
left entorhinal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_entorhinal.imaging_t1 | numeric | 838.2724 | 2095.4464 |
ctx_lh_frontalpole
Description :
left frontalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_frontalpole.imaging_t1 | numeric | 144.1125 | 685.5874 |
ctx_lh_fusiform
Description :
left fusiform volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_fusiform.imaging_t1 | numeric | 4092.457 | 8702.539 |
ctx_lh_inferiorparietal
Description :
left inferiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiorparietal.imaging_t1 | numeric | 3196.095 | 9184.522 |
ctx_lh_inferiortemporal
Description :
left inferiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_inferiortemporal.imaging_t1 | numeric | 3487.354 | 8623.834 |
ctx_lh_insula
Description :
left insula volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_insula.imaging_t1 | numeric | 2487.091 | 5651.842 |
ctx_lh_isthmuscingulate
Description :
left isthmuscingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_isthmuscingulate.imaging_t1 | numeric | 617.5744 | 1682.0325 |
ctx_lh_lateraloccipital
Description :
left lateraloccipital volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateraloccipital.imaging_t1 | numeric | 2235.151 | 7438.230 |
ctx_lh_lateralorbitofrontal
Description :
left lateralorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lateralorbitofrontal.imaging_t1 | numeric | 1903.824 | 4918.792 |
ctx_lh_lingual
Description :
left lingual volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_lingual.imaging_t1 | numeric | 1908.043 | 4460.839 |
ctx_lh_medialorbitofrontal
Description :
left medialorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_medialorbitofrontal.imaging_t1 | numeric | 1472.236 | 3737.812 |
ctx_lh_middletemporal
Description :
left middletemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_middletemporal.imaging_t1 | numeric | 3537.506 | 9519.761 |
ctx_lh_paracentral
Description :
left paracentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_paracentral.imaging_t1 | numeric | 696.2287 | 2001.9623 |
ctx_lh_parahippocampal
Description :
left parahippocampal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parahippocampal.imaging_t1 | numeric | 743.6812 | 1483.2450 |
ctx_lh_parsopercularis
Description :
left parsopercularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsopercularis.imaging_t1 | numeric | 1011.896 | 3189.520 |
ctx_lh_parsorbitalis
Description :
left parsorbitalis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parsorbitalis.imaging_t1 | numeric | 460.9136 | 1676.5076 |
ctx_lh_parstriangularis
Description :
left parstriangularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_parstriangularis.imaging_t1 | numeric | 710.7986 | 2371.9061 |
ctx_lh_pericalcarine
Description :
left pericalcarine volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_pericalcarine.imaging_t1 | numeric | 410.4675 | 1279.3309 |
ctx_lh_postcentral
Description :
left postcentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_postcentral.imaging_t1 | numeric | 1513.438 | 4570.155 |
ctx_lh_posteriorcingulate
Description :
left posteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_posteriorcingulate.imaging_t1 | numeric | 568.3129 | 2037.2580 |
ctx_lh_precentral
Description :
left precentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precentral.imaging_t1 | numeric | 2170.412 | 6667.717 |
ctx_lh_precuneus
Description :
left precuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_precuneus.imaging_t1 | numeric | 2346.610 | 6700.219 |
ctx_lh_rostralanteriorcingulate
Description :
left rostralanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralanteriorcingulate.imaging_t1 | numeric | 717.2516 | 2175.8828 |
ctx_lh_rostralmiddlefrontal
Description :
left rostralmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_rostralmiddlefrontal.imaging_t1 | numeric | 3317.034 | 11865.353 |
ctx_lh_superiorfrontal
Description :
left superiorfrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorfrontal.imaging_t1 | numeric | 4917.746 | 15391.552 |
ctx_lh_superiorparietal
Description :
left superiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiorparietal.imaging_t1 | numeric | 2767.358 | 7128.844 |
ctx_lh_superiortemporal
Description :
left superiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_superiortemporal.imaging_t1 | numeric | 3645.844 | 9481.894 |
ctx_lh_supramarginal
Description :
left supramarginal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_supramarginal.imaging_t1 | numeric | 2638.238 | 6600.589 |
ctx_lh_temporalpole
Description :
left temporalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_temporalpole.imaging_t1 | numeric | 306.2178 | 2068.6793 |
ctx_lh_transversetemporal
Description :
left transversetemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_transversetemporal.imaging_t1 | numeric | 233.3701 | 924.2100 |
ctx_lh_unknown
Description :
left unknown volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_lh_unknown.imaging_t1 | numeric | 248.2329 | 535.3830 |
ctx_rh_bankssts
Description :
right bankssts volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_bankssts.imaging_t1 | numeric | 710.8391 | 2137.6946 |
ctx_rh_caudalanteriorcingulate
Description :
right caudalanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalanteriorcingulate.imaging_t1 | numeric | 350.7097 | 1366.1662 |
ctx_rh_caudalmiddlefrontal
Description :
right caudalmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_caudalmiddlefrontal.imaging_t1 | numeric | 1164.031 | 4002.818 |
ctx_rh_cuneus
Description :
right cuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_cuneus.imaging_t1 | numeric | 749.2264 | 2221.2022 |
ctx_rh_entorhinal
Description :
right entorhinal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_entorhinal.imaging_t1 | numeric | 568.1509 | 1783.7044 |
ctx_rh_frontalpole
Description :
right frontalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_frontalpole.imaging_t1 | numeric | 149.5159 | 687.1365 |
ctx_rh_fusiform
Description :
right fusiform volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_fusiform.imaging_t1 | numeric | 3558.532 | 7846.335 |
ctx_rh_inferiorparietal
Description :
right inferiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiorparietal.imaging_t1 | numeric | 3033.302 | 9556.245 |
ctx_rh_inferiortemporal
Description :
right inferiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_inferiortemporal.imaging_t1 | numeric | 3523.635 | 8988.266 |
ctx_rh_insula
Description :
right insula volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_insula.imaging_t1 | numeric | 2577.454 | 5944.961 |
ctx_rh_isthmuscingulate
Description :
right isthmuscingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_isthmuscingulate.imaging_t1 | numeric | 625.2727 | 1571.3359 |
ctx_rh_lateraloccipital
Description :
right lateraloccipital volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateraloccipital.imaging_t1 | numeric | 2584.136 | 7552.204 |
ctx_rh_lateralorbitofrontal
Description :
right lateralorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lateralorbitofrontal.imaging_t1 | numeric | 1967.881 | 4714.267 |
ctx_rh_lingual
Description :
right lingual volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_lingual.imaging_t1 | numeric | 2115.612 | 4430.464 |
ctx_rh_medialorbitofrontal
Description :
right medialorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_medialorbitofrontal.imaging_t1 | numeric | 1108.681 | 3150.498 |
ctx_rh_middletemporal
Description :
right middletemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_middletemporal.imaging_t1 | numeric | 3222.102 | 9522.866 |
ctx_rh_paracentral
Description :
right paracentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_paracentral.imaging_t1 | numeric | 751.5315 | 2381.7173 |
ctx_rh_parahippocampal
Description :
right parahippocampal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parahippocampal.imaging_t1 | numeric | 593.0381 | 1202.7386 |
ctx_rh_parsopercularis
Description :
right parsopercularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsopercularis.imaging_t1 | numeric | 942.3135 | 3086.8594 |
ctx_rh_parsorbitalis
Description :
right parsorbitalis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parsorbitalis.imaging_t1 | numeric | 417.7474 | 1613.9385 |
ctx_rh_parstriangularis
Description :
right parstriangularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_parstriangularis.imaging_t1 | numeric | 1088.620 | 3354.791 |
ctx_rh_pericalcarine
Description :
right pericalcarine volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_pericalcarine.imaging_t1 | numeric | 594.7223 | 1848.8486 |
ctx_rh_postcentral
Description :
right postcentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_postcentral.imaging_t1 | numeric | 1411.104 | 4239.000 |
ctx_rh_posteriorcingulate
Description :
right posteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_posteriorcingulate.imaging_t1 | numeric | 482.4664 | 2233.9665 |
ctx_rh_precentral
Description :
right precentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precentral.imaging_t1 | numeric | 2281.203 | 7464.690 |
ctx_rh_precuneus
Description :
right precuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_precuneus.imaging_t1 | numeric | 2451.826 | 7862.704 |
ctx_rh_rostralanteriorcingulate
Description :
right rostralanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralanteriorcingulate.imaging_t1 | numeric | 476.7862 | 1503.7954 |
ctx_rh_rostralmiddlefrontal
Description :
right rostralmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_rostralmiddlefrontal.imaging_t1 | numeric | 3242.460 | 13084.605 |
ctx_rh_superiorfrontal
Description :
right superiorfrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorfrontal.imaging_t1 | numeric | 4881.971 | 15666.649 |
ctx_rh_superiorparietal
Description :
right superiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiorparietal.imaging_t1 | numeric | 2491.287 | 7332.795 |
ctx_rh_superiortemporal
Description :
right superiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_superiortemporal.imaging_t1 | numeric | 3465.045 | 8986.815 |
ctx_rh_supramarginal
Description :
right supramarginal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_supramarginal.imaging_t1 | numeric | 2449.322 | 6528.600 |
ctx_rh_temporalpole
Description :
right temporalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_temporalpole.imaging_t1 | numeric | 447.7714 | 1551.2006 |
ctx_rh_transversetemporal
Description :
right transversetemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_transversetemporal.imaging_t1 | numeric | 195.1165 | 640.1835 |
ctx_rh_unknown
Description :
right unknown volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ctx_rh_unknown.imaging_t1 | numeric | 390.8891 | 898.6174 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| delta_t.imaging_t1 | numeric | 0 | Infinity |
frontal_composite
Description :
frontal composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| frontal_composite.imaging_t1 | numeric | 32984.59 | 99604.15 |
gm
Description :
global grey matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_t1 | numeric | 392434.3 | 856851.3 |
label
Description :
Calculation of volume in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_t1 | Sum | character |
left_accumbens_area
Description :
left accumbens area volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_accumbens_area.imaging_t1 | numeric | 171.4932 | 455.2841 |
left_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_six_composite.imaging_t1 | numeric | 11703.66 | 26784.82 |
left_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ad_meta_ten_composite.imaging_t1 | numeric | 22959.13 | 50889.86 |
left_amygdala
Description :
left amygdala volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_amygdala.imaging_t1 | numeric | 674.8920 | 1528.8986 |
left_caudate
Description :
left caudate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_caudate.imaging_t1 | numeric | 681.5374 | 2800.1295 |
left_cerebellum_cortex
Description :
left cerebellum cortex volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_cortex.imaging_t1 | numeric | 21294.26 | 46504.46 |
left_cerebellum_white_matter
Description :
left cerebellum white matter volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_cerebellum_white_matter.imaging_t1 | numeric | 2452.852 | 5457.847 |
left_choroid_plexus
Description :
left choroid plexus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_choroid_plexus.imaging_t1 | numeric | 370.9564 | 1008.8381 |
left_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_frontal_composite.imaging_t1 | numeric | 16820.46 | 50012.90 |
left_hippocampus
Description :
left hippocampus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_hippocampus.imaging_t1 | numeric | 1619.501 | 3971.869 |
left_inf_lat_vent
Description :
left inf lat vent volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_inf_lat_vent.imaging_t1 | numeric | 76.63140 | 196.22081 |
left_lateral_ventricle
Description :
left lateral ventricle volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_lateral_ventricle.imaging_t1 | numeric | 730.7516 | 2672.3250 |
left_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_medial_temporal_composite.imaging_t1 | numeric | 3246.308 | 7462.753 |
left_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_occipital_composite.imaging_t1 | numeric | 12139.49 | 30404.09 |
left_pallidum
Description :
left pallidum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_pallidum.imaging_t1 | numeric | 251.9812 | 648.1620 |
left_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_parietal_composite.imaging_t1 | numeric | 13044.83 | 32757.48 |
left_putamen
Description :
left putamen volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_putamen.imaging_t1 | numeric | 1733.197 | 4520.745 |
left_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_temporal_composite.imaging_t1 | numeric | 22068.10 | 48869.71 |
left_thalamus_proper
Description :
left thalamus proper volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_thalamus_proper.imaging_t1 | numeric | 938.2703 | 3209.0479 |
left_unsegmented_white_matter
Description :
left unsegmented white matter volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_unsegmented_white_matter.imaging_t1 | numeric | 1872.032 | 4423.477 |
left_ventral_dc
Description :
left ventral dc volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_ventral_dc.imaging_t1 | numeric | 555.1470 | 1299.3446 |
left_vessel
Description :
left vessel volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| left_vessel.imaging_t1 | numeric | 21.20438 | 43.95735 |
medial_temporal_composite
Description :
medial temporal composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| medial_temporal_composite.imaging_t1 | numeric | 6203.739 | 13669.806 |
occipital_composite
Description :
occipital composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| occipital_composite.imaging_t1 | numeric | 12139.49 | 30404.09 |
optic_chiasm
Description :
optic chiasm volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| optic_chiasm.imaging_t1 | numeric | 52.17514 | 147.22931 |
parietal_composite
Description :
parietal composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| parietal_composite.imaging_t1 | numeric | 25199.84 | 66543.02 |
right_accumbens_area
Description :
right accumbens area volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_accumbens_area.imaging_t1 | numeric | 160.9261 | 351.3071 |
right_ad_meta_six_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_six_composite.imaging_t1 | numeric | 10813.95 | 26332.34 |
right_ad_meta_ten_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ad_meta_ten_composite.imaging_t1 | numeric | 22169.09 | 50360.08 |
right_amygdala
Description :
right amygdala volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_amygdala.imaging_t1 | numeric | 623.8148 | 1554.8456 |
right_caudate
Description :
right caudate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_caudate.imaging_t1 | numeric | 741.2141 | 3147.8220 |
right_cerebellum_cortex
Description :
right cerebellum cortex volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_cortex.imaging_t1 | numeric | 23486.73 | 51290.55 |
right_cerebellum_white_matter
Description :
right cerebellum white matter volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_cerebellum_white_matter.imaging_t1 | numeric | 2499.238 | 5578.267 |
right_choroid_plexus
Description :
right choroid plexus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_choroid_plexus.imaging_t1 | numeric | 473.5598 | 1186.7445 |
right_frontal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_frontal_composite.imaging_t1 | numeric | 16164.13 | 49591.25 |
right_hippocampus
Description :
right hippocampus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_hippocampus.imaging_t1 | numeric | 1473.147 | 3630.116 |
right_inf_lat_vent
Description :
right inf lat vent volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_inf_lat_vent.imaging_t1 | numeric | 68.66404 | 198.80032 |
right_lateral_ventricle
Description :
right lateral ventricle volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_lateral_ventricle.imaging_t1 | numeric | 687.0589 | 2542.0365 |
right_medial_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_medial_temporal_composite.imaging_t1 | numeric | 2737.324 | 6539.765 |
right_occipital_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_occipital_composite.imaging_t1 | numeric | 6091.271 | 15470.720 |
right_pallidum
Description :
right pallidum volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_pallidum.imaging_t1 | numeric | 178.3897 | 526.6485 |
right_parietal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_parietal_composite.imaging_t1 | numeric | 14849.48 | 39671.10 |
right_putamen
Description :
right putamen volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_putamen.imaging_t1 | numeric | 1310.205 | 4115.542 |
right_temporal_composite
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_temporal_composite.imaging_t1 | numeric | 19470.07 | 46584.54 |
right_thalamus_proper
Description :
right thalamus proper volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_thalamus_proper.imaging_t1 | numeric | 1113.429 | 3513.139 |
right_unsegmented_white_matter
Description :
right unsegmented white matter volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_unsegmented_white_matter.imaging_t1 | numeric | 2050.137 | 4765.095 |
right_ventral_dc
Description :
right ventral dc volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_ventral_dc.imaging_t1 | numeric | 508.9736 | 1175.4990 |
right_vessel
Description :
right vessel volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| right_vessel.imaging_t1 | numeric | 11.30149 | 24.77098 |
temporal_composite
Description :
temporal composite volume in mm3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| temporal_composite.imaging_t1 | numeric | 43460.43 | 95160.62 |
tiv
Description :
global total intracranial volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_t1 | numeric | 1111535 | 2100666 |
wm_hypointensities
Description :
white matter hypointensities volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_hypointensities.imaging_t1 | numeric | 22.00510 | 62.42434 |
wm_lh_bankssts
Description :
white matter left bankssts volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_bankssts.imaging_t1 | numeric | 514.3770 | 1489.5563 |
wm_lh_caudalanteriorcingulate
Description :
white matter left caudalanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalanteriorcingulate.imaging_t1 | numeric | 301.9029 | 932.9006 |
wm_lh_caudalmiddlefrontal
Description :
white matter left caudalmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_caudalmiddlefrontal.imaging_t1 | numeric | 1169.448 | 3039.140 |
wm_lh_cuneus
Description :
white matter left cuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_cuneus.imaging_t1 | numeric | 584.7323 | 1807.2450 |
wm_lh_entorhinal
Description :
white matter left entorhinal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_entorhinal.imaging_t1 | numeric | 321.0739 | 815.6160 |
wm_lh_frontalpole
Description :
white matter left frontalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_frontalpole.imaging_t1 | numeric | 45.66004 | 181.36001 |
wm_lh_fusiform
Description :
white matter left fusiform volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_fusiform.imaging_t1 | numeric | 1426.052 | 3252.221 |
wm_lh_inferiorparietal
Description :
white matter left inferiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiorparietal.imaging_t1 | numeric | 1880.196 | 5181.536 |
wm_lh_inferiortemporal
Description :
white matter left inferiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_inferiortemporal.imaging_t1 | numeric | 1445.421 | 3652.155 |
wm_lh_insula
Description :
white matter left insula volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_insula.imaging_t1 | numeric | 1781.180 | 3848.816 |
wm_lh_isthmuscingulate
Description :
white matter left isthmuscingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_isthmuscingulate.imaging_t1 | numeric | 523.0271 | 1203.9604 |
wm_lh_lateraloccipital
Description :
white matter left lateraloccipital volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateraloccipital.imaging_t1 | numeric | 1842.682 | 6814.733 |
wm_lh_lateralorbitofrontal
Description :
white matter left lateralorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lateralorbitofrontal.imaging_t1 | numeric | 1398.576 | 3383.505 |
wm_lh_lingual
Description :
white matter left lingual volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_lingual.imaging_t1 | numeric | 1471.831 | 3534.334 |
wm_lh_medialorbitofrontal
Description :
white matter left medialorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_medialorbitofrontal.imaging_t1 | numeric | 867.2839 | 2063.9880 |
wm_lh_middletemporal
Description :
white matter left middletemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_middletemporal.imaging_t1 | numeric | 1518.544 | 3865.894 |
wm_lh_paracentral
Description :
white matter left paracentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_paracentral.imaging_t1 | numeric | 566.8447 | 1589.8309 |
wm_lh_parahippocampal
Description :
white matter left parahippocampal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parahippocampal.imaging_t1 | numeric | 559.4839 | 1152.9405 |
wm_lh_parsopercularis
Description :
white matter left parsopercularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsopercularis.imaging_t1 | numeric | 661.2806 | 1822.1726 |
wm_lh_parsorbitalis
Description :
white matter left parsorbitalis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parsorbitalis.imaging_t1 | numeric | 179.3100 | 523.7257 |
wm_lh_parstriangularis
Description :
white matter left parstriangularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_parstriangularis.imaging_t1 | numeric | 549.5175 | 1375.2146 |
wm_lh_pericalcarine
Description :
white matter left pericalcarine volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_pericalcarine.imaging_t1 | numeric | 750.6405 | 2278.0744 |
wm_lh_postcentral
Description :
white matter left postcentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_postcentral.imaging_t1 | numeric | 1397.483 | 3877.875 |
wm_lh_posteriorcingulate
Description :
white matter left posteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_posteriorcingulate.imaging_t1 | numeric | 356.2819 | 1622.0857 |
wm_lh_precentral
Description :
white matter left precentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precentral.imaging_t1 | numeric | 1940.639 | 5455.114 |
wm_lh_precuneus
Description :
white matter left precuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_precuneus.imaging_t1 | numeric | 1466.360 | 4179.870 |
wm_lh_rostralanteriorcingulate
Description :
white matter left rostralanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralanteriorcingulate.imaging_t1 | numeric | 343.4164 | 909.4714 |
wm_lh_rostralmiddlefrontal
Description :
white matter left rostralmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_rostralmiddlefrontal.imaging_t1 | numeric | 1973.896 | 6114.488 |
wm_lh_superiorfrontal
Description :
white matter left superiorfrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorfrontal.imaging_t1 | numeric | 2503.062 | 7051.658 |
wm_lh_superiorparietal
Description :
white matter left superiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiorparietal.imaging_t1 | numeric | 2463.278 | 6232.714 |
wm_lh_superiortemporal
Description :
white matter left superiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_superiortemporal.imaging_t1 | numeric | 1609.629 | 3944.734 |
wm_lh_supramarginal
Description :
white matter left supramarginal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_supramarginal.imaging_t1 | numeric | 1705.131 | 4414.534 |
wm_lh_temporalpole
Description :
white matter left temporalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_temporalpole.imaging_t1 | numeric | 123.0852 | 426.7991 |
wm_lh_transversetemporal
Description :
white matter left transversetemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_lh_transversetemporal.imaging_t1 | numeric | 107.8967 | 413.6062 |
wm_rh_bankssts
Description :
white matter right bankssts volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_bankssts.imaging_t1 | numeric | 518.3122 | 1529.5534 |
wm_rh_caudalanteriorcingulate
Description :
white matter right caudalanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalanteriorcingulate.imaging_t1 | numeric | 276.6494 | 1114.5128 |
wm_rh_caudalmiddlefrontal
Description :
white matter right caudalmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_caudalmiddlefrontal.imaging_t1 | numeric | 870.5610 | 2282.9040 |
wm_rh_cuneus
Description :
white matter right cuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_cuneus.imaging_t1 | numeric | 637.2675 | 1891.9507 |
wm_rh_entorhinal
Description :
white matter right entorhinal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_entorhinal.imaging_t1 | numeric | 191.1708 | 572.5924 |
wm_rh_frontalpole
Description :
white matter right frontalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_frontalpole.imaging_t1 | numeric | 45.66105 | 174.22965 |
wm_rh_fusiform
Description :
white matter right fusiform volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_fusiform.imaging_t1 | numeric | 1427.774 | 3079.704 |
wm_rh_inferiorparietal
Description :
white matter right inferiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiorparietal.imaging_t1 | numeric | 2051.595 | 5968.417 |
wm_rh_inferiortemporal
Description :
white matter right inferiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_inferiortemporal.imaging_t1 | numeric | 1184.652 | 3230.675 |
wm_rh_insula
Description :
white matter right insula volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_insula.imaging_t1 | numeric | 1900.375 | 4279.061 |
wm_rh_isthmuscingulate
Description :
white matter right isthmuscingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_isthmuscingulate.imaging_t1 | numeric | 528.3967 | 1200.6360 |
wm_rh_lateraloccipital
Description :
white matter right lateraloccipital volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateraloccipital.imaging_t1 | numeric | 2180.425 | 7067.385 |
wm_rh_lateralorbitofrontal
Description :
white matter right lateralorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lateralorbitofrontal.imaging_t1 | numeric | 1317.728 | 2926.631 |
wm_rh_lingual
Description :
white matter right lingual volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_lingual.imaging_t1 | numeric | 1691.418 | 3600.787 |
wm_rh_medialorbitofrontal
Description :
white matter right medialorbitofrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_medialorbitofrontal.imaging_t1 | numeric | 652.0399 | 1821.0859 |
wm_rh_middletemporal
Description :
white matter right middletemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_middletemporal.imaging_t1 | numeric | 1290.445 | 3732.379 |
wm_rh_paracentral
Description :
white matter right paracentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_paracentral.imaging_t1 | numeric | 627.1931 | 1870.8637 |
wm_rh_parahippocampal
Description :
white matter right parahippocampal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parahippocampal.imaging_t1 | numeric | 580.7025 | 1193.0557 |
wm_rh_parsopercularis
Description :
white matter right parsopercularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsopercularis.imaging_t1 | numeric | 518.9602 | 1535.8073 |
wm_rh_parsorbitalis
Description :
white matter right parsorbitalis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parsorbitalis.imaging_t1 | numeric | 155.8251 | 535.3796 |
wm_rh_parstriangularis
Description :
white matter right parstriangularis volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_parstriangularis.imaging_t1 | numeric | 655.9312 | 1775.9621 |
wm_rh_pericalcarine
Description :
white matter right pericalcarine volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_pericalcarine.imaging_t1 | numeric | 803.6989 | 2418.4778 |
wm_rh_postcentral
Description :
white matter right postcentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_postcentral.imaging_t1 | numeric | 1159.360 | 3324.740 |
wm_rh_posteriorcingulate
Description :
white matter right posteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_posteriorcingulate.imaging_t1 | numeric | 329.6761 | 1811.8991 |
wm_rh_precentral
Description :
white matter right precentral volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precentral.imaging_t1 | numeric | 1947.928 | 5364.360 |
wm_rh_precuneus
Description :
white matter right precuneus volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_precuneus.imaging_t1 | numeric | 1439.340 | 4578.356 |
wm_rh_rostralanteriorcingulate
Description :
white matter right rostralanteriorcingulate volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralanteriorcingulate.imaging_t1 | numeric | 318.4923 | 936.7650 |
wm_rh_rostralmiddlefrontal
Description :
white matter right rostralmiddlefrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_rostralmiddlefrontal.imaging_t1 | numeric | 1887.391 | 5851.778 |
wm_rh_superiorfrontal
Description :
white matter right superiorfrontal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorfrontal.imaging_t1 | numeric | 2549.927 | 7268.467 |
wm_rh_superiorparietal
Description :
white matter right superiorparietal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiorparietal.imaging_t1 | numeric | 1839.669 | 5294.092 |
wm_rh_superiortemporal
Description :
white matter right superiortemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_superiortemporal.imaging_t1 | numeric | 1474.021 | 3681.787 |
wm_rh_supramarginal
Description :
white matter right supramarginal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_supramarginal.imaging_t1 | numeric | 1363.858 | 3526.571 |
wm_rh_temporalpole
Description :
white matter right temporalpole volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_temporalpole.imaging_t1 | numeric | 114.4712 | 361.0845 |
wm_rh_transversetemporal
Description :
white matter right transversetemporal volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm_rh_transversetemporal.imaging_t1 | numeric | 83.11241 | 270.02936 |
wm
Description :
global white matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_t1 | numeric | 271997.7 | 676189.9 |
x3rd_ventricle
Description :
3rd ventricle volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x3rd_ventricle.imaging_t1 | numeric | 253.7916 | 738.8449 |
x4th_ventricle
Description :
4th ventricle volume in mm3 (Deskian ROI)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| x4th_ventricle.imaging_t1 | numeric | 431.9561 | 1150.9627 |
imaging_wmh
Description :
White matter hyperintensities (WMH) are lesions in the brain that are likely the result of demyelination and axonal loss due to cerebral small vessel disease. These hyperintense areas are predominantly seen near the ventricles or in subcortical white matter areas and are quantified through segmentation from FLAIR MR images. While the exact underlying cause of WMH is not yet fully understood, age is an important risk factor as WMH becomes more prevalent and severe with older age. There has also been evidence to suggest that WMH play a role in cognitive decline and risk of dementia.
References :
Kim, K. W., MacFall, J. R., & Payne, M. E. (2008). Classification of white matter lesions on magnetic resonance imaging in elderly persons. Biological Psychiatry, 64(4), 273–280. https://doi.org/10.1016/j.biopsych.2008.03.024
Prins, N. D., & Scheltens, P. (2015). White matter hyperintensities, cognitive impairment and dementia: An update. Nature Reviews Neurology, 11(3), 157–165. https://doi.org/10.1038/nrneurol.2015.10
csf
Description :
global CSF volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| csf.imaging_wmh | numeric | 158716.4 | 1199485.8 |
delta_t
Description :
Days between scans for each PIDN
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| delta_t.imaging_wmh | 0 | numeric |
FLAIR
| Variable Name | Type |
|---|---|
| FLAIR.imaging_wmh | numeric |
gm
Description :
global grey matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gm.imaging_wmh | numeric | 354034.9 | 846619.1 |
label
Description :
Calculation of volume in each region
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| label.imaging_wmh | Sum | character |
log_wmh_mm3_prisma
| Variable Name | Type |
|---|---|
| log_wmh_mm3_prisma.imaging_wmh | numeric |
log_wmh_mm3_trio
| Variable Name | Type |
|---|---|
| log_wmh_mm3_trio.imaging_wmh | numeric |
mci_dataset
| Variable Name | Type |
|---|---|
| mci_dataset.imaging_wmh | numeric |
new
| Variable Name | Type |
|---|---|
| new.imaging_wmh | numeric |
old
| Variable Name | Type |
|---|---|
| old.imaging_wmh | numeric |
source_id
Description :
Suject Source ID
| Variable Name | Type |
|---|---|
| source_id.imaging_wmh | character |
tiv
Description :
global total intracranial volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| tiv.imaging_wmh | numeric | 1105908 | 2200421 |
wm
Description :
global white matter volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wm.imaging_wmh | numeric | 265428.6 | 667508.4 |
wmh_mm3_prisma
Description :
WMH volume (mm3) for Prisma Scanner
| Variable Name | Type |
|---|---|
| wmh_mm3_prisma.imaging_wmh | numeric |
wmh_mm3_trio
Description :
WMH volume (mm3) for Trio Scanner
| Variable Name | Type |
|---|---|
| wmh_mm3_trio.imaging_wmh | numeric |
wmh
Description :
WMH volume (mm3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wmh.imaging_wmh | numeric | 13.4783 | 236932.4043 |
WMH
| Variable Name | Type |
|---|---|
| WMH.imaging_wmh | numeric |
infoprocessingspeed
Description :
Info Processing Speed is a computerized battery of 10 binary choice reaction time tasks that rely upon non-verbal visuospatial cues, developed at the UCSF Memory and Aging Center and designed to measure cognitive processing speed. Tasks include abstract matching, mental rotation, visual search, distance judgement, length judgement, shape judgement, and semantic language tasks.
References :
- Kerchner, G. A., Racine, C. A., Hale, S., Wilheim, R., Laluz, V., Miller, B. L., & Kramer, J. H. (2012). Cognitive processing speed in older adults: relationship with white matter integrity. PloS one, 7(11), e50425. https://doi.org/10.1371/journal.pone.0050425
animnoz
Description :
Z-score for Animal task: non-animal word performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animnoz.infoprocessingspeed | numeric | 0.000 | 37.209 |
animyesz
Description :
Z-score for Animal task: animal word performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animyesz.infoprocessingspeed | numeric | 0.000 | 343.560 |
animz
Description :
Z-score for Animal task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animz.infoprocessingspeed | numeric | 0.003 | 29.369 |
dotz
Description :
Z-score for Dot task (distance judgement) performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dotz.infoprocessingspeed | numeric | 0.002 | 47.265 |
line10z
Description :
Z-score for Line task: lines differing by 10% performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| line10z.infoprocessingspeed | numeric | 0.002 | 37.900 |
line20z
Description :
Z-score for Line task: lines differing by 20% performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| line20z.infoprocessingspeed | numeric | 0.000 | 42.412 |
linez
Description :
Z-score for Line task (length judgement) performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| linez.infoprocessingspeed | numeric | 0.001 | 37.513 |
match1z
Description :
Z-score for Abstract Matching task: matching arrays equivalent on 2 dimensions performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match1z.infoprocessingspeed | numeric | 0.003 | 39.640 |
match21z
Description :
Z-score for Abstract Matching 2 task: matching arrays equivalent on 3 dimensions performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match21z.infoprocessingspeed | numeric | 0.002 | 15.185 |
match22z
Description :
Z-score for Abstract Matching 2 task: matching arrays equivalent on 2 dimensions performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match22z.infoprocessingspeed | numeric | 0.002 | 12.496 |
match23z
Description :
Z-score for Abstract Matching 2 task: matching arrays equivalent on 1 dimension performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match23z.infoprocessingspeed | numeric | 0.005 | 19.285 |
match2z
Description :
Z-score for Abstract Matching task: matching arrays equivalent on 1 dimension performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match2z.infoprocessingspeed | numeric | 0.002 | 12.881 |
pronz
Description :
Z-score for Pronounce task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pronz.infoprocessingspeed | numeric | 0.001 | 18.053 |
rhymenoz
Description :
Z-score for Rhyme task: non-rhyming word pair performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rhymenoz.infoprocessingspeed | numeric | 0.001 | 19.395 |
rhymeyesz
Description :
Z-score for Rhyme task: rhyming word pair performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rhymeyesz.infoprocessingspeed | numeric | 0.003 | 20.130 |
rhymez
Description :
Z-score for Rhyme task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rhymez.infoprocessingspeed | numeric | 0.000 | 19.763 |
rotate120z
Description :
Z-score for Rotation task: 120° mental rotation performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rotate120z.infoprocessingspeed | numeric | 0.023 | -0.569 |
rotate60z
Description :
Z-score for Rotation task: 60° mental rotation performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rotate60z.infoprocessingspeed | numeric | 0.026 | -0.717 |
rotatez
Description :
Z-score for Rotation task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rotatez.infoprocessingspeed | numeric | 0.023 | -0.510 |
search16nz
Description :
Z-score for Search task: 16 object array without target performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| search16nz.infoprocessingspeed | numeric | 0.001 | 21.526 |
search16yz
Description :
Z-score for Search task: 16 object array with target performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| search16yz.infoprocessingspeed | numeric | 0.024 | 41.002 |
search24nz
Description :
Z-score for Search task: 24 object array without target performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| search24nz.infoprocessingspeed | numeric | 0.011 | 18.071 |
search24yz
Description :
Z-score for Search task: 24 object array with target performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| search24yz.infoprocessingspeed | numeric | 0.008 | 51.355 |
searchz
Description :
Z-score for Search task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| searchz.infoprocessingspeed | numeric | 0.038 | 30.126 |
shapez
Description :
Z-score for Shape task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shapez.infoprocessingspeed | numeric | 0.112 | 52.837 |
spatial
Description :
Z-score for performance on Spacial tasks
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| spatial.infoprocessingspeed | numeric | 0.003 | 15.904 |
task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| task.infoprocessingspeed | AgingCog_RXNTestsPart1, AgingCog_RXNTestsPart2 | character |
verbal
Description :
Z-score for performance on Verbal tasks
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| verbal.infoprocessingspeed | numeric | 0.000 | 22.346 |
version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| version.infoprocessingspeed | 1.0.1 | character |
wordnoz
Description :
Z-score for Word task: non-real English word performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wordnoz.infoprocessingspeed | numeric | 0.008 | 26.391 |
wordyesz
Description :
Z-score for Word task: real English word performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wordyesz.infoprocessingspeed | numeric | 0.003 | 25.787 |
wordz
Description :
Z-score for Word task performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wordz.infoprocessingspeed | numeric | 0.002 | 26.089 |
insomnia_severity_index
Description :
7-item questionnaire asks respondents to rate the nature and symptoms of their sleep problems (the severity of symptoms, the respondent’s satisfaction with his or her sleep patterns, the degree to which insomnia interferes with daily functioning, how noticeable the respondent feels his or her insomnia is to others, and the overall level of distress)
References :
- Bastien, C. H., Vallières, A., & Morin, C. M. (2001). Validation of the insomnia severity index as an outcome measure for insomnia research. Sleep Medicine, 2 , 297–307
dont_worry_abt_col_names:
- https://www.ons.org/sites/default/files/InsomniaSeverityIndex_ISI.pdf
ISIdx
Description :
level of insomnia by category - total score of 0–7 indicates “no clinically signifi cant insomnia,” 8–14 means “subthreshold insomnia,” 15–21 is “clinical insomnia (moderate severity),” and 22–28 means “clinical insomnia (severe).”
References :
- Bastien, C. H., Vallières, A., & Morin, C. M. (2001). Validation of the insomnia severity index as an outcome measure for insomnia research. Sleep Medicine, 2 , 297–307.
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ISIdx.insomnia_severity_index | clinical insomnia (moderate), no clinical insomnia, subthreshold insomnia | character |
ISItotal
Description :
level of insomnia by total score - total score of 0–7 indicates “no clinically signifi cant insomnia,” 8–14 means “subthreshold insomnia,” 15–21 is “clinical insomnia (moderate severity),” and 22–28 means “clinical insomnia (severe).”
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ISItotal.insomnia_severity_index | numeric | 0 | 21 |
janssen
Description :
Plasma biomarker assays performed in collaboration with Janssen. P-tau217 was measured using an in-house SiMOA assay developed by Janssen. GFAP and NfL were measured using the Quanterix SiMOA Neurology 2‐Plex B kit.
References :
Saloner, R., VandeVrede, L., Asken, B. M., Paolillo, E. W., Gontrum, E. Q., Wolf, A., Lario-Lago, A., Milà-Alomà, M., Triana-Baltzer, G., Kolb, H. C., Dubal, D. B., Rabinovici, G. D., Miller, B. L., Boxer, A. L., Casaletto, K. B., & Kramer, J. H. (2024). Plasma phosphorylated tau-217 exhibits sex-specific prognostication of cognitive decline and brain atrophy in cognitively unimpaired adults. Alzheimer’s & dementia : the journal of the Alzheimer’s Association, 20(1), 376–387. https://doi.org/10.1002/alz.13454
Triana-Baltzer, G., Moughadam, S., Slemmon, R., Van Kolen, K., Theunis, C., Mercken, M., & Kolb, H. C. (2021). Development and validation of a high-sensitivity assay for measuring p217+tau in plasma. Alzheimer’s & dementia (Amsterdam, Netherlands), 13(1), e12204. https://doi.org/10.1002/dad2.12204
gfap_cv_janssen
Description :
Glial fibrillary acidic protein (GFAP) coefficient of variation (cv)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cv_janssen.janssen | numeric | 0 | 18.871068623 |
gfap_janssen
Description :
GFAP concentration (pg/ml)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_janssen.janssen | numeric | 0 | 1121.44195 |
nfl_cv_janssen
Description :
Neurofilament light chain (nfl) coefficient of variation (cv)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cv_janssen.janssen | numeric | 0 | 17.66269943 |
nfl_janssen
Description :
Nfl concentration (pg/ml)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_janssen.janssen | numeric | 0 | 116.103074 |
ptau217_cv_janssen
Description :
Phosphorylated tau-217 (P-tau217) coefficient of variation (cv)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau217_cv_janssen.janssen | numeric | 0 | 44.73198027 |
ptau217_janssen
Description :
P-tau217 concentration (pg/ml)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau217_janssen.janssen | numeric | 0 | 0.54509011 |
maas_mindfulness
Description :
The MAAS is a 15-item scale designed to assess a core characteristic of dispositional mindfulness, namely, open or receptive awareness of and attention to what is taking place in the present.
References :
- Brown, K.W. & Ryan, R.M. (2003). The benefits of being present: Mindfulness and its role in psychological well-being. Journal of Personality and Social Psychology, 84, 822-848.
maas_mindfulnessscore
Description :
MAAS score: mean mindfulness score of 15 item scale
References :
- Brown, K.W. & Ryan, R.M. (2003). The benefits of being present: Mindfulness and its role in psychological well-being. Journal of Personality and Social Psychology, 84, 822-848.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| maas_mindfulnessscore.maas_mindfulness | numeric | 1 | 6.00 |
maas_mindfulnesstot
Description :
total score of 15 mindfullnesss items
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| maas_mindfulnesstot.maas_mindfulness | numeric | 15 | 90 |
med_conditions
Description :
Clinician-assessed medical conditions from Form D2 UDS version 3
References :
Besser, L., Kukull, W., Knopman, D. S., Chui, H., Galasko, D., Weintraub, S., … & Neuropsychology Work Group. (2018). Version 3 of the national Alzheimer’s coordinating center’s uniform data set. Alzheimer Disease & Associated Disorders, 32(4), 351-358.
https://naccdata.org/data-collection/forms-documentation/uds-3
afibrill
Description :
Atrial fibrillation
References :
- https://naccdata.org/data-collection/forms-documentation/uds-3
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| afibrill.med_conditions | 0, 1 | numeric | no, yes |
angina
Description :
Angina
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| angina.med_conditions | 0, 1 | numeric | no, yes |
angiocp
Description :
Carotid procedure: angioplasty, endarterectomy, or stent
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| angiocp.med_conditions | 0, 1 | numeric | no, yes |
angiopci
Description :
Percutaneous coronary intervention: angioplasty and/or stent
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| angiopci.med_conditions | 0, 1 | numeric | no, yes |
antienc
Description :
Antibody-mediated encephalopathy
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| antienc.med_conditions | 0, 1 | numeric | no, yes |
antiencx
Description :
Antibody-mediated encephalopathy, specify
| Variable Name | Type |
|---|---|
| antiencx.med_conditions | character |
arth
Description :
Arthritis
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| arth.med_conditions | 0, 1 | numeric | no, yes |
artloex
Description :
Arthritis region affected — lower extremity
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artloex.med_conditions | 0, 1 | numeric | no, yes |
artspin
Description :
Arthritis region affected — spine
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artspin.med_conditions | 0, 1 | numeric | no, yes |
artunkn
Description :
Arthritis region affected — unknown
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artunkn.med_conditions | 0, 1 | numeric | no, yes |
artupex
Description :
Arthritis region affected — upper extremity
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artupex.med_conditions | 0, 1 | numeric | no, yes |
artype
Description :
Arthritis type
| Label | Value |
|---|---|
| 1 | Rheumatoid |
| 2 | Osteoarthritis |
| 3 | Other |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| artype.med_conditions | 1, 2, 3 | numeric | Rheumatoid, Osteoarthritis, Other |
artypex
Description :
Other arthritis type specification
| Variable Name | Type |
|---|---|
| artypex.med_conditions | character |
bowlinc
Description :
Incontinence — bowel
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| bowlinc.med_conditions | 0, 1 | numeric | no, yes |
cancer
Description :
Cancer (excluding non-melanoma skin cancer), primary or metastatic
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| cancer.med_conditions | 0, 1, 2 | numeric | no, yes, primary/non-metastatic, yes, metastatic |
cancsite
Description :
Cancer primary site specification
| Variable Name | Type |
|---|---|
| cancsite.med_conditions | character |
conghrt
Description :
Congestive Heart Failure
| Label | Value |
|---|---|
| 0 | absent |
| 1 | recent/active |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| conghrt.med_conditions | 0, 1 | numeric | absent, recent/active |
diabet
Description :
Diabetes
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes type 1 |
| 2 | yes type 2 |
| 3 | yes other type |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| diabet.med_conditions | 0, 1, 2, 3 | numeric | no, yes type 1, yes type 2, yes other type |
form_ver
Description :
Form Type
| Label | Value |
|---|---|
| 3.0 | form version 3.0 |
| 3.2 | form version 3.2 |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| form_ver.med_conditions | 3.0, 3.2 | numeric | form version 3.0, form version 3.2 |
hvalve
Description :
heart valve replacement or repair
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hvalve.med_conditions | 0, 1 | numeric | no, yes |
hypchol
Description :
Hypercholesterolemia
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hypchol.med_conditions | 0, 1 | numeric | no, yes |
hypert
Description :
Hypertension
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hypert.med_conditions | 0, 1 | numeric | no, yes |
hyposom
Description :
Hyposomnia/insomnia
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hyposom.med_conditions | 0, 1 | numeric | no, yes |
myoinf
Description :
Myocardial infarct
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| myoinf.med_conditions | 0, 1 | numeric | no, yes |
othcond
Description :
Other medical conditions or procedures not listed above
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| othcond.med_conditions | 0, 1 | numeric | no, yes |
othcondx
Description :
Other medical conditions specification
| Variable Name | Type |
|---|---|
| othcondx.med_conditions | character |
pacemake
Description :
Pacemaker and/or defrbillator
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| pacemake.med_conditions | 0, 1 | numeric | no, yes |
remdis
Description :
REM sleep behavior disorder (RBD)
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| remdis.med_conditions | 0, 1 | numeric | no, yes |
sleepap
Description :
Sleep apnea
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| sleepap.med_conditions | 0, 1 | numeric | no, yes |
sleepoth
Description :
other sleep disorder
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| sleepoth.med_conditions | 0, 1 | numeric | no, yes |
sleepotx
Description :
Other sleep disorder specification
| Variable Name | Type |
|---|---|
| sleepotx.med_conditions | character |
thydis
Description :
Thyroid disease
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| thydis.med_conditions | 0, 1 | numeric | no, yes |
urineinc
Description :
Incontinence — urinary
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| urineinc.med_conditions | 0, 1 | numeric | no, yes |
vb12def
Description :
B12 deficiency
| Label | Value |
|---|---|
| 0 | no |
| 1 | yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| vb12def.med_conditions | 0, 1 | numeric | no, yes |
mesoscale
ang_bfgf_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_bfgf_clncv.mesoscale | numeric | 0.570 | 796.740 |
ang_bfgf_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_bfgf_cv.mesoscale | numeric | 0.008 | 30.700 |
ang_bfgf
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_bfgf.mesoscale | numeric | 0.570 | 796.740 |
ang_flt_1_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_flt_1_clncv.mesoscale | numeric | 9.112 | 163.670 |
ang_flt_1_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_flt_1_cv.mesoscale | numeric | 0.000 | 20.927 |
ang_flt_1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_flt_1.mesoscale | numeric | 9.112 | 163.670 |
ang_plgf_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_plgf_clncv.mesoscale | numeric | 3.840 | 19.186 |
ang_plgf_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_plgf_cv.mesoscale | numeric | 0.000 | 17.266 |
ang_plgf
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_plgf.mesoscale | numeric | 3.840 | 19.186 |
ang_tie_2_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_tie_2_clncv.mesoscale | numeric | 193.982 | 14804.620 |
ang_tie_2_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_tie_2_cv.mesoscale | numeric | 0.007 | 100.440 |
ang_tie_2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_tie_2.mesoscale | numeric | 193.982 | 14804.620 |
ang_vegf_c_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_c_clncv.mesoscale | numeric | 25.280 | 2032.100 |
ang_vegf_c_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_c_cv.mesoscale | numeric | 0.000 | 98.730 |
ang_vegf_c
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_c.mesoscale | numeric | 24.038 | 2032.100 |
ang_vegf_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_clncv.mesoscale | numeric | 25.420 | 864.460 |
ang_vegf_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_cv.mesoscale | numeric | 0.000 | 19.200 |
ang_vegf_d_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_d_clncv.mesoscale | numeric | 45.690 | 2271.960 |
ang_vegf_d_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_d_cv.mesoscale | numeric | 0.010 | 41.370 |
ang_vegf_d
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf_d.mesoscale | numeric | 45.690 | 2271.960 |
ang_vegf
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ang_vegf.mesoscale | numeric | 25.420 | 864.460 |
chem_eotaxin_3_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_3_clncv.mesoscale | numeric | 0.7896232 | 3316.2327580 |
chem_eotaxin_3_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_3_cv.mesoscale | numeric | 0.0000000 | 136.6200000 |
chem_eotaxin_3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_3.mesoscale | numeric | 0.7896232 | 3316.2327580 |
chem_eotaxin_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_clncv.mesoscale | numeric | 35.25931 | 2201.45200 |
chem_eotaxin_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin_cv.mesoscale | numeric | 0.000000000 | 49.815000000 |
chem_eotaxin
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_eotaxin.mesoscale | numeric | 35.25931 | 2201.45200 |
chem_ip_10_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_ip_10_clncv.mesoscale | numeric | 0.0000 | 14793.9526 |
chem_ip_10_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_ip_10_cv.mesoscale | numeric | 0.000000e+00 | 9.995000e+00 |
chem_ip_10
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_ip_10.mesoscale | numeric | 0.0000 | 14793.9526 |
chem_mcp_1_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_1_clncv.mesoscale | numeric | 16.09000 | 333.35351 |
chem_mcp_1_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_1_cv.mesoscale | numeric | 0.006000000 | 85.540000000 |
chem_mcp_1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_1.mesoscale | numeric | 16.09000 | 333.35351 |
chem_mcp_4_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_4_clncv.mesoscale | numeric | 11.40600 | 1734.23700 |
chem_mcp_4_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_4_cv.mesoscale | numeric | 0.000000000 | 68.910000000 |
chem_mcp_4
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mcp_4.mesoscale | numeric | 11.40600 | 1734.23700 |
chem_mdc_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mdc_clncv.mesoscale | numeric | 217.3490 | 23498.9500 |
chem_mdc_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mdc_cv.mesoscale | numeric | 0.01045173 | 77.05000000 |
chem_mdc
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mdc.mesoscale | numeric | 217.3490 | 23498.9500 |
chem_mip_1alpha_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1alpha_clncv.mesoscale | numeric | 3.513518 | 746.952854 |
chem_mip_1alpha_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1alpha_cv.mesoscale | numeric | 0.0000000 | 123.0300000 |
chem_mip_1alpha
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1alpha.mesoscale | numeric | 1.581820 | 746.952854 |
chem_mip_1beta_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1beta_clncv.mesoscale | numeric | 13.62669 | 523.93000 |
chem_mip_1beta_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1beta_cv.mesoscale | numeric | 0.003557655 | 56.700000000 |
chem_mip_1beta
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_mip_1beta.mesoscale | numeric | 13.62669 | 523.93000 |
chem_tarc_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_tarc_clncv.mesoscale | numeric | 8.859382 | 3710.250000 |
chem_tarc_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_tarc_cv.mesoscale | numeric | 0.00000000 | 73.88000000 |
chem_tarc
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| chem_tarc.mesoscale | numeric | 6.972760 | 3710.250000 |
cyt_ifn_gamma_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_ifn_gamma_clncv.mesoscale | numeric | 0.4066359 | 749.5975302 |
cyt_ifn_gamma_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_ifn_gamma_cv.mesoscale | numeric | 0.00000000 | 67.13834315 |
cyt_ifn_gamma
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_ifn_gamma.mesoscale | numeric | 0.3210666 | 749.5975302 |
cyt_il_10_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_10_clncv.mesoscale | numeric | 0.06847087 | 16.84495125 |
cyt_il_10_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_10_cv.mesoscale | numeric | 0.00000000 | 103.38000000 |
cyt_il_10
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_10.mesoscale | numeric | 0.03740846 | 16.84495125 |
cyt_il_12p70_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_12p70_clncv.mesoscale | numeric | 0.008135177 | 6.021390238 |
cyt_il_12p70_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_12p70_cv.mesoscale | numeric | 0.0000000 | 140.5465313 |
cyt_il_12p70
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_12p70.mesoscale | numeric | 0.001958770 | 6.021390238 |
cyt_il_13_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_13_clncv.mesoscale | numeric | 0.1281520 | 8.1599861 |
cyt_il_13_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_13_cv.mesoscale | numeric | 0.0000000 | 134.2184627 |
cyt_il_13
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_13.mesoscale | numeric | 0.07670215 | 8.15998614 |
cyt_il_1beta_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_1beta_clncv.mesoscale | numeric | 0.004834041 | 1.790074301 |
cyt_il_1beta_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_1beta_cv.mesoscale | numeric | 0.4354365 | 131.4346251 |
cyt_il_1beta
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_1beta.mesoscale | numeric | 0.004184987 | 14.539722000 |
cyt_il_2_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_2_clncv.mesoscale | numeric | 0.00006890 | 113.89536090 |
cyt_il_2_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_2_cv.mesoscale | numeric | 0.0000000 | 135.4783285 |
cyt_il_2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_2.mesoscale | numeric | 1.006149e-01 | 9.949623e-02 |
cyt_il_4_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_4_clncv.mesoscale | numeric | 0.001259597 | 1.529505746 |
cyt_il_4_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_4_cv.mesoscale | numeric | 0.0000000 | 139.4589891 |
cyt_il_4
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_4.mesoscale | numeric | 0.000172982 | 1.529505746 |
cyt_il_6_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_6_clncv.mesoscale | numeric | 0.1150000 | 62.0100000 |
cyt_il_6_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_6_cv.mesoscale | numeric | 0.00000000 | 80.38000000 |
cyt_il_6
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_6.mesoscale | numeric | 0.0500000 | 62.0100000 |
cyt_il_8_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_8_clncv.mesoscale | numeric | 1.262448 | 3541.786927 |
cyt_il_8_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_8_cv.mesoscale | numeric | 0.0000000 | 140.9614505 |
cyt_il_8
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_il_8.mesoscale | numeric | 1.262448 | 3677.231791 |
cyt_tnf_alph_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_tnf_alph_clncv.mesoscale | numeric | 0.7900000 | 35.1600000 |
cyt_tnf_alph_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_tnf_alph_cv.mesoscale | numeric | 0.00000000 | 17.89000000 |
cyt_tnf_alph
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cyt_tnf_alph.mesoscale | numeric | 0.7900000 | 35.1600000 |
il_8_p_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| il_8_p_clncv.mesoscale | numeric | 1.439664 | 660.294828 |
il_8_p_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| il_8_p_cv.mesoscale | numeric | 0.00000000 | 67.36930440 |
il_8_p
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| il_8_p.mesoscale | numeric | 1.439664 | 660.294828 |
meso_plate
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| meso_plate.mesoscale | numeric | 1 | 34 |
pro_gm_csf
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_gm_csf.mesoscale | numeric | 0.006118335 | 0.791806968 |
pro_il_1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_1.mesoscale | numeric | 0.2552253 | 101.0278045 |
pro_il_12p40
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_12p40.mesoscale | numeric | 24.50345 | 1184.51537 |
pro_il_15
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_15.mesoscale | numeric | 0.9717009 | 7.0070758 |
pro_il_16
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_16.mesoscale | numeric | 20.81769 | 1470.61875 |
pro_il_17
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_17.mesoscale | numeric | 0.2712118 | 13.3502784 |
pro_il_5
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_5.mesoscale | numeric | 0.1482988 | 2.9899785 |
pro_il_7
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_il_7.mesoscale | numeric | 0.8170460 | 28.3601503 |
pro_tnf
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_tnf.mesoscale | numeric | 0.03474753 | 1.03086943 |
pro_vegf
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pro_vegf.mesoscale | numeric | 18.37737 | 443.96111 |
vasc_crp_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_crp_clncv.mesoscale | numeric | 71604.29 | 84889271.68 |
vasc_crp_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_crp_cv.mesoscale | numeric | 0.00000000 | 62.26000000 |
vasc_crp
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_crp.mesoscale | numeric | 71604.29 | 92167127.44 |
vasc_icam_1_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_icam_1_clncv.mesoscale | numeric | 212627.0 | 2078658.3 |
vasc_icam_1_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_icam_1_cv.mesoscale | numeric | 0.0150000 | 58.3300000 |
vasc_icam_1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_icam_1.mesoscale | numeric | 212627.0 | 2078658.3 |
vasc_saa_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_saa_clncv.mesoscale | numeric | 162223.6 | 304395515.3 |
vasc_saa_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_saa_cv.mesoscale | numeric | 0.000000000 | 65.170000000 |
vasc_saa
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_saa.mesoscale | numeric | 162223.6 | 304395515.3 |
vasc_vcam_1_clncv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_vcam_1_clncv.mesoscale | numeric | 199334.6 | 2739272.1 |
vasc_vcam_1_cv
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_vcam_1_cv.mesoscale | numeric | 0.00000000 | 62.78000000 |
vasc_vcam_1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| vasc_vcam_1.mesoscale | numeric | 199334.6 | 2739272.1 |
npi
Description :
The NPI-Q is based on a study partner interview in which a series of questions are read about 12 behaviors. After each behavior, the study partner responds yes or no. If the study partner responds yes, then they are asked to rate the behavior as mild, moderate, or severe.
References :
- Gontrum, E. Q., Paolillo, E. W., Lee, S., Diaz, V., Ehrenberg, A., Saloner, R., … & Casaletto, K. (2024). Neuropsychiatric profiles and cerebral amyloid burden in adults without dementia. Dementia and Geriatric Cognitive Disorders.
abandon
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| abandon.npi | 1, 2 | numeric |
affair
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| affair.npi | 1, 2 | numeric |
ag_dis
| Variable Name | Type |
|---|---|
| ag_dis.npi | numeric |
ag_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ag_freq.npi | 1, 2, 3, 4 | numeric |
ag_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ag_oth.npi | 1, 2 | numeric |
ag_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ag_sev.npi | 1, 2, 3 | numeric |
ag_totl
| Variable Name | Type |
|---|---|
| ag_totl.npi | numeric |
agitate
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| agitate.npi | 1, 2 | numeric |
anger
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anger.npi | 1, 2 | numeric |
anx_dis
| Variable Name | Type |
|---|---|
| anx_dis.npi | numeric |
anx_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anx_freq.npi | 1, 2, 3, 4 | numeric |
anx_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anx_oth.npi | 1, 2 | numeric |
anx_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anx_sev.npi | 1, 2, 3 | numeric |
anx_totl
| Variable Name | Type |
|---|---|
| anx_totl.npi | numeric |
anxiety
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| anxiety.npi | 1, 2 | numeric |
apathy
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apathy.npi | 1, 2 | numeric |
appetite
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| appetite.npi | 1, 2 | numeric |
apth_dis
| Variable Name | Type |
|---|---|
| apth_dis.npi | numeric |
apth_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apth_freq.npi | 1, 2, 3, 4 | numeric |
apth_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apth_oth.npi | 1, 2 | numeric |
apth_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| apth_sev.npi | 1, 2, 3 | numeric |
apth_totl
| Variable Name | Type |
|---|---|
| apth_totl.npi | numeric |
avoid
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| avoid.npi | 1, 2 | numeric |
awaken
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| awaken.npi | 1, 2 | numeric |
behavior
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behavior.npi | 1, 2 | numeric |
burden
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| burden.npi | 1, 2 | numeric |
change
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| change.npi | 1, 2 | numeric |
chores
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| chores.npi | 1, 2 | numeric |
claim
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| claim.npi | 1, 2 | numeric |
clothing
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| clothing.npi | 1, 2 | numeric |
convrs
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| convrs.npi | 1, 2 | numeric |
coping
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| coping.npi | 1, 2 | numeric |
cranky
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cranky.npi | 1, 2 | numeric |
crude
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| crude.npi | 1, 2 | numeric |
curse
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| curse.npi | 1, 2 | numeric |
day
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| day.npi | 1, 2 | numeric |
death
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| death.npi | 1, 2 | numeric |
del_dis
| Variable Name | Type |
|---|---|
| del_dis.npi | numeric |
del_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| del_freq.npi | 1, 2, 3, 4 | numeric |
del_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| del_oth.npi | 1, 2 | numeric |
del_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| del_sev.npi | 1, 2, 3 | numeric |
del_totl
| Variable Name | Type |
|---|---|
| del_totl.npi | numeric |
delusn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| delusn.npi | 1, 2 | numeric |
dep_dis
| Variable Name | Type |
|---|---|
| dep_dis.npi | numeric |
dep_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dep_freq.npi | 1, 2, 3, 4 | numeric |
dep_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dep_oth.npi | 1, 2 | numeric |
dep_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dep_sev.npi | 1, 2, 3 | numeric |
dep_totl
| Variable Name | Type |
|---|---|
| dep_totl.npi | numeric |
difficult
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| difficult.npi | 1, 2 | numeric |
dis_dis
| Variable Name | Type |
|---|---|
| dis_dis.npi | numeric |
dis_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dis_freq.npi | 1, 2, 3, 4 | numeric |
dis_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dis_oth.npi | 1, 2 | numeric |
dis_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dis_sev.npi | 1, 2, 3 | numeric |
dis_totl
| Variable Name | Type |
|---|---|
| dis_totl.npi | numeric |
disinhibition
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| disinhibition.npi | 1, 2 | numeric |
dngr
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dngr.npi | 1, 2 | numeric |
dprssn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dprssn.npi | 1, 2 | numeric |
dstrs_tot
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dstrs_tot.npi | numeric | 0 | 46 |
early
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| early.npi | 1, 2 | numeric |
eat_dis
| Variable Name | Type |
|---|---|
| eat_dis.npi | numeric |
eat_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eat_freq.npi | 1, 2, 3, 4 | numeric |
eat_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eat_oth.npi | 1, 2 | numeric |
eat_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eat_sev.npi | 1, 2, 3 | numeric |
eat_totl
| Variable Name | Type |
|---|---|
| eat_totl.npi | numeric |
eat
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eat.npi | 1, 2 | numeric |
emotion
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| emotion.npi | 1, 2 | numeric |
enthuse
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| enthuse.npi | 1, 2 | numeric |
eup_dis
| Variable Name | Type |
|---|---|
| eup_dis.npi | numeric |
eup_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eup_freq.npi | 1, 2, 3, 4 | numeric |
eup_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eup_oth.npi | 1, 2 | numeric |
eup_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| eup_sev.npi | 1, 2, 3 | numeric |
eup_totl
| Variable Name | Type |
|---|---|
| eup_totl.npi | numeric |
euphoria
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| euphoria.npi | 1, 2 | numeric |
failure
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| failure.npi | 1, 2 | numeric |
fall_asleep
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fall_asleep.npi | 1, 2 | numeric |
fidget
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fidget.npi | 1, 2 | numeric |
food_type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| food_type.npi | 1, 2 | numeric |
food
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| food.npi | 1, 2 | numeric |
friends
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| friends.npi | 1, 2 | numeric |
future
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| future.npi | 1, 2 | numeric |
giggle
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| giggle.npi | 1, 2 | numeric |
habits
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| habits.npi | 1, 2 | numeric |
hal_dis
| Variable Name | Type |
|---|---|
| hal_dis.npi | numeric |
hal_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hal_freq.npi | 1, 2, 3, 4 | numeric |
hal_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hal_oth.npi | 1, 2 | numeric |
hal_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hal_sev.npi | 1, 2, 3 | numeric |
hal_totl
| Variable Name | Type |
|---|---|
| hal_totl.npi | numeric |
happy
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| happy.npi | 1, 2 | numeric |
help
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| help.npi | 1, 2 | numeric |
hit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hit.npi | 1, 2 | numeric |
hlcntns
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hlcntns.npi | 1, 2 | numeric |
home
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| home.npi | 1, 2 | numeric |
hug
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hug.npi | 1, 2 | numeric |
humor
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| humor.npi | 1, 2 | numeric |
hurt
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| hurt.npi | 1, 2 | numeric |
impulsiv
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| impulsiv.npi | 1, 2 | numeric |
increase
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| increase.npi | 1, 2 | numeric |
intrst
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| intrst.npi | 1, 2 | numeric |
irr_dis
| Variable Name | Type |
|---|---|
| irr_dis.npi | numeric |
irr_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| irr_freq.npi | 1, 2, 3, 4 | numeric |
irr_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| irr_oth.npi | 1, 2 | numeric |
irr_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| irr_sev.npi | 1, 2, 3 | numeric |
irr_totl
| Variable Name | Type |
|---|---|
| irr_totl.npi | numeric |
irritble
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| irritble.npi | 1, 2 | numeric |
jokes
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| jokes.npi | 1, 2 | numeric |
mood
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mood.npi | 1, 2 | numeric |
mot_dis
| Variable Name | Type |
|---|---|
| mot_dis.npi | numeric |
mot_freq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mot_freq.npi | 1, 2, 3, 4 | numeric |
mot_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mot_oth.npi | 1, 2 | numeric |
mot_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mot_sev.npi | 1, 2, 3 | numeric |
mot_totl
| Variable Name | Type |
|---|---|
| mot_totl.npi | numeric |
motor
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| motor.npi | 1, 2 | numeric |
nervous
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nervous.npi | 1, 2 | numeric |
night
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| night.npi | 1, 2 | numeric |
npi_q
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| npi_q.npi | 0, 1 | numeric |
openly
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| openly.npi | 1, 2 | numeric |
pace
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pace.npi | 1, 2 | numeric |
pranks
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pranks.npi | 1, 2 | numeric |
punish
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| punish.npi | 1, 2 | numeric |
repetitive
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| repetitive.npi | 1, 2 | numeric |
resist
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| resist.npi | 1, 2 | numeric |
rummage
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rummage.npi | 1, 2 | numeric |
sad
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sad.npi | 1, 2 | numeric |
see
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| see.npi | 1, 2 | numeric |
sighing
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sighing.npi | 1, 2 | numeric |
sle_dis
| Variable Name | Type |
|---|---|
| sle_dis.npi | numeric |
sle_frq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sle_frq.npi | 1, 2, 3, 4 | numeric |
sle_sev
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sle_sev.npi | 1, 2, 3 | numeric |
sle_totl
| Variable Name | Type |
|---|---|
| sle_totl.npi | numeric |
sleep_oth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_oth.npi | 1, 2 | numeric |
sleep
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep.npi | 1, 2 | numeric |
smell
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| smell.npi | 2 | numeric |
spntns
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| spntns.npi | 1, 2 | numeric |
start
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| start.npi | 1, 2 | numeric |
steal
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| steal.npi | 1, 2 | numeric |
stranger
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| stranger.npi | 1, 2 | numeric |
stubborn
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| stubborn.npi | 1, 2 | numeric |
t_vfigs
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| t_vfigs.npi | 1, 2 | numeric |
talk
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| talk.npi | 1, 2 | numeric |
taste
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| taste.npi | 2 | numeric |
tearful
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tearful.npi | 1, 2 | numeric |
temper
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| temper.npi | 1, 2 | numeric |
tense
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| tense.npi | 1, 2 | numeric |
throw
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| throw.npi | 1, 2 | numeric |
total
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| total.npi | numeric | 0 | 123 |
touch
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| touch.npi | 1, 2 | numeric |
truth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| truth.npi | 1, 2 | numeric |
uds_agit
Description :
Agitation or aggression in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_agit.npi | 0, 1 | categorical | No, Yes |
uds_agitsev
Description :
Agitation or aggression severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_agitsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_anx
Description :
Anxiety in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_anx.npi | 0, 1 | categorical | No, Yes |
uds_anxsev
Description :
Anxiety severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_anxsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_apa
Description :
Apathy or indifference in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_apa.npi | 0, 1 | categorical | No, Yes |
uds_apasev
Description :
Apathy or indifference severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_apasev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_app
Description :
Appetite and eating problems in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_app.npi | 0, 1 | categorical | No, Yes |
uds_appsev
Description :
appetite and eating severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_appsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_del
Description :
Delusions in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_del.npi | 0, 1 | categorical | No, Yes |
uds_delsev
Description :
Delusions severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_delsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_depd
Description :
Depression or dysphoria in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_depd.npi | 0, 1 | categorical | No, Yes |
uds_depdsev
Description :
Depression or dysphoria severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_depdsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_disn
Description :
Disinhibition in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_disn.npi | 0, 1 | categorical | No, Yes |
uds_disnsev
Description :
Disinhibition severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_disnsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_elat
Description :
Elation or euphoria in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_elat.npi | 0, 1 | categorical | No, Yes |
uds_elatsev
Description :
Elation or euphoria severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_elatsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_hall
Description :
Hallucinations in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_hall.npi | 0, 1 | categorical | No, Yes |
uds_hallsev
Description :
Hallucinations severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_hallsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_irr
Description :
Irritability or lability in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_irr.npi | 0, 1 | categorical | No, Yes |
uds_irrsev
Description :
Irritability or lability severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_irrsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_mot
Description :
Motor disturbance in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_mot.npi | 0, 1 | categorical | No, Yes |
uds_motsev
Description :
Motor severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_motsev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_nite
Description :
Nighttime behaviors in the last month
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_nite.npi | 0, 1 | categorical | No, Yes |
uds_nitesev
Description :
Nighttime behaviors severity
| Label | Value |
|---|---|
| 1 | Mild |
| 2 | Moderate |
| 3 | Severe |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| uds_nitesev.npi | 1, 2, 3 | categorical | Mild, Moderate, Severe |
uds_npiqinf
Description :
NPI-Q co-participant
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| uds_npiqinf.npi | 1, 2, 3 | character |
uds_npiqinfx
Description :
NPI-Q co-participant, other specify
| Variable Name | Type |
|---|---|
| uds_npiqinfx.npi | character |
osu_tbi
Description :
The Ohio State University (OSU) Traumatic Brain Injury (TBI) Identification Method (OSU TBI-ID) is a standardized procedure for eliciting a person’s lifetime history of TBI via a 3-5 minute structured interview.
References :
Bogner, J.A., Corrigan, J.D. (2009). Reliability and validity of the OSU TBI Identification Method with Prisoners. Journal of Head Trauma Rehabilitation, 24(6), 279-291
Corrigan, J.D., Bogner, J.A. (2007). Initial reliability and validity of the OSU TBI Identification Method. Journal of Head Trauma Rehabilitation, 22(6), 318-329.
osu_any_modsev_tbi
Description :
Worst? has there been one moderate or severe TBI (i.e., any TBI with 30 minutes or more loss of consciousness)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| osu_any_modsev_tbi.osu_tbi | 0, 1 | categorical |
osu_tbi_locpta_total
Description :
??
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| osu_tbi_locpta_total.osu_tbi | 0, 1, 2, 3 | numeric |
osu_tbi1_locpta_age
Description :
Age of first TBI
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| osu_tbi1_locpta_age.osu_tbi | numeric | 1 | 76 |
osu_tbi2_locpta_age
Description :
Age of second TBI
| Variable Name | Type |
|---|---|
| osu_tbi2_locpta_age.osu_tbi | numeric |
osu_tbi3_locpta_age
Description :
TBI
| Variable Name | Type |
|---|---|
| osu_tbi3_locpta_age.osu_tbi | numeric |
osu_tbi7_locpta_age
Description :
??
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| osu_tbi7_locpta_age.osu_tbi | 52 | numeric |
patternseparation
Description :
Mnemonic similarity task: During incidental encoding, participants viewed pictures of 80 common objects. In order to enhance encoding/attention, they were asked to judge whether the objects were most commonly found indoors or outdoors. Immediately following encoding, they were shown 40 of the studied objects, 40 novel foil objects, and 40 lure objects that were similar but not identical to studied objects. Participants were asked to classify items as “old,” “similar” or “new.” The critical metric of pattern separation is the ability to discriminate similar lure items from old items.
References :
Stark, S. M., Yassa, M. A., Lacy, J. W., & Stark, C. E. (2013). A task to assess behavioral pattern separation (BPS) in humans: Data from healthy aging and mild cognitive impairment. Neuropsychologia, 51(12), 2442–2449. https://doi.org/10.1016/j.neuropsychologia.2012.12.014.
Memel, M., Staffaroni, A. M., Cobigo, Y., Casaletto, K. B., Fonseca, C., Bettcher, B. M., … & Kramer, J. H. (2021). APOE moderates the effect of hippocampal blood flow on memory pattern separation in clinically normal older adults. Hippocampus, 31(8), 845-857.
LDI
Description :
Lure Discrimination Index: the difference between the probability of giving a “similar” response to lure items and the probability of giving a “similar” response to a new item
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| LDI.patternseparation | numeric | 0 | 120 |
p_sep_sim_foil
Description :
Number of foil tems classified as “similar”
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| p_sep_sim_foil.patternseparation | numeric | 0 | 120 |
p_sep_sim_lure
Description :
Number of lure items classified as “similar”
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| p_sep_sim_lure.patternseparation | numeric | 0 | 120 |
pet
PET_status_inferred
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PET_status_inferred.pet | DISCREPANT, NEGATIVE, POSITIVE | character |
PET_suvr_threshold_positive
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PET_suvr_threshold_positive.pet | 0, 1 | numeric |
PET_suvr_threshold
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PET_suvr_threshold.pet | 1.08, 1.11, 1.21 | numeric |
PETcentiloids
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| PETcentiloids.pet | numeric | 0.018685720 | 148.305259700 |
PETcompound
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PETcompound.pet | AV45, FBB, PIB | character |
PETlocation
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PETlocation.pet | CB, LBL, SFVA | character |
PETnotes
| Variable Name | Type |
|---|---|
| PETnotes.pet | character |
PETsuvr
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| PETsuvr.pet | numeric | 0.8470289 | 2.4323309 |
PETvisit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| PETvisit.pet | Amyloid PET CB, AV45 PET, LBL PET, PIB | character |
physical
Description :
Physical measurements and vital signs are collected during the neurological exam at each research visit.
bpdias
Description :
Diastolic blood pressure of participant; minimum blood pressure detected just prior to the next contraction
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bpdias.physical | numeric | 30 | 170 |
bpsys
Description :
Systolic blood pressure of participant; maximum blood pressure detected during contraction of the ventricles
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bpsys.physical | numeric | 86 | 220 |
height
Description :
Height of the participant measured in inches
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| height.physical | numeric | -6.0 | 79.0 |
hrate
Description :
Resting heart rate of the participant
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| hrate.physical | numeric | 19 | 120 |
weight
Description :
Weight of the participant measured in lbs
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| weight.physical | numeric | 80 | 320 |
physical_activity_scale
Description :
The Physical Activity Scale for the Elderly (PASE) is a widely validated measure of self-reported activity levels for older adults. Participants are ask to rate weekly frequency and daily duration for the following recreational activities: (1) walking; (2) light, moderate, and strenuous sports; (3) housework; (4) yardwork; and (5) strength training. Activity scores are computed by multiplying activity frequencies by the task-specific weights, according to the scoring manual. Activity scores are then summed to obtain a total score representing overall physical activity level, with higher values indicating greater activity.
References :
- Washburn RA, Smith KW, Jette AM, Janney CA. The physical activity scale for the elderly (PASE): Development and evaluation. Journal of Clinical Epidemiology. 1993;46(2):153-162. doi:10.1016/0895-4356(93)90053-4
pase_pase_total
Description :
PASE scores are calculated from weights and frequency values for each type of activity. Range can be from 0 to 500 or more.
References :
- Link to scoring manual: https://meetinstrumentenzorg.nl/wp-content/uploads/instrumenten/PASE-handl.pdf
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| pase_pase_total.physical_activity_scale | numeric | 0.00 | infinity |
psqi
Description :
The Pittsburgh Sleep Quality Index (PSQI) is a self-report questionnaire that assesses sleep quality over a 1-month time interval. Each of the questionnaire’s 19 self-reported items belongs to one of seven subcategories: subjective sleep quality, sleep latency, sleep duration, habitual sleep efficiency, sleep disturbances, use of sleeping medication, and daytime dysfunction. The 19 individual items, with 7 components, produce one global score. The PSQI takes 5–10 minutes to complete.
References :
- Buysse, D. J., Reynolds, C. F., 3rd, Monk, T. H., Berman, S. R., & Kupfer, D. J. (1989). The Pittsburgh Sleep Quality Index: a new instrument for psychiatric practice and research. Psychiatry research, 28(2), 193–213. https://doi.org/10.1016/0165-1781(89)90047-4
psqi_PSQItot
Description :
Total score is the sum of the 7 components
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| psqi_PSQItot.psqi | numeric | 0.0 | 21 |
psqi_totBinary
Description :
Total less than or equal to 5 is associated with good sleep quality (0); Total greater than 5 associated with poor sleep quality (1)
| Label | Value |
|---|---|
| 0 | good |
| 1 | poor |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| psqi_totBinary.psqi | 0, 1 | categorical | good, poor |
pss
Description :
The Perceived Stress Scale (PSS) measures the perception of stress. The PSS has 10-items assessing degree of life stress over the past month (e.g., how “unpredictable, uncontrollable, and overloaded” respondents find their lives). Likert scale answers range from “never” (zero points) to “very often” (four points). Score range: 0-40.
References :
Cohen, S., Kamarck, T., & Mermelstein, R. (1983). A global measure of perceived stress. Journal of Health and Social Behavior, 24(4), 385–396. https://doi.org/10.2307/2136404
Cohen, S. and Williamson, G. (1988) Perceived stress in a probability sample of the United States. The Social Psychology of Health, 13, 31-67.
PSSTotal
Description :
Total PSS score: sum of PSS1 – PSS10, each question max of 4 points
References :
- Cohen, S., Kamarck, T., & Mermelstein, R. (1983). A global measure of perceived stress. Journal of Health and Social Behavior, 24(4), 385–396. https://doi.org/10.2307/2136404
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| PSSTotal.pss | numeric | 0 | 40 |
quanterix
Description :
Plasma biomarker assays performed in-house at UCSF MAC using the Quanterix SiMOA Neurology 4‐Plex E (amyloid-beta 40/42, NfL, GFAP), P-tau181, and total tau kits. Experiments were conducted on two non-overlapping study samples: 1) BrANCH participants, 2) Fitbit substudy participants.
ab40_analysis_date_branch
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_analysis_date_branch.quanterix | 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 | Date |
ab40_analysis_date_fitbit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_analysis_date_fitbit.quanterix | 2023-04-24, 2023-04-25, 2023-04-26 | Date |
ab40_branch
Description :
Amyloid-beta40 concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_branch.quanterix | numeric | 0 | 249.0 |
ab40_cleaned_branch
Description :
Amyloid-beta40 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_cleaned_branch.quanterix | numeric | 0 | 249.0 |
ab40_cleaned_fitbit
Description :
Amyloid-beta40 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_cleaned_fitbit.quanterix | numeric | 0 | 194.0 |
ab40_cv_branch
Description :
Amyloid-beta40 coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_cv_branch.quanterix | numeric | 0 | 0.365 |
ab40_cv_fitbit
Description :
Amyloid-beta40 coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_cv_fitbit.quanterix | numeric | 0 | 1.139 |
ab40_fitbit
Description :
Amyloid-beta40 concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab40_fitbit.quanterix | numeric | 0 | 194.0 |
ab40_kit_lot_number_branch
Description :
Kit lot number BrANCH experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_kit_lot_number_branch.quanterix | 503819 | numeric |
ab40_kit_lot_number_fitbit
Description :
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_kit_lot_number_fitbit.quanterix | 503420 | numeric |
ab40_specimen_type_branch
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_specimen_type_branch.quanterix | plasma | character |
ab40_specimen_type_fitbit
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab40_specimen_type_fitbit.quanterix | plasma | character |
ab42_analysis_date_branch
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_analysis_date_branch.quanterix | 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 | Date |
ab42_analysis_date_fitbit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_analysis_date_fitbit.quanterix | 2023-04-24, 2023-04-25, 2023-04-26 | Date |
ab42_branch
Description :
Amyloid-beta42 concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_branch.quanterix | numeric | 0 | 17.800 |
ab42_cleaned_branch
Description :
Amyloid-beta42 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_cleaned_branch.quanterix | numeric | 0 | 17.800 |
ab42_cleaned_fitbit
Description :
Amyloid-beta42 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_cleaned_fitbit.quanterix | numeric | 0 | 11.40 |
ab42_cv_branch
Description :
Amyloid-beta42 coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_cv_branch.quanterix | numeric | 0 | 0.335 |
ab42_cv_fitbit
Description :
Amyloid-beta42 coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_cv_fitbit.quanterix | numeric | 0 | 1.221 |
ab42_fitbit
Description :
Amyloid-beta42 concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ab42_fitbit.quanterix | numeric | 0 | 11.40 |
ab42_kit_lot_number_branch
Description :
Kit lot number BrANCH experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_kit_lot_number_branch.quanterix | 503819 | character |
ab42_kit_lot_number_fitbit
Description :
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_kit_lot_number_fitbit.quanterix | 503420 | character |
ab42_specimen_type_branch
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_specimen_type_branch.quanterix | plasma | character |
ab42_specimen_type_fitbit
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ab42_specimen_type_fitbit.quanterix | plasma | character |
gfap_analysis_date_branch
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_analysis_date_branch.quanterix | 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 | Date |
gfap_analysis_date_fitbit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_analysis_date_fitbit.quanterix | 2023-04-24, 2023-04-25, 2023-04-26 | Date |
gfap_branch
Description :
GFAP concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_branch.quanterix | numeric | 0 | 743.0 |
gfap_cleaned_branch
Description :
GFAP concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cleaned_branch.quanterix | numeric | 0 | 743.0 |
gfap_cleaned_fitbit
Description :
GFAP concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cleaned_fitbit.quanterix | numeric | 0 | 682.0 |
gfap_cv_branch
Description :
GFAP coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cv_branch.quanterix | numeric | 0 | 0.458 |
gfap_cv_fitbit
Description :
GFAP coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_cv_fitbit.quanterix | numeric | 0 | 1.031 |
gfap_fitbit
Description :
GFAP concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| gfap_fitbit.quanterix | numeric | 0 | 682.0 |
gfap_kit_lot_number_branch
Description :
Kit lot number BrANCH experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_kit_lot_number_branch.quanterix | 503819 | character |
gfap_kit_lot_number_fitbit
Description :
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_kit_lot_number_fitbit.quanterix | 503420 | character |
gfap_specimen_type_branch
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_specimen_type_branch.quanterix | plasma | character |
gfap_specimen_type_fitbit
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| gfap_specimen_type_fitbit.quanterix | plasma | character |
nfl_analysis_date_branch
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_analysis_date_branch.quanterix | 2023-06-30, 2023-07-03, 2023-07-05, 2023-07-12, 2023-07-14 | Date |
nfl_analysis_date_fitbit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_analysis_date_fitbit.quanterix | 2023-04-24, 2023-04-25, 2023-04-26 | Date |
nfl_branch
Description :
NfL concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_branch.quanterix | numeric | 0 | 198.00 |
nfl_cleaned_branch
Description :
NfL concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cleaned_branch.quanterix | numeric | 0 | 198.00 |
nfl_cleaned_fitbit
Description :
NfL concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cleaned_fitbit.quanterix | numeric | 0 | 133.00 |
nfl_cv_branch
Description :
NfL coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cv_branch.quanterix | numeric | 0 | 0.536 |
nfl_cv_fitbit
Description :
NfL coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_cv_fitbit.quanterix | numeric | 0 | 1.126 |
nfl_fitbit
Description :
NfL concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| nfl_fitbit.quanterix | numeric | 0 | 133.00 |
nfl_kit_lot_number_branch
Description :
Kit lot number BrANCH experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_kit_lot_number_branch.quanterix | 503819 | character |
nfl_kit_lot_number_fitbit
Description :
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_kit_lot_number_fitbit.quanterix | 503420 | character |
nfl_specimen_type_branch
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_specimen_type_branch.quanterix | plasma | character |
nfl_specimen_type_fitbit
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| nfl_specimen_type_fitbit.quanterix | plasma | character |
ptau181_analysis_date_fitbit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptau181_analysis_date_fitbit.quanterix | 2023-04-03, 2023-04-04, 2023-04-05 | Date |
ptau181_branch
Description :
P-tau181 concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_branch.quanterix | numeric | 0 | 15.500 |
ptau181_cleaned_branch
Description :
P-tau181 concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_cleaned_branch.quanterix | numeric | 0 | 7.770 |
ptau181_cleaned_fitbit
Description :
P-tau181 concentration (pg/ml) with high cvs (>.20) removed [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_cleaned_fitbit.quanterix | numeric | 0 | 35.800 |
ptau181_cv_branch
Description :
P-tau181 coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_cv_branch.quanterix | numeric | 0 | 0.787 |
ptau181_cv_fitbit
Description :
P-tau181 coefficient of variation (cv) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_cv_fitbit.quanterix | numeric | 0 | 1.134 |
ptau181_fitbit
Description :
P-tau181 concentration (pg/ml) [Fitbit experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ptau181_fitbit.quanterix | numeric | 0 | 35.800 |
ptau181_kit_lot_number_fitbit
Description :
Kit lot number Fitbit experiment
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptau181_kit_lot_number_fitbit.quanterix | 503545 | character |
ptau181_specimen_type_branch
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptau181_specimen_type_branch.quanterix | plasma | character |
ptau181_specimen_type_fitbit
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ptau181_specimen_type_fitbit.quanterix | plasma | character |
ttau_branch
Description :
Total tau concentration (pg/ml) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ttau_branch.quanterix | numeric | 0 | 3.270 |
ttau_cleaned_branch
Description :
Total tau concentration (pg/ml) with high cvs (>.20) removed [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ttau_cleaned_branch.quanterix | numeric | 0 | 3.270 |
ttau_cv_branch
Description :
Total tau coefficient of variation (cv) [BrANCH experiment]
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ttau_cv_branch.quanterix | numeric | 0 | 0.854 |
ttau_specimen_type_branch
Description :
Specimen type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ttau_specimen_type_branch.quanterix | plasma | character |
sdoh
age
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| age.sdoh | numeric | 31 | 92 |
sdoh_date
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sdoh_date.sdoh | POSIXct | 2022-01-02 | 2023-02-13 |
sex
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sex.sdoh | Female, Male | character |
setshifting
Description :
Set Shifting is an NIH-EXAMINER task in which participants match a stimulus on the top of the screen to one of two stimuli in the lower corners of the screen. The screen on each trial contains a red triangle in the bottom left corner and a blue rectangle in the bottom right corner. At the beginning of each trial, a cue that reads “shape” or “color” appears at the bottom of the screen followed by a blue triangle stimulus or a red rectangle stimulus in the top-center of the screen. The examinee is then instructed to match the stimulus presented with one of the reference objects based on the cue provided.
References :
- Kramer, J. H., Mungas, D., Possin, K. L., Rankin, K. P., Boxer, A. L., Rosen, H. J., Bostrom, A., Sinha, L., Berhel, A., & Widmeyer, M. (2014). NIH EXAMINER: conceptualization and development of an executive function battery. Journal of the International Neuropsychological Society : JINS, 20(1), 11–19. https://doi.org/10.1017/S1355617713001094
platform
Description :
Computer program that NIH-EXAMINER Set Shifting is run on (E-Prime)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| platform.setshifting | E-Prime | character |
shftlog
Description :
Log 10 of the mean response time of the correct shift block trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shftlog.setshifting | numeric | 2.602 | 3.431 |
shftstem
Description :
Measure of reaction time after log transformations/calculations
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shftstem.setshifting | numeric | 0.002 | -0.093 |
shiftacc
Description :
Measure of accuracy calculated as # of correct trials / # of total trials in the shift block
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shiftacc.setshifting | numeric | 0.313 | 1.000 |
shiftaccscore
Description :
Accuracy score = shiftacc.setshifting multiplied by 5
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shiftaccscore.setshifting | numeric | 1.563 | 5.000 |
shiftrtscore
Description :
Reaction time score = 5 - (shftstem.setshifting multiplied by 5)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shiftrtscore.setshifting | numeric | 0.004 | -2.055 |
shiftscore
Description :
A calcuated composite score that combines accuracy and reaction time scores
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| shiftscore.setshifting | numeric | 1.076 | 10.184 |
sex_and_reproductive_health
sexQ_ageatlastperiod
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sexQ_ageatlastperiod.sex_and_reproductive_health | numeric | 32.0 | 70.0 |
sexQ_birthcontrol_currently_years
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_birthcontrol_currently_years.sex_and_reproductive_health | 34 | numeric |
sexQ_birthcontrol_currently
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_birthcontrol_currently.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_children_ageatfirstchild
| Variable Name | Type |
|---|---|
| sexQ_children_ageatfirstchild.sex_and_reproductive_health | character |
sexQ_children_ageatlastchild
| Variable Name | Type |
|---|---|
| sexQ_children_ageatlastchild.sex_and_reproductive_health | character |
sexQ_children_number
| Variable Name | Type |
|---|---|
| sexQ_children_number.sex_and_reproductive_health | numeric |
sexQ_everpregnant
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_everpregnant.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_facialhairgrowth
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_facialhairgrowth.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_fertilitytreatments_type_other
| Variable Name | Type |
|---|---|
| sexQ_fertilitytreatments_type_other.sex_and_reproductive_health | character |
sexQ_fertilitytreatments_type
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_fertilitytreatments_type.sex_and_reproductive_health | 1, 2, 3 | numeric |
sexQ_fertilitytreatments
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_fertilitytreatments.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_firstperiodage
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sexQ_firstperiodage.sex_and_reproductive_health | numeric | 9.0 | 17.0 |
sexQ_gender
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_gender.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_hormonalbirthcontrol_everused
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_hormonalbirthcontrol_everused.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_hormonalbirthcontrol_yearsused
| Variable Name | Type |
|---|---|
| sexQ_hormonalbirthcontrol_yearsused.sex_and_reproductive_health | character |
sexQ_hormonetherapy_currently_length
| Variable Name | Type |
|---|---|
| sexQ_hormonetherapy_currently_length.sex_and_reproductive_health | character |
sexQ_hormonetherapy_length
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_hormonetherapy_length.sex_and_reproductive_health | 1, 3, 4, 5 | numeric |
sexQ_hormonetherapy_why_other
| Variable Name | Type |
|---|---|
| sexQ_hormonetherapy_why_other.sex_and_reproductive_health | character |
sexQ_hormonetherapy_why
| Variable Name | Type |
|---|---|
| sexQ_hormonetherapy_why.sex_and_reproductive_health | numeric |
sexQ_hormonetherapy
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_hormonetherapy.sex_and_reproductive_health | 1, 2, 4 | numeric |
sexQ_hysterectomyremoval_age
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sexQ_hysterectomyremoval_age.sex_and_reproductive_health | numeric | 32.0 | 77.0 |
sexQ_hysterectomyremoval
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_hysterectomyremoval.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_menstrualpattern
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_menstrualpattern.sex_and_reproductive_health | 1, 2, 3 | numeric |
sexQ_ovaryremoval_age
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sexQ_ovaryremoval_age.sex_and_reproductive_health | numeric | 21.0 | 77.0 |
sexQ_ovaryremoval
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_ovaryremoval.sex_and_reproductive_health | 1, 2, 3, 4 | numeric |
sexQ_PCOS_endometriosis_infertility
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_PCOS_endometriosis_infertility.sex_and_reproductive_health | 1, 2, 3, 13, 23 | numeric |
sexQ_periodregular
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_periodregular.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_pregnancies_firsttrimester
| Variable Name | Type |
|---|---|
| sexQ_pregnancies_firsttrimester.sex_and_reproductive_health | numeric |
sexQ_pregnancies_secondtrimester
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_pregnancies_secondtrimester.sex_and_reproductive_health | 0, 1, 2, 10 | numeric |
sexQ_pregnancies_thirdtrimester
| Variable Name | Type |
|---|---|
| sexQ_pregnancies_thirdtrimester.sex_and_reproductive_health | numeric |
sexQ_sex
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_sex.sex_and_reproductive_health | 1, 2 | numeric |
sexQ_sexorientation_other
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_sexorientation_other.sex_and_reproductive_health | Pansexual | character |
sexQ_sexorientation
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_sexorientation.sex_and_reproductive_health | 1, 2, 3, 4 | numeric |
sexQ_stillmenstruating_lastmenses
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_stillmenstruating_lastmenses.sex_and_reproductive_health | 1/1/2020, 4/6/2020, 8/23/1984 | character |
sexQ_stillmenstruating_periodfreq
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_stillmenstruating_periodfreq.sex_and_reproductive_health | 2 | numeric |
sexQ_stillmenstruating_regularperiods
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_stillmenstruating_regularperiods.sex_and_reproductive_health | 2 | numeric |
sexQ_stillmenstruating
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sexQ_stillmenstruating.sex_and_reproductive_health | 4, 5 | numeric |
sleep_instruments
Description :
Sleep Intruments include different questionnaires that participants enrolled in the Sleep Project at UCSF asnwer during the 7 day study. These questionnaires include the Circadian Type Inventory, Functional Outcomes of Sleep Questionnaire, Morningness Evening Type, and the Sleep Preoccupation Scale.
bmi
Description :
BMI captured from the Berlin Sleep Questionnaire
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| bmi.sleep_instruments | numeric | 17.00000 | 41.00000 |
cti_fr
Description :
Circadian type inventory - high scores = fluidity/ low scores = rigidity
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cti_fr.sleep_instruments | numeric | 5 | 21 |
cti_lv
Description :
Circadian type inventory - high scores = languid/ low scores = vigorous
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cti_lv.sleep_instruments | numeric | 6 | 24 |
fosq_activity_level
Description :
functional outcomes of sleep: affect on activity levels
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_activity_level.sleep_instruments | numeric | 1.166667 | 4.000000 |
fosq_general_productivity
Description :
functional outcomes of sleep: affect on productivity levels
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_general_productivity.sleep_instruments | numeric | 1.125000 | 4.000000 |
fosq_intimate_rels_sexual_activity
Description :
functional outcomes of sleep: affect on sexual relationships
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_intimate_rels_sexual_activity.sleep_instruments | numeric | 0.000000 | 5.333333 |
fosq_total
Description :
functional outcomes of sleep total score (high score= better function, low scores = worse function)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_total.sleep_instruments | numeric | 8.646825 | 26.000000 |
fosq_vigilance
Description :
functional outcomes of sleep: affect on vigilance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fosq_vigilance.sleep_instruments | numeric | 1.000000 | 10.000000 |
meq_morn_total
Description :
morningness eveningness questionnaire total score
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| meq_morn_total.sleep_instruments | numeric | 22.00 | 81.00 |
meq_score
Description :
morningness eveningness type ( 0 = neither type, 1 = morning type, 3 = evening type)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| meq_score.sleep_instruments | 0, 1, 2 | numeric |
sps_ac
Description :
sleep preoccupation scale - affective consequences
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sps_ac.sleep_instruments | numeric | 7 | 39 |
sps_cbc
Description :
sleep preoccupation scale - cognitive and behavioral consequences
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sps_cbc.sleep_instruments | numeric | 14 | 62 |
sps_total
Description :
sleep preoccupation scale total (high scores = more preoccupation, low scores = low preoccupation)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sps_total.sleep_instruments | numeric | 33 | 127 |
sleep_profiler
Description :
The Sleep Profiler provides detailed information on rapid eye movement, the percentage of sleep you get overall and other aspects of sleep quality.
References :
- Levendowski, D., Walsh, C., Boeve, B., Lee-Iannotti, J., Salat, D., Hamilton, J., … & Louis, E. S. (2022). 0269 Non-REM sleep Hypertonia in Parkinsonian-Spectrum Disorders. Sleep, 45(Supplement_1), A121-A122.
actual_sleep_time_hrs_night_1
Description :
Total time spent in sleep stages across the first night
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| actual_sleep_time_hrs_night_1.sleep_profiler | numeric | 3.541667 | 8.775000 |
actual_sleep_time_hrs_night_2
Description :
Total time spent in sleep stages across the second night
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| actual_sleep_time_hrs_night_2.sleep_profiler | numeric | 3.541667 | 9.008333 |
actual_sleep_time_hrs_night_3
Description :
Total time spent in sleep stages across the third night
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| actual_sleep_time_hrs_night_3.sleep_profiler | numeric | 2.975000 | 8.316667 |
actual_sleep_time_hrs_night_4
Description :
Total time spent in sleep stages across the fourth night
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| actual_sleep_time_hrs_night_4.sleep_profiler | 4.066667, 6.166667, 6.291667, 6.600000, 7.516667 | numeric |
actual_sleep_time_hrs_night_5
Description :
Total time spent in sleep stages across the fifth night
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| actual_sleep_time_hrs_night_5.sleep_profiler | 3.966667, 4.333333, 9.616667 | numeric |
actual_sleep_time_hrs_night_6
Description :
Total time spent in sleep stages across the sixth night
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| actual_sleep_time_hrs_night_6.sleep_profiler | 6.016667 | numeric |
invalid_time_hrs_night_1
Description :
Invalid sleep time during night 1(not used to calculate summary variables)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| invalid_time_hrs_night_1.sleep_profiler | numeric | 0.000000000 | 3.408333000 |
invalid_time_hrs_night_2
Description :
Invalid sleep time during night 2(not used to calculate summary variables)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| invalid_time_hrs_night_2.sleep_profiler | numeric | 0.000000000 | 4.491667000 |
invalid_time_hrs_night_3
Description :
Invalid sleep time during night 3(not used to calculate summary variables)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| invalid_time_hrs_night_3.sleep_profiler | numeric | 0.000000000 | 4.666667000 |
invalid_time_hrs_night_4
Description :
Invalid sleep time during night 4(not used to calculate summary variables)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| invalid_time_hrs_night_4.sleep_profiler | 0.00000000, 0.03333334, 0.16666670 | numeric |
invalid_time_hrs_night_5
Description :
Invalid sleep time during night 5(not used to calculate summary variables)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| invalid_time_hrs_night_5.sleep_profiler | 0.000000, 2.841667 | numeric |
invalid_time_hrs_night_6
Description :
Invalid sleep time during night 6(not used to calculate summary variables)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| invalid_time_hrs_night_6.sleep_profiler | 0.01666667 | numeric |
n1_delta_night_1
Description :
Average delta power duing N1 epochs on night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_delta_night_1.sleep_profiler | numeric | 0.08240977 | 0.99258361 |
n1_delta_night_2
Description :
Average delta power duing N1 epochs on night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_delta_night_2.sleep_profiler | numeric | 0.09493082 | 0.66833355 |
n1_delta_night_3
Description :
Average delta power duing N1 epochs on night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_delta_night_3.sleep_profiler | numeric | 0.08832198 | 0.85857893 |
n1_delta_night_4
Description :
Average delta power duing N1 epochs on night 4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_delta_night_4.sleep_profiler | 0.1049325, 0.1298847, 0.1374232, 0.1520938, 0.1643450 | numeric |
n1_delta_night_5
Description :
Average delta power duing N1 epochs on night 5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_delta_night_5.sleep_profiler | 0.1550275, 0.1909848, 0.2064550 | numeric |
n1_delta_night_6
Description :
Average delta power duing N1 epochs on night 6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_delta_night_6.sleep_profiler | 0.1335652 | numeric |
n1_time_hrs_night_1
Description :
Time spent in N1 sleep (light sleep) across the night during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_time_hrs_night_1.sleep_profiler | numeric | 0.05833333 | 0.70833330 |
n1_time_hrs_night_2
Description :
Time spent in N1 sleep (light sleep) across the night during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_time_hrs_night_2.sleep_profiler | numeric | 0.05833333 | 1.20833300 |
n1_time_hrs_night_3
Description :
Time spent in N1 sleep (light sleep) across the night during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n1_time_hrs_night_3.sleep_profiler | numeric | 0.05000000 | 1.35000000 |
n1_time_hrs_night_4
Description :
Time spent in N1 sleep (light sleep) across the night during night 4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_time_hrs_night_4.sleep_profiler | 0.1583333, 0.1750000, 0.2083333, 0.5250000 | numeric |
n1_time_hrs_night_5
Description :
Time spent in N1 sleep (light sleep) across the night during night 5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_time_hrs_night_5.sleep_profiler | 0.1833333, 0.1916667, 0.3750000 | numeric |
n1_time_hrs_night_6
Description :
Time spent in N1 sleep (light sleep) across the night during night 6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n1_time_hrs_night_6.sleep_profiler | 0.1416667 | numeric |
n2_delta_night_1
Description :
Average delta power duing N2 epochs during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_delta_night_1.sleep_profiler | numeric | 0.1048906 | 0.8912354 |
n2_delta_night_2
Description :
Average delta power duing N2 epochs during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_delta_night_2.sleep_profiler | numeric | 0.1041672 | 0.3071150 |
n2_delta_night_3
Description :
Average delta power duing N2 epochs during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_delta_night_3.sleep_profiler | numeric | 0.1107100 | 0.9062055 |
n2_delta_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_delta_night_4.sleep_profiler | 0.1314645, 0.1476429, 0.1476847, 0.1533604, 0.3593146 | numeric |
n2_delta_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_delta_night_5.sleep_profiler | 0.1352762, 0.1682801, 0.1762796 | numeric |
n2_delta_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_delta_night_6.sleep_profiler | 0.1431319 | numeric |
n2_time_hrs_night_1
Description :
Time spent in N2 sleep across the night during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_time_hrs_night_1.sleep_profiler | numeric | 1.208333 | 5.550000 |
n2_time_hrs_night_2
Description :
Time spent in N2 sleep across the night during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_time_hrs_night_2.sleep_profiler | numeric | 1.166667 | 5.516667 |
n2_time_hrs_night_3
Description :
Time spent in N2 sleep across the night during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n2_time_hrs_night_3.sleep_profiler | numeric | 0.625000 | 5.291667 |
n2_time_hrs_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_time_hrs_night_4.sleep_profiler | 1.550000, 3.000000, 3.508333, 3.516667, 4.641667 | numeric |
n2_time_hrs_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_time_hrs_night_5.sleep_profiler | 1.350000, 3.666667, 5.375000 | numeric |
n2_time_hrs_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n2_time_hrs_night_6.sleep_profiler | 3.466667 | numeric |
n3_delta_night_1
Description :
Average delta power duing N3 epochs during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_delta_night_1.sleep_profiler | numeric | 0.1546968 | 0.9048144 |
n3_delta_night_2
Description :
Average delta power duing N3 epochs during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_delta_night_2.sleep_profiler | numeric | 0.1271705 | 0.3579841 |
n3_delta_night_3
Description :
Average delta power duing N3 epochs during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_delta_night_3.sleep_profiler | numeric | 0.1503306 | 0.4133622 |
n3_delta_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_delta_night_4.sleep_profiler | 0.1748096, 0.2030818, 0.2121810, 0.2125902, 0.2272466 | numeric |
n3_delta_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_delta_night_5.sleep_profiler | 0.1595341, 0.2050501, 0.2423254 | numeric |
n3_delta_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_delta_night_6.sleep_profiler | 0.1834426 | numeric |
n3_time_hrs_night_1
Description :
Time spent in N3 sleep (SWS sleep) across the night during night 1
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_time_hrs_night_1.sleep_profiler | numeric | 0.000000000 | 3.025000000 |
n3_time_hrs_night_2
Description :
Time spent in N3 sleep (SWS sleep) across the night during night 2
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_time_hrs_night_2.sleep_profiler | numeric | 0.00000000 | 4.21666700 |
n3_time_hrs_night_3
Description :
Time spent in N3 sleep (SWS sleep) across the night during night 3
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| n3_time_hrs_night_3.sleep_profiler | numeric | 0.000000000 | 3.500000000 |
n3_time_hrs_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_time_hrs_night_4.sleep_profiler | 0.4583333, 0.4750000, 0.9250000, 1.4250000, 1.9583330 | numeric |
n3_time_hrs_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_time_hrs_night_5.sleep_profiler | 0.008333334, 0.358333300, 1.200000000 | numeric |
n3_time_hrs_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| n3_time_hrs_night_6.sleep_profiler | 0.25 | numeric |
percent_night_in_n1_night_1
Description :
Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n1_night_1.sleep_profiler | numeric | 1.136364 | 20.000000 |
percent_night_in_n1_night_2
Description :
Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n1_night_2.sleep_profiler | numeric | 0.7667032 | 29.7741300 |
percent_night_in_n1_night_3
Description :
Hours of valid stage 1 sleep divided by hours of actual sleep time x 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n1_night_3.sleep_profiler | numeric | 0.6993007 | 25.1141500 |
percent_night_in_n1_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n1_night_4.sleep_profiler | 2.328160, 3.156566, 3.378378, 3.893443, 8.344371 | numeric |
percent_night_in_n1_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n1_night_5.sleep_profiler | 3.899480, 4.423077, 4.621849 | numeric |
percent_night_in_n1_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n1_night_6.sleep_profiler | 2.354571 | numeric |
percent_night_in_n2_night_1
Description :
Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n2_night_1.sleep_profiler | numeric | 25.43860 | 81.27208 |
percent_night_in_n2_night_2
Description :
Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n2_night_2.sleep_profiler | numeric | 19.70398 | 75.33113 |
percent_night_in_n2_night_3
Description :
Hours of valid stage 2 sleep divided by hours of actual sleep time x 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n2_night_3.sleep_profiler | numeric | 15.36885 | 76.76399 |
percent_night_in_n2_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n2_night_4.sleep_profiler | 38.11475, 48.64865, 53.28283, 55.76159, 61.75166 | numeric |
percent_night_in_n2_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n2_night_5.sleep_profiler | 34.03362, 55.89255, 84.61539 | numeric |
percent_night_in_n2_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n2_night_6.sleep_profiler | 57.61773 | numeric |
percent_night_in_n3_night_1
Description :
Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n3_night_1.sleep_profiler | numeric | 0.0000000 | 50.0000000 |
percent_night_in_n3_night_2
Description :
Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n3_night_2.sleep_profiler | numeric | 0.0000000 | 55.6742300 |
percent_night_in_n3_night_3
Description :
Hours of valid stage 3 sleep divided by hours of actual sleep time x 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_n3_night_3.sleep_profiler | numeric | 0.0000000 | 67.6229600 |
percent_night_in_n3_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n3_night_4.sleep_profiler | 6.097561, 7.549669, 14.015150, 31.756760, 35.040980 | numeric |
percent_night_in_n3_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n3_night_5.sleep_profiler | 0.1923077, 3.7261700, 30.2521000 | numeric |
percent_night_in_n3_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_n3_night_6.sleep_profiler | 4.155125 | numeric |
percent_night_in_rem_night_1
Description :
Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_rem_night_1.sleep_profiler | numeric | 12.59398 | 39.68254 |
percent_night_in_rem_night_2
Description :
Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_rem_night_2.sleep_profiler | numeric | 6.361829 | 42.214530 |
percent_night_in_rem_night_3
Description :
Hours of valid REM sleep divided by hours of actual sleep time x 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| percent_night_in_rem_night_3.sleep_profiler | numeric | 13.44538 | 45.89041 |
percent_night_in_rem_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_rem_night_4.sleep_profiler | 16.21622, 22.95082, 28.34437, 29.41919, 29.82261 | numeric |
percent_night_in_rem_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_rem_night_5.sleep_profiler | 10.76923, 31.09244, 36.48180 | numeric |
percent_night_in_rem_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| percent_night_in_rem_night_6.sleep_profiler | 35.87257 | numeric |
rem_delta_night_1
Description :
Average delta power duing REM epochs (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_delta_night_1.sleep_profiler | numeric | 0.08191241 | 0.67787162 |
rem_delta_night_2
Description :
Average delta power duing REM epochs (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_delta_night_2.sleep_profiler | numeric | 0.08790630 | 0.30564024 |
rem_delta_night_3
Description :
Average delta power duing REM epochs (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_delta_night_3.sleep_profiler | numeric | 0.07753680 | 0.89780582 |
rem_delta_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_delta_night_4.sleep_profiler | 0.1151842, 0.1241935, 0.1433784, 0.1553233, 0.5109914 | numeric |
rem_delta_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_delta_night_5.sleep_profiler | 0.1142421, 0.1540582, 0.1652997 | numeric |
rem_delta_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_delta_night_6.sleep_profiler | 0.1398343 | numeric |
rem_time_hrs_night_1
Description :
Time spent in REM sleep across the night (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_time_hrs_night_1.sleep_profiler | numeric | 0.5583333 | 2.5000000 |
rem_time_hrs_night_2
Description :
Time spent in REM sleep across the night (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_time_hrs_night_2.sleep_profiler | numeric | 0.2666667 | 2.7833330 |
rem_time_hrs_night_3
Description :
Time spent in REM sleep across the night (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rem_time_hrs_night_3.sleep_profiler | numeric | 0.4000000 | 2.5583330 |
rem_time_hrs_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_time_hrs_night_4.sleep_profiler | 0.9333333, 1.0000000, 1.7833330, 1.9416670, 2.2416670 | numeric |
rem_time_hrs_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_time_hrs_night_5.sleep_profiler | 0.4666667, 1.2333330, 3.5083330 | numeric |
rem_time_hrs_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rem_time_hrs_night_6.sleep_profiler | 2.158333 | numeric |
sleep_efficiency_percent_night_1
Description :
Actual sleep time divided by Time In Bed X 100 (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_efficiency_percent_night_1.sleep_profiler | numeric | 33.65004 | 96.04366 |
sleep_efficiency_percent_night_2
Description :
Actual sleep time divided by Time In Bed X 100 (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_efficiency_percent_night_2.sleep_profiler | numeric | 42.01898 | 97.86781 |
sleep_efficiency_percent_night_3
Description :
Actual sleep time divided by Time In Bed X 100 (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_efficiency_percent_night_3.sleep_profiler | numeric | 41.91388 | 96.90844 |
sleep_efficiency_percent_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_efficiency_percent_night_4.sleep_profiler | 54.16204, 66.51982, 71.98444, 82.75862, 85.25520 | numeric |
sleep_efficiency_percent_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_efficiency_percent_night_5.sleep_profiler | 63.29787, 77.38096, 80.19458 | numeric |
sleep_efficiency_percent_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_efficiency_percent_night_6.sleep_profiler | 76.89031 | numeric |
sleep_latency_mins_night_1
Description :
Minutes required to fall asleep (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_latency_mins_night_1.sleep_profiler | numeric | 1 | 175 |
sleep_latency_mins_night_2
Description :
Minutes required to fall asleep (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_latency_mins_night_2.sleep_profiler | numeric | 2 | 69 |
sleep_latency_mins_night_3
Description :
Minutes required to fall asleep (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sleep_latency_mins_night_3.sleep_profiler | numeric | 1 | 115 |
sleep_latency_mins_night_4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_latency_mins_night_4.sleep_profiler | 7, 9, 11, 19, 23 | numeric |
sleep_latency_mins_night_5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_latency_mins_night_5.sleep_profiler | 9, 16 | numeric |
sleep_latency_mins_night_6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| sleep_latency_mins_night_6.sleep_profiler | 34 | numeric |
startdate
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| startdate.sleep_profiler | Date | 2018-08-28 | 2022-11-14 |
time_in_bed_hrs_night_1
Description :
Time spent in bed from start of recording to end of recording (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| time_in_bed_hrs_night_1.sleep_profiler | numeric | 5.200000 | 11.025000 |
time_in_bed_hrs_night_2
Description :
Time spent in bed from start of recording to end of recording (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| time_in_bed_hrs_night_2.sleep_profiler | numeric | 6.075000 | 11.996390 |
time_in_bed_hrs_night_3
Description :
Time spent in bed from start of recording to end of recording (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| time_in_bed_hrs_night_3.sleep_profiler | numeric | 4.675000 | 11.996390 |
time_in_bed_hrs_night_4
Description :
Time spent in bed from start of recording to end of recording (Night 4)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| time_in_bed_hrs_night_4.sleep_profiler | 7.508333, 7.975000, 8.566667, 8.816667, 9.460834 | numeric |
time_in_bed_hrs_night_5
Description :
Time spent in bed from start of recording to end of recording (Night 5)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| time_in_bed_hrs_night_5.sleep_profiler | 5.600000, 6.266667, 11.991670 | numeric |
time_in_bed_hrs_night_6
Description :
Time spent in bed from start of recording to end of recording (Night 6)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| time_in_bed_hrs_night_6.sleep_profiler | 7.825 | numeric |
wake_after_sleep_onset_mins_night_1
Description :
Total minutes the participant was awake after sleep onset until the end of the recording (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_after_sleep_onset_mins_night_1.sleep_profiler | numeric | 11 | 320 |
wake_after_sleep_onset_mins_night_2
Description :
Total minutes the participant was awake after sleep onset until the end of the recording (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_after_sleep_onset_mins_night_2.sleep_profiler | numeric | 8 | 291 |
wake_after_sleep_onset_mins_night_3
Description :
Total minutes the participant was awake after sleep onset until the end of the recording (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_after_sleep_onset_mins_night_3.sleep_profiler | numeric | 10 | 258 |
wake_after_sleep_onset_mins_night_4
Description :
Total minutes the participant was awake after sleep onset until the end of the recording (Night 4)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_after_sleep_onset_mins_night_4.sleep_profiler | 59, 69, 136, 167, 199 | numeric |
wake_after_sleep_onset_mins_night_5
Description :
Total minutes the participant was awake after sleep onset until the end of the recording (Night 5)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_after_sleep_onset_mins_night_5.sleep_profiler | 66, 121, 128 | numeric |
wake_after_sleep_onset_mins_night_6
Description :
Total minutes the participant was awake after sleep onset until the end of the recording (Night 6)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_after_sleep_onset_mins_night_6.sleep_profiler | 72 | numeric |
wake_delta_night_1
Description :
Average delta power during wake epochs (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_delta_night_1.sleep_profiler | numeric | 0.09730534 | 0.68893232 |
wake_delta_night_2
Description :
Average delta power during wake epochs (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_delta_night_2.sleep_profiler | numeric | 0.1234879 | 0.4058309 |
wake_delta_night_3
Description :
Average delta power during wake epochs (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_delta_night_3.sleep_profiler | numeric | 0.1280672 | 0.5426953 |
wake_delta_night_4
Description :
Average delta power during wake epochs (Night 4)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_delta_night_4.sleep_profiler | 0.1583221, 0.1711860, 0.1944113, 0.1977259, 0.2189980 | numeric |
wake_delta_night_5
Description :
Average delta power during wake epochs (Night 5)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_delta_night_5.sleep_profiler | 0.1749399, 0.1808890, 0.2453625 | numeric |
wake_delta_night_6
Description :
Average delta power during wake epochs (Night 6)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_delta_night_6.sleep_profiler | 0.2022863 | numeric |
wake_time_hrs_night_1
Description :
Time spent awake during the night (Night 1)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_time_hrs_night_1.sleep_profiler | numeric | 0.2416667 | 7.2416670 |
wake_time_hrs_night_2
Description :
Time spent awake during the night (Night 2)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_time_hrs_night_2.sleep_profiler | numeric | 0.1666667 | 5.6000000 |
wake_time_hrs_night_3
Description :
Time spent awake during the night (Night 3)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wake_time_hrs_night_3.sleep_profiler | numeric | 0.2166667 | 5.0583330 |
wake_time_hrs_night_4
Description :
Time spent awake during the night (Night 4)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_time_hrs_night_4.sleep_profiler | 1.300000, 1.375000, 2.400000, 3.166667, 3.441667 | numeric |
wake_time_hrs_night_5
Description :
Time spent awake during the night (Night 5)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_time_hrs_night_5.sleep_profiler | 1.266667, 2.300000, 2.375000 | numeric |
wake_time_hrs_night_6
Description :
Time spent awake during the night (Night 6)
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| wake_time_hrs_night_6.sleep_profiler | 1.808333 | numeric |
specimens
sample_id
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| sample_id.specimens | numeric | 329777 | 4077971 |
tabcat_animal_fluency
Description :
Animal Fluency is a widely used test of language generation. Examinees are asked to generate as many animals as possible in 1 minute, and the total correct is recorded.
References :
- Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.
animal_fluency_task_language
Description :
Language of administration
| Label | Value |
|---|---|
| English | English |
| Mandarin | Mandarin |
| Spanish-MEX | Spanish-MEX |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| animal_fluency_task_language.tabcat_animal_fluency | English, Mandarin, Spanish-MEX | character | English, Mandarin, Spanish-MEX |
animal_fluency_task_version
Description :
TabCAT version
| Label | Value |
|---|---|
| 1.0.0 | 1.0.0 |
| 3.0.0 | 3.0.0 |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| animal_fluency_task_version.tabcat_animal_fluency | 1.0.0, 3.0.0 | character | 1.0.0, 3.0.0 |
animal_fluency_total_correct_z
Description :
Z-score adjusted for age, sex, education
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| animal_fluency_total_correct_z.tabcat_animal_fluency | 22 | numeric |
animal_fluency_total_correct
Description :
Number of animals generated in 60-seconds
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| animal_fluency_total_correct.tabcat_animal_fluency | 10, 18, 22, 23, 24 | numeric |
animal_fluency_total_repetitions
Description :
Number of repetition errors
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| animal_fluency_total_repetitions.tabcat_animal_fluency | 0, 1, 2, 3, 4 | numeric |
animal_fluency_total_rule_violations
Description :
Number of rule violation errors
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| animal_fluency_total_rule_violations.tabcat_animal_fluency | 0, 1 | numeric |
tabcat_bha
Description :
The Brain Health Assessment (BHA) battery includes two required tests (Favorites, Match), two optional tests (Line Orientation, Animal Fluency), and an optional informant survey (Brain Health Survey [BHS]). The battery is optimized for the accurate detection of MCI and mild dementia, reliably measures change over time, and provides a performance sample from each major cognitive domain.
References :
Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.
Tsoy E, Erlhoff SJ, Goode CA, Dorsman KA, Kanjanapong S, Lindbergh CA, La Joie R, Strom A, Rabinovici GD, Lanata SC, Miller BL, Tomaszewski Farias SE, Kramer JH, Rankin KP, Possin KL. BHA-CS: A novel cognitive composite for Alzheimer’s disease and related disorders. Alzheimers Dement (Amst). 2020 Jun 21;12(1):e12042. doi: 10.1002/dad2.12042. PMID: 32582835; PMCID: PMC7306517.
dont_worry_abt_col_names:
- Moskowitz, T., Rabinowitz, N., Johnson, E., Huey, E., Kaufer, D., Small, G., … & Possin, K. (2016). The TabCAT brain health assessment: a highly efficient and sensitive approach to detecting very mild cognitive impairment (P5. 197). Neurology, 86(16_supplement), P5-197.
composite_bha_cs_short
Description :
a composite score combining results of only the two TabCAT required tests (Favorites, Match), calulated as: BHA CS-Short = ((1.753 + 0.946FavRegZ + 0.995MatRegZ) - 1.751)/1.509, where FavRegZ is the demographically adjusted regression-based z-score for Favorites Total Recall and MatRegZ is the demographically adjusted regression-based z-score for Match Total Correct
| Variable Name | Type |
|---|---|
| composite_bha_cs_short.tabcat_bha | numeric |
tabcat_fav
Description :
Favorites is a test of multimodal associative memory for visual and verbal information in which examinees are asked to remember faces paired with a food and animal word. The task consists of 2 Learning Trials, each followed by an Immediate Recall Trial, and a 10-minute Delayed Recall and Delayed Recognition trials.
References :
- Thompson, L. I., Kunicki, Z. J., Emrani, S., Strenger, J., De Vito, A. N., Britton, K. J., … & Jones, R. N. (2023). Remote and in‐clinic digital cognitive screening tools outperform the MoCA to distinguish cerebral amyloid status among cognitively healthy older adults. Alzheimer’s & Dementia: Diagnosis, Assessment & Disease Monitoring, 15(4), e12500.
fav_delay_total_correct_z
Description :
Z-score of the total number of correct responses
| Variable Name | Type |
|---|---|
| fav_delay_total_correct_z.tabcat_fav | numeric |
fav_delay_total_correct
Description :
total number of correct responses given
| Variable Name | Type |
|---|---|
| fav_delay_total_correct.tabcat_fav | numeric |
fav_delay_total_dk
Description :
total number of “DK”: don’t know, where the examinee did not give a response
| Variable Name | Type |
|---|---|
| fav_delay_total_dk.tabcat_fav | numeric |
fav_delay_total_intrusions
Description :
total number of “INT”: intrusion, where the response given was not presented during the trial
| Variable Name | Type |
|---|---|
| fav_delay_total_intrusions.tabcat_fav | numeric |
fav_delay_total_sme
Description :
total number of “SME”: source memory error, where the response given was incorrectly matched
| Variable Name | Type |
|---|---|
| fav_delay_total_sme.tabcat_fav | numeric |
fav_learn_r1_animal1score
Description :
Recall 1 Animal 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_animal1score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r1_animal2score
Description :
Recall 1 Animal 2 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_animal2score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r1_animal3score
Description :
Recall 1 Animal 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_animal3score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r1_animal4score
Description :
Recall 1 Animal 4 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_animal4score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r1_food1score
Description :
Recall 1 Food 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_food1score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r1_food2score
Description :
Recall 1 Food 2 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_food2score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r1_food3score
Description :
Recall 1 Food 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_food3score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r1_food4score
Description :
Recall 1 Food 4 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r1_food4score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r1_total_correct_z
Description :
Z-score of total number of correct responses across Recall 1
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_correct_z.tabcat_fav | numeric |
fav_learn_r1_total_correct
Description :
Total number of correct responses across Recall 1
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_correct.tabcat_fav | numeric |
fav_learn_r1_total_dk
Description :
Total number of Don’t Know responses across Recall 1, i.e., giving no response
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_dk.tabcat_fav | numeric |
fav_learn_r1_total_intrusions
Description :
Total number of Intrusion responses across Recall 1, i.e., giving a food/animal that was not presented during the trial
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_intrusions.tabcat_fav | numeric |
fav_learn_r1_total_sme
Description :
Total number of SME responses across Recall 1, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face
| Variable Name | Type |
|---|---|
| fav_learn_r1_total_sme.tabcat_fav | numeric |
fav_learn_r2_animal1score
Description :
Recall 2 Animal 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_animal1score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r2_animal2score
Description :
Recall 2 Animal 2 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_animal2score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r2_animal3score
Description :
Recall 2 Animal 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_animal3score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r2_animal4score
Description :
Recall 2 Animal 4 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_animal4score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r2_food1score
Description :
Recall 2 Food 1 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_food1score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r2_food2score
Description :
Recall 2 Food 2 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_food2score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r2_food3score
Description :
Recall 2 Food 3 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_food3score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r2_food4score
Description :
Recall 2 Food 4 score
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_r2_food4score.tabcat_fav | correct, DK, INT, SME | character |
fav_learn_r2_total_correct_z
Description :
Z-score of total number of correct responses across Recall 2
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_correct_z.tabcat_fav | numeric |
fav_learn_r2_total_correct
Description :
Total number of correct responses across Recall 2
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_correct.tabcat_fav | numeric |
fav_learn_r2_total_dk
Description :
Total number of Don’t Know responses across Recall 2, i.e., giving no response
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_dk.tabcat_fav | numeric |
fav_learn_r2_total_intrusions
Description :
Total number of Intrusion responses across Recall 2, i.e., giving a food/animal that was not presented during the trial
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_intrusions.tabcat_fav | numeric |
fav_learn_r2_total_sme
Description :
Total number of SME responses across Recall 2, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face
| Variable Name | Type |
|---|---|
| fav_learn_r2_total_sme.tabcat_fav | numeric |
fav_learn_task_duration
Description :
Total amount of time spent on the learning tasks, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_learn_task_duration.tabcat_fav | numeric | 0 | Infinity |
fav_learn_task_form
Description :
The task form chosen
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_task_form.tabcat_fav | A, B, C, D | character |
fav_learn_task_language
Description :
Testing language used during the task
| Variable Name | Type |
|---|---|
| fav_learn_task_language.tabcat_fav | character |
fav_learn_task_version
Description :
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_learn_task_version.tabcat_fav | 1.0.0, 3.0.0 | character |
fav_rec_bias
Description :
Score that reflects the response bias across all Favorites Recognition trials. Higher scores reflect worse performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_bias.tabcat_fav | numeric | (-) Infinity | Infinity |
fav_rec_d_prime
Description :
Score that reflects the recognition discriminability accuracy across all Favorites Recognition trials. Higher scores reflect better performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_d_prime.tabcat_fav | numeric | (-) Infinity | Infinity |
fav_rec_task_duration
Description :
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_task_duration.tabcat_fav | numeric | 0 | Infinity |
fav_rec_task_form
Description :
The task form chosen
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_rec_task_form.tabcat_fav | A, B, C, D | character |
fav_rec_task_language
Description :
Testing language used during the task
| Variable Name | Type |
|---|---|
| fav_rec_task_language.tabcat_fav | character |
fav_rec_task_version
Description :
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| fav_rec_task_version.tabcat_fav | 1.0.0, 3.0.0 | character |
fav_rec_total_false_negative
Description :
Total number of false negative scores across all 24 trials
| Variable Name | Type |
|---|---|
| fav_rec_total_false_negative.tabcat_fav | numeric |
fav_rec_total_false_positive
Description :
Total number of false positive scores across all 24 trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_total_false_positive.tabcat_fav | numeric | 0 | 16 |
fav_rec_total_true_negative
Description :
Total number of true negative scores across all 24 trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| fav_rec_total_true_negative.tabcat_fav | numeric | 0 | 16 |
fav_rec_total_true_positive
Description :
Total number of true positive scores across all 24 trials
| Variable Name | Type |
|---|---|
| fav_rec_total_true_positive.tabcat_fav | numeric |
favorites_all_trials_total_correct_z
Description :
Z-score of the total number of correct responses across all three trials: Recall 1, Recall 2, and Delayed Recall
| Variable Name | Type |
|---|---|
| favorites_all_trials_total_correct_z.tabcat_fav | numeric |
favorites_all_trials_total_correct
Description :
Total number of correct responses across all three trials: Recall 1, Recall 2, and Delayed Recall
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_all_trials_total_correct.tabcat_fav | numeric | 0 | 24 |
favorites_all_trials_total_dk
Description :
Number of Don’t Know responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving no response
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_all_trials_total_dk.tabcat_fav | numeric | 0 | 24 |
favorites_all_trials_total_intrusions
Description :
Number of Intrusion responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving a food/animal that was not presented during the trial
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_all_trials_total_intrusions.tabcat_fav | numeric | 0 | 24 |
favorites_all_trials_total_sme
Description :
Number of SME responses across all three trials: Recall 1, Recall 2, and Delayed Recall, i.e., giving a food/animal that was presented during the trial but matching it with the incorrect face
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| favorites_all_trials_total_sme.tabcat_fav | numeric | 0 | 24 |
tabcat_flanker
flanker_congr_correct_median_rt
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_congr_correct_median_rt.tabcat_flanker | numeric | 0.5671260 | 2.3457495 |
flanker_congr_correct_total
| Variable Name | Type |
|---|---|
| flanker_congr_correct_total.tabcat_flanker | numeric |
flanker_correct_median_rt
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_correct_median_rt.tabcat_flanker | numeric | 0.6335810 | 2.3457495 |
flanker_correct_st_dev_rt
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_correct_st_dev_rt.tabcat_flanker | numeric | 0.06286568 | 0.78552673 |
flanker_correct_total
| Variable Name | Type |
|---|---|
| flanker_correct_total.tabcat_flanker | numeric |
flanker_incongr_correct_median_rt
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_incongr_correct_median_rt.tabcat_flanker | numeric | 0.5144560 | 3.5945000 |
flanker_incongr_correct_total
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_incongr_correct_total.tabcat_flanker | numeric | 0 | 16 |
flanker_practice_trial_success
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| flanker_practice_trial_success.tabcat_flanker | FALSE, TRUE | logical |
flanker_pt_set1_total_correct
| Variable Name | Type |
|---|---|
| flanker_pt_set1_total_correct.tabcat_flanker | numeric |
flanker_pt_set2_total_correct
| Variable Name | Type |
|---|---|
| flanker_pt_set2_total_correct.tabcat_flanker | numeric |
flanker_task_duration
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_task_duration.tabcat_flanker | numeric | 0 | 291 |
flanker_task_language
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| flanker_task_language.tabcat_flanker | English, Spanish (Argentina, Uruguay), Spanish (MEX, ESP, Central America), Spanish-MEX | character |
flanker_task_version
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| flanker_task_version.tabcat_flanker | 1.0.0, 1.1.0, 3.0.0 | character |
flanker_total_score_z
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_total_score_z.tabcat_flanker | numeric | 0.924528 | -5.415094 |
flanker_total_score
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| flanker_total_score.tabcat_flanker | numeric | 0.313000 | 9.822000 |
tabcat_ll
Description :
Line Length is a test of visuospatial skills. Examinees are shown two parallel white lines of differing lengths on a navy background and asked to tap the longer line of the two lines. The difference in length between the two lines shortens with response accuracy and lengthens when an incorrect response is made. There are ten easy catch trials interspersed throughout the task to indicate task validity.
ll_avg_time_per_trial
Description :
Mean reaction time across all task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_avg_time_per_trial.tabcat_ll | numeric | 0 | Infinity |
ll_catch_trial_score
Description :
Percent of total correct catch trials, a Catch Trials score < 80 indicates that the Threshold Score may not be valid
| Variable Name | Type |
|---|---|
| ll_catch_trial_score.tabcat_ll | numeric |
ll_catch_trial1
Description :
Catch Trial 1: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial1.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial10
Description :
Catch Trial 10: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial10.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial2
Description :
Catch Trial 2: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial2.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial3
Description :
Catch Trial 3: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial3.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial4
Description :
Catch Trial 4: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial4.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial5
Description :
Catch Trial 5: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial5.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial6
Description :
Catch Trial 6: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial6.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial7
Description :
Catch Trial 7: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial7.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial8
Description :
Catch Trial 8: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial8.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_catch_trial9
Description :
Catch Trial 9: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_catch_trial9.tabcat_ll | FALSE, TRUE | character | Incorrect, Correct |
ll_highest_consecutive_timed_out
Description :
Highest consecutive number of trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_highest_consecutive_timed_out.tabcat_ll | 0, 3 | numeric |
ll_median_time_per_trial
Description :
Median reaction time across all task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_median_time_per_trial.tabcat_ll | numeric | 0 | Infinity |
ll_practice_trials_success
Description :
Indication of whether the examinee completed the practice trial set successfully
| Label | Value |
|---|---|
| 0 | Incorrect |
| 1 | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| ll_practice_trials_success.tabcat_ll | 0,1 | categorical | Incorrect, Correct |
ll_r1
Description :
Reversal 1: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r1.tabcat_ll | numeric | 1 | 50 |
ll_r10
Description :
Reversal 10: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r10.tabcat_ll | numeric | 1 | 50 |
ll_r2
Description :
Reversal 2: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r2.tabcat_ll | numeric | 1 | 50 |
ll_r3
Description :
Reversal 3: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r3.tabcat_ll | numeric | 1 | 50 |
ll_r4
Description :
Reversal 4: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r4.tabcat_ll | numeric | 1 | 50 |
ll_r5
Description :
Reversal 5: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r5.tabcat_ll | numeric | 1 | 50 |
ll_r6
Description :
Reversal 6: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r6.tabcat_ll | numeric | 1 | 50 |
ll_r7
Description :
Reversal 7: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r7.tabcat_ll | numeric | 1 | 50 |
ll_r8
Description :
Reversal 8: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r8.tabcat_ll | numeric | 1 | 50 |
ll_r9
Description :
Reversal 9: The intensity of the difference in line lengths at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_r9.tabcat_ll | numeric | 1 | 50 |
ll_task_duration
Description :
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_task_duration.tabcat_ll | numeric | 0 | Infinity |
ll_task_language
Description :
Testing language used during the task
| Variable Name | Type |
|---|---|
| ll_task_language.tabcat_ll | character |
ll_task_version
Description :
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_task_version.tabcat_ll | 1.0.0, 1.1.0, 3.0.0 | character |
ll_threshold_score_3_10_z
Description :
Z-score of the threshold score across reversals 3:10
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_threshold_score_3_10_z.tabcat_ll | 0.480469, 0.921875 | numeric |
ll_threshold_score_3_10
Description :
Primary performance metric: Average intensity of the difference in line lengths at the time of reversal across reversals 3:10, i.e., mean of LL_R3:LL_R10. Otherwise explained as: the average length difference between the two lines at which the probability of the examinee responding accurately is 75%. Scores are reported on a continuous scale with higher scores indicating worse performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_threshold_score_3_10.tabcat_ll | numeric | 1 | Infinity |
ll_total_catch_trials_timed_out
Description :
Total number of catch trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_catch_trials_timed_out.tabcat_ll | 0, 1 | numeric |
ll_total_practice_trials_correct
Description :
Total number of correct responses given during practice trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_practice_trials_correct.tabcat_ll | 4 | numeric |
ll_total_practice_trials_timed_out
Description :
Total number of practice trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_practice_trials_timed_out.tabcat_ll | 0 | numeric |
ll_total_practice_trials
Description :
Total number of practice trials completed
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_practice_trials.tabcat_ll | 4 | numeric |
ll_total_task_trials_timed_out
Description :
Total number of task trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| ll_total_task_trials_timed_out.tabcat_ll | 0, 5 | numeric |
ll_total_trials
Description :
Total number of task trials completed
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| ll_total_trials.tabcat_ll | numeric | 0 | Infinity |
tabcat_lo
Description :
TabCAT BHA Line Orientation is a test of visuospatial skills modeled after the Benton Judgment of Line Orientation. Examinees are shown 3 lines on a dark background: 1 white line and 2 shorter orange lines. One orange line is parallel to the white line and the other orange line is presented at a different angle. Examinees are asked to tap the orange line that is parallel to the target white line. Trial difficulty is manipulated by varying the angle difference between the non-match orange line and the white line. Difficulty is staircased based on response accuracy.
References :
- Possin KL, Moskowitz T, Erlhoff SJ, Rogers KM, Johnson ET, Steele NZR, Higgins JJ, Stiver J, Alioto AG, Farias ST, Miller BL, Rankin KP. The Brain Health Assessment for detecting and diagnosing neurocognitive disorders. J Am Geriatr Soc. 2018;66:150-156. doi: 10.1111/jgs.15208.
lo_avg_time_per_trial
Description :
Mean reaction time across all task trials. In March 2022, the task was modified such that trials were cutoff at a limit of 8 seconds.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_avg_time_per_trial.tabcat_lo | numeric | 0 | Infinity |
lo_catch_trial_score
Description :
10 easy Catch Trials are interspersed throughout the task. A Catch Trials score < 80% indicate that the Threshold Score may not be valid.
| Variable Name | Type |
|---|---|
| lo_catch_trial_score.tabcat_lo | numeric |
lo_catch_trial1
Description :
Catch Trial 1: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial1.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial10
Description :
Catch Trial 10: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial10.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial2
Description :
Catch Trial 2: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial2.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial3
Description :
Catch Trial 3: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial3.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial4
Description :
Catch Trial 4: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial4.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial5
Description :
Catch Trial 5: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial5.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial6
Description :
Catch Trial 6: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial6.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial7
Description :
Catch Trial 7: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial7.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial8
Description :
Catch Trial 8: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial8.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_catch_trial9
Description :
Catch Trial 9: Examinee’s score
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_catch_trial9.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_highest_consecutive_timed_out
Description :
Highest consecutive number of trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_highest_consecutive_timed_out.tabcat_lo | 0, 1, 2, 3 | numeric |
lo_median_time_per_trial
Description :
Median reaction time across all task trials. In March 2022, the task was modified such that trials were cutoff at a limit of 8 seconds.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_median_time_per_trial.tabcat_lo | numeric | 0.833000 | 12.417000 |
lo_practice_trials_success
Description :
Indication of whether the examinee completed the practice trial set successfully
| Label | Value |
|---|---|
| FALSE | Incorrect |
| TRUE | Correct |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| lo_practice_trials_success.tabcat_lo | FALSE, TRUE | logical | Incorrect, Correct |
lo_r1
Description :
Reversal 1: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r1.tabcat_lo | numeric | 1 | 60 |
lo_r10
Description :
Reversal 10: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r10.tabcat_lo | numeric | 1 | 60 |
lo_r2
Description :
Reversal 2: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r2.tabcat_lo | numeric | 1 | 60 |
lo_r3
Description :
Reversal 3: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r3.tabcat_lo | numeric | 1 | 60 |
lo_r4
Description :
Reversal 4: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r4.tabcat_lo | numeric | 1 | 60 |
lo_r5
Description :
Reversal 5: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r5.tabcat_lo | numeric | 1 | 60 |
lo_r6
Description :
Reversal 6: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r6.tabcat_lo | numeric | 1 | 60 |
lo_r7
Description :
Reversal 7: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r7.tabcat_lo | numeric | 1 | 60 |
lo_r8
Description :
Reversal 8: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r8.tabcat_lo | numeric | 1 | 60 |
lo_r9
Description :
Reversal 9: The intensity of the difference in the angle between lines at the time of reversal
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_r9.tabcat_lo | numeric | 1 | 60 |
lo_task_duration
Description :
Total amount of time spent on the task, in seconds.
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_task_duration.tabcat_lo | numeric | 0 | Infinity |
lo_task_language
Description :
Testing language used during the task
| Variable Name | Type |
|---|---|
| lo_task_language.tabcat_lo | character |
lo_task_version
Description :
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_task_version.tabcat_lo | 1.0.0, 1.1.0, 3.0.0 | character |
lo_threshold_score_3_10_z
Description :
Z-score of the threshold score across reversals 3:10
| Variable Name | Type |
|---|---|
| lo_threshold_score_3_10_z.tabcat_lo | numeric |
lo_threshold_score_3_10
Description :
Primary performance metric: Average angle between lines at the time of reversal across reversals 3:10, i.e., mean of LO_R3:LO_R10. Otherwise explained as: the average angle difference between lines at which probability of the examinee’s correct response is 75%. Higher scores indicate worse performance.. Scores are reported on a continuous scale with higher scores indicating worse performance
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_threshold_score_3_10.tabcat_lo | numeric | 1 | 90 |
lo_total_catch_trials_timed_out
Description :
Total number of catch trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_catch_trials_timed_out.tabcat_lo | 0, 1, 3, 4 | numeric |
lo_total_practice_trials_correct
Description :
Total number of correct responses given during practice trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_practice_trials_correct.tabcat_lo | 4, 6, 7 | numeric |
lo_total_practice_trials_timed_out
Description :
Total number of practice trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_practice_trials_timed_out.tabcat_lo | 0, 1, 3, 6 | numeric |
lo_total_practice_trials
Description :
Total number of practice trials completed
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_practice_trials.tabcat_lo | 4, 5, 8, 9, 13 | numeric |
lo_total_task_trials_timed_out
Description :
Total number of task trials in which the examinee ran out of time before giving a response
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| lo_total_task_trials_timed_out.tabcat_lo | 0, 1, 2, 5 | numeric |
lo_total_trials
Description :
Total number of task trials completed
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| lo_total_trials.tabcat_lo | numeric | 0 | Infinity |
tabcat_match
Description :
Match is a test of processing speed and executive functions modeled after the WAIS-III Digit Symbol Coding paradigm. The examinee is shown a fixed legend of numbers 1 through 7 with corresponding simple, abstract pictures. Each time a number appears in the middle of the screen, the examinee must tap the corresponding picture at the bottom of the screen as quickly as possible. The task lasts for two minutes and the primary performance metrics are total correct and total errors.
References :
- Tsoy E, Erlhoff SJ, Goode CA, et al. BHA-CS: A novel cognitive composite for Alzheimer’s disease and related disorders. Alzheimers Dement (Amst). 2020;12(1):e12042. Published 2020 Jun 21. doi:10.1002/dad2.12042 [2] Possin KL, Moskowitz T, Erlhoff SJ, et al. The Brain Health Assessment for Detecting and Diagnosing Neurocognitive Disorders. J Am Geriatr Soc. 2018;66(1):150-156. doi:10.1111/jgs.15208 [3] Rodríguez-Salgado AM, Llibre-Guerra JJ, Tsoy E, et al. A Brief Digital Cognitive Assessment for Detection of Cognitive Impairment in Cuban Older Adults. J Alzheimers Dis. 2021;79(1):85-94. doi:10.3233/JAD-200985 [4] Alioto AG, Mumford P, Wolf A, et al. White Matter Correlates of Cognitive Performance on the UCSF Brain Health Assessment. J Int Neuropsychol Soc. 2019;25(6):654-658. doi:10.1017/S1355617719000225 [5] Tsoy E, Strom A, Iaccarino L, et al. Detecting Alzheimer’s disease biomarkers with a brief tablet-based cognitive battery: sensitivity to Aβ and tau PET. Alzheimers Res Ther. 2021;13(1):36. Published 2021 Feb 8. doi:10.1186/s13195-021-00776-w
match_practice_trial_success
Description :
Overall success of the total practice trial sets
| Label | Value |
|---|---|
| TRUE | Pass |
| FALSE | Fail |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| match_practice_trial_success.tabcat_match | TRUE, FALSE | character | Pass, Fail |
match_pt_set1_success
Description :
Success of the first practice trial set, 2 consecutive correct trials accomplished
| Label | Value |
|---|---|
| 0 | Fail |
| 1 | Pass |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| match_pt_set1_success.tabcat_match | 0,1 | categorical | Fail, Pass |
match_pt_set1_total_trials
Description :
Total number of trials completed in the first practice trial set
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_pt_set1_total_trials.tabcat_match | 2, 3, 4, 6 | numeric |
match_pt_set2_success
Description :
Success of the second practice trial set, 2 consecutive correct trials accomplished
| Label | Value |
|---|---|
| 0 | Fail |
| 1 | Pass |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| match_pt_set2_success.tabcat_match | 0, 1 | categorical | Fail, Pass |
match_pt_set2_total_trials
Description :
Total number of trials completed in the second practice trial set
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_pt_set2_total_trials.tabcat_match | 0 | numeric |
match_pt_set3_success
Description :
Success of the third practice trial set, 2 consecutive correct trials accomplished
| Label | Value |
|---|---|
| 0 | Fail |
| 1 | Pass |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| match_pt_set3_success.tabcat_match | 0, 1 | categorical | Fail, Pass |
match_pt_set3_total_trials
Description :
Total number of trials completed in the third practice trial set
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_pt_set3_total_trials.tabcat_match | 0 | numeric |
match_task_duration
Description :
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match_task_duration.tabcat_match | numeric | 0 | Infinity |
match_task_form
Description :
The task form chosen
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_task_form.tabcat_match | A, B, C, D | character |
match_task_language
Description :
Testing language used during the task
| Variable Name | Type |
|---|---|
| match_task_language.tabcat_match | character |
match_task_version
Description :
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| match_task_version.tabcat_match | 1.0.0, 3.0.0 | character |
match_total_correct_z
Description :
Z-score of the total number of correct responses given during the full 2 minute duration of the task
| Variable Name | Type |
|---|---|
| match_total_correct_z.tabcat_match | numeric |
match_total_correct
Description :
Total number of correct responses given during the full task duration, 2 minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| match_total_correct.tabcat_match | numeric | 0 | Infinity |
match_total_incorrect
Description :
Total number of incorrect responses given during the full task duration, 2 minutes
| Variable Name | Type |
|---|---|
| match_total_incorrect.tabcat_match | numeric |
tabcat_rapid_naming
Description :
Rapid Naming is a computerized, one-minute speeded visual naming test aimed at measuring subtle age-related word-finding decline.
References :
- Stiver, J., Staffaroni, A. M., Walters, S. M., You, M. Y., Casaletto, K. B., Erlhoff, S. J., Possin, K. L., Lukic, S., La Joie, R., Rabinovici, G. D., Zimmerman, M. E., Gorno-Tempini, M. L., & Kramer, J. H. (2022). The Rapid Naming Test: Development and initial validation in typically aging adults. The Clinical neuropsychologist, 36(7), 1822–1843. https://doi.org/10.1080/13854046.2021.1900399
rapid_naming_avg_reaction_time
Description :
Mean reaction time across all correct trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_avg_reaction_time.tabcat_rapid_naming | numeric | ? | ? |
rapid_naming_median_reaction_time
Description :
Median reaction time across all correct trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_median_reaction_time.tabcat_rapid_naming | numeric | ? | ? |
rapid_naming_st_dev_reaction_time
Description :
Standard deviation of reaction time across all correct trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_st_dev_reaction_time.tabcat_rapid_naming | numeric | ? | ? |
rapid_naming_task_language
Description :
Language the task was administered in
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rapid_naming_task_language.tabcat_rapid_naming | English, Portuguese (Brazil), Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain) | character |
rapid_naming_task_version
Description :
Indicates which verison of the TabCAT app was used during administration. Version revisions include task experience, scoring, mechanism, or format that may impact comparison with older data.
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rapid_naming_task_version.tabcat_rapid_naming | 1.0.0, 3.0.0 | character |
rapid_naming_total_correct
Description :
Total number of correct responses given across all trials (initial and self-corrected)
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_total_correct.tabcat_rapid_naming | numeric | 0 | 60 |
rapid_naming_total_incorrect
Description :
Total number of incorrect responoses given across all trials
| Variable Name | Type |
|---|---|
| rapid_naming_total_incorrect.tabcat_rapid_naming | numeric |
rapid_naming_total_initial_correct
Description :
Total number of initial correct responses given across all trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_total_initial_correct.tabcat_rapid_naming | numeric | 0 | 60 |
rapid_naming_total_not_seen
Description :
Total number of unseen trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_total_not_seen.tabcat_rapid_naming | numeric | 0 | 60 |
rapid_naming_total_seen
Description :
Total number of seen trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| rapid_naming_total_seen.tabcat_rapid_naming | numeric | 0 | 60 |
rapid_naming_total_self_corrected
Description :
Total number of self corrected responses given across all trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rapid_naming_total_self_corrected.tabcat_rapid_naming | 0, 1, 2 | numeric |
rapid_naming_total_skipped
Description :
Total number of skipped trials
| Variable Name | Type |
|---|---|
| rapid_naming_total_skipped.tabcat_rapid_naming | numeric |
tabcat_running_dots
Description :
Running dots is an executive functioning/visuospatial working memory task where participants must watch a dot move across a grid and remember the pattern it moved in. As the trials continue, the number of dot placements the participant must remember in the sequence increases from 2 dot spaces to 3, 4, and 5 dot spaces.
References :
Lindbergh, C. A., & Kramer, J. H. (2023). Measures of Executive Functions. The SAGE Handbook of Clinical Neuropsychology: Clinical Neuropsychological Assessment and Diagnosis, 179.
Tsoy E, Erlhoff SJ, Goode CA, et al. BHA-CS: A novel cognitive composite for Alzheimer’s disease and related disorders. Alzheimers Dement (Amst). 2020;12(1):e12042. Published 2020 Jun 21. doi:10.1002/dad2.12042
running_dots_2dot_percent_correct
Description :
Percent of correct responses given across all trials in the 2 dot condition, regardless of order
| Variable Name | Type |
|---|---|
| running_dots_2dot_percent_correct.tabcat_running_dots | numeric |
running_dots_2dot_total_correct
Description :
Total number of correct responses given across all trials in the 2 dot condition, regardless of order
| Variable Name | Type |
|---|---|
| running_dots_2dot_total_correct.tabcat_running_dots | numeric |
running_dots_2dot_trial_score
Description :
For each trial in the 2 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_2dot_trial_score.tabcat_running_dots | numeric | 0 | 6 |
running_dots_3dot_percent_correct
Description :
Percent of correct responses given across all trials in the 3 dot condition, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_3dot_percent_correct.tabcat_running_dots | numeric | 0 | 100 |
running_dots_3dot_total_correct
Description :
Total number of correct responses given across all trials in the 3 dot condition, regardless of order
| Variable Name | Type |
|---|---|
| running_dots_3dot_total_correct.tabcat_running_dots | numeric |
running_dots_3dot_trial_score
Description :
For each trial in the 3 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials
| Variable Name | Type |
|---|---|
| running_dots_3dot_trial_score.tabcat_running_dots | character |
running_dots_4dot_percent_correct
Description :
Percent of correct responses given across all trials in the 4 dot condition, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_4dot_percent_correct.tabcat_running_dots | numeric | 0 | 100 |
running_dots_4dot_total_correct
Description :
Total number of correct responses given across all trials in the 4 dot condition, regardless of order
| Variable Name | Type |
|---|---|
| running_dots_4dot_total_correct.tabcat_running_dots | numeric |
running_dots_4dot_trial_score
Description :
For each trial in the 4 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_4dot_trial_score.tabcat_running_dots | numeric | 0 | 12 |
running_dots_5dot_percent_correct
Description :
Percent of correct responses given across all trials in the 5 dot condition, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_5dot_percent_correct.tabcat_running_dots | numeric | 0 | 100 |
running_dots_5dot_total_correct
Description :
Total number of correct responses given across all trials in the 5 dot condition, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_5dot_total_correct.tabcat_running_dots | numeric | 0 | 15 |
running_dots_5dot_trial_score
Description :
For each trial in the 5 dot condition: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_5dot_trial_score.tabcat_running_dots | numeric | 0 | 15 |
running_dots_percent_correct
Description :
Percent of correct responses given across all trials, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_percent_correct.tabcat_running_dots | numeric | 0 | 100 |
running_dots_task_duration
Description :
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_task_duration.tabcat_running_dots | numeric | 0 | (Infinity) |
running_dots_task_language
Description :
Testing language used during the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| running_dots_task_language.tabcat_running_dots | Arabic, Cantonese (Traditional), English, Filipino, Greek, Igbo, Mandarin (Simplified), Mandarin (Traditional), Portuguese (Brazil), Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain), Thai | character |
running_dots_task_version
Description :
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| running_dots_task_version.tabcat_running_dots | 1.0.0, 1.1.0, 1.2.0, 1.2.1, 3.0.0 | character |
running_dots_total_correct
Description :
Total number of correct responses given across all trials, regardless of order
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_total_correct.tabcat_running_dots | numeric | 0 | 42 |
running_dots_trial_score
Description :
For each trial: 1 point given for each correct location chosen in the correct order, 0.5 points given for each correct location chosen in the incorrect order, and 0 points for incorrect locations chosen; scores summed across all trials and all dot number conditions
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| running_dots_trial_score.tabcat_running_dots | numeric | 0 | 42 |
tabcat_set_shifting
Description :
Set Shifting is a test of executive functioning and is modeled after the NIH EXAMINER Set Shifting task. Examinees are required to match a stimulus on the top of the screen to one of two stimuli in the lower corners of the screen, classifying shapes or classifying colors.
References :
- Lindbergh, C. A., & Kramer, J. H. (2023). Measures of Executive Functions. The SAGE Handbook of Clinical Neuropsychology: Clinical Neuropsychological Assessment and Diagnosis, 179.
set_shifting_color_correct_median_rt
Description :
Median reaction time of all correct color block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_color_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
set_shifting_color_correct_total
Description :
Total number of correct responses given across all color block task trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| set_shifting_color_correct_total.tabcat_set_shifting | 11, 13, 14, 15, 16 | numeric |
set_shifting_nonshifted_correct_median_rt
Description :
Median reaction time of all correct nonshifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_nonshifted_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
set_shifting_nonshifted_correct_total
Description :
Total number of correct responses given across all nonshifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_nonshifted_correct_total.tabcat_set_shifting | numeric | 0 | 16 |
set_shifting_shape_correct_median_rt
Description :
Median reaction time of all correct shape block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shape_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
set_shifting_shape_correct_total
Description :
Total number of correct responses given across all shape block task trials
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| set_shifting_shape_correct_total.tabcat_set_shifting | 7, 13, 14, 15, 16 | numeric |
set_shifting_shift_correct_median_rt
Description :
Median reaction time of all correct shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shift_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
set_shifting_shift_correct_total
Description :
Total number of correct responses given across all shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shift_correct_total.tabcat_set_shifting | numeric | 0 | 32 |
set_shifting_shifted_correct_median_rt
Description :
Median reaction time of all correct shifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shifted_correct_median_rt.tabcat_set_shifting | numeric | 0 | 5 |
set_shifting_shifted_correct_st_dev_rt
Description :
Standard deviation of reaction time of all correct shifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shifted_correct_st_dev_rt.tabcat_set_shifting | numeric | (-) Infinity | Infinity |
set_shifting_shifted_correct_total
Description :
Total number of correct responses given across all shifted shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_shifted_correct_total.tabcat_set_shifting | numeric | 0 | 16 |
set_shifting_task_duration
Description :
Total amount of time spent on the task, in minutes
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_task_duration.tabcat_set_shifting | numeric | 0 | Infinity |
set_shifting_task_language
Description :
Testing language used during the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| set_shifting_task_language.tabcat_set_shifting | Amharic, Arabic, Cantonese (Traditional), English, Filipino, French, Greek, Hebrew, Igbo, Italian, Mandarin (Simplified), Mandarin (Traditional), Portuguese (Brazil), Setswana, Spanish (Argentina, Uruguay), Spanish (Cuba), Spanish (Mexico, Central America, Spain), Swahili, Thai | character |
set_shifting_task_version
Description :
Task version of the assessment, different versions have major revisions to the task
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| set_shifting_task_version.tabcat_set_shifting | 1.0.0, 1.1.0, 3.0.0 | character |
set_shifting_total_score_z
Description :
Z-score of the global score that combines accuracy and reaction time scores across all correct shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_total_score_z.tabcat_set_shifting | numeric | (-) Infinity | Infinity |
set_shifting_total_score
Description :
Global score that combines accuracy and reaction time scores across all correct shift block task trials
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| set_shifting_total_score.tabcat_set_shifting | numeric | 0 | 10 |
tech_familiarity
Description :
Participant self reported familiarity interacting with technology. Questionnaire developed in house as part of Fitbit study.
References :
- Paolillo, E. W., Lee, S. Y., VandeBunte, A., Djukic, N., Fonseca, C., Kramer, J. H., & Casaletto, K. B. (2022). Wearable use in an observational study among older adults: adherence, feasibility, and effects of clinicodemographic factors. Frontiers in Digital Health, 4, 884208.
access
Description :
Do you have access to a computer or tablet at home?
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| access.tech_familiarity | 0, 1 | categorical | No, Yes |
computer_difficulty
Description :
How much difficulty do you have using computers?
| Label | Value |
|---|---|
| 0 | No difficulty |
| 1 | Some difficulty |
| 2 | Moderate difficulty |
| 3 | Quite a bit of difficulty |
| 4 | Extreme difficulty |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| computer_difficulty.tech_familiarity | 0, 1, 2, 3, 4 | categorical | No difficulty, Some difficulty, Moderate difficulty, Quite a bit of difficulty, Extreme difficulty |
hours_internet_per_day
Description :
On average, how many hours PER DAY do you spend on the internet?
| Label | Value |
|---|---|
| 0 | 0-1 |
| 1 | 2-4 |
| 2 | 5-8 |
| 3 | 9-15 |
| 4 | 15+ |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| hours_internet_per_day.tech_familiarity | 0, 1, 2, 3, 4 | categorical | 0-1, 2-4, 5-8, 9-15, 15+ |
nervous_anxious_technology
Description :
How anxious (or nervous) do you typically feel when using a computer, tablet, or
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| nervous_anxious_technology.tech_familiarity | 1, 2, 3, 4 | categorical | Not anxious, Somewhat anxious, Moderately anxious, Quite a bit anxious, Extremely anxious |
smartphone
Description :
smartphone?
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| smartphone.tech_familiarity | 0, 1 | categorical | No, Yes |
wearable
Description :
Have you ever used a wearable tracking device
| Label | Value |
|---|---|
| 0 | No |
| 1 | Yes |
| Variable Name | All Possible Values (Categorical) | Type | Value Labels |
|---|---|---|---|
| wearable.tech_familiarity | 0, 1 | categorical | No, Yes |
uds_neuropsych
Description :
The neuropsychological testing battery from the Uniform Data Set (UDS) of the Alzheimer’s Disease Centers (ADC) program of the National Institute on Aging (NIA). This testing battery includes measures to test domains such as episodic memory, attention, processing speed, executive function, and language.
References :
- Weintraub, S., Salmon, D., Mercaldo, N., Ferris, S., Graff-Radford, N. R., Chui, H., Cummings, J., DeCarli, C., Foster, N. L., Galasko, D., Peskind, E., Dietrich, W., Beekly, D. L., Kukull, W. A., & Morris, J. C. (2009). The Alzheimer’s Disease Centers’ Uniform Data Set (UDS): the neuropsychologic test battery. Alzheimer disease and associated disorders, 23(2), 91–101. https://doi.org/10.1097/WAD.0b013e318191c7dd
animals_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animals_zscore.uds_neuropsych | numeric | 0.018 | -3.981 |
animals
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| animals.uds_neuropsych | numeric | 0 | 52 |
boston_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| boston_zscore.uds_neuropsych | numeric | 0.000 | -11.667 |
boston
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| boston.uds_neuropsych | numeric | 0 | 30 |
cogstat
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cogstat.uds_neuropsych | 0, 1, 2, 3, 4 | numeric |
craftdre
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| craftdre.uds_neuropsych | numeric | 0 | 25 |
craftdvr
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| craftdvr.uds_neuropsych | numeric | 0 | 39 |
crafturs
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| crafturs.uds_neuropsych | numeric | 0 | 25 |
craftvrs
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| craftvrs.uds_neuropsych | numeric | 0 | 41 |
digbacct
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digbacct.uds_neuropsych | integer | 0 | 14 |
digforct
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digforct.uds_neuropsych | numeric | 0 | 14 |
digib_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digib_zscore.uds_neuropsych | numeric | 0.045 | -3.364 |
digib
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digib.uds_neuropsych | numeric | 0 | 12 |
digiblen_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digiblen_zscore.uds_neuropsych | numeric | 0.000 | -4.333 |
digiblen
| Variable Name | Type |
|---|---|
| digiblen.uds_neuropsych | numeric |
digif_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digif_zscore.uds_neuropsych | numeric | 0.095 | -4.550 |
digif
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digif.uds_neuropsych | numeric | 0 | 12 |
digiflen_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| digiflen_zscore.uds_neuropsych | numeric | 0.091 | -6.273 |
digiflen
| Variable Name | Type |
|---|---|
| digiflen.uds_neuropsych | numeric |
logi_mem_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| logi_mem_zscore.uds_neuropsych | numeric | 0.000 | -4.086 |
logimem
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| logimem.uds_neuropsych | numeric | 0 | 23 |
mem_units_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mem_units_zscore.uds_neuropsych | numeric | 0.000 | -3.500 |
memtime
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| memtime.uds_neuropsych | numeric | 0 | 35 |
memunits
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| memunits.uds_neuropsych | numeric | 0 | 23 |
minttots
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| minttots.uds_neuropsych | numeric | 0 | 32 |
mmse_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mmse_zscore.uds_neuropsych | numeric | 0.000 | -29.300 |
mocatots
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| mocatots.uds_neuropsych | numeric | 0 | 30 |
pentagon
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| pentagon.uds_neuropsych | 0, 1 | numeric |
SE_uds3_ef
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| SE_uds3_ef.uds_neuropsych | numeric | 0.3202755 | 0.9562837 |
trail_a_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trail_a_zscore.uds_neuropsych | numeric | 0.021 | -11.207 |
trail_b_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trail_b_zscore.uds_neuropsych | numeric | 0.003 | -6.803 |
trailA_ratio
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailA_ratio.uds_neuropsych | numeric | 0.000000 | 160.000000 |
traila
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| traila.uds_neuropsych | numeric | 9 | 150 |
trailali
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailali.uds_neuropsych | numeric | 0 | 24 |
trailarr
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailarr.uds_neuropsych | numeric | 0 | 40 |
trailB_ratio
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailB_ratio.uds_neuropsych | numeric | 0.200000 | 72.000000 |
trailb
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailb.uds_neuropsych | numeric | 17 | 300 |
trailbli
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailbli.uds_neuropsych | numeric | 0 | 24 |
trailbrr
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| trailbrr.uds_neuropsych | numeric | 0 | 40 |
uds3_ef_mean.adj
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uds3_ef_mean.adj.uds_neuropsych | numeric | 0.000092800 | -1.026420414 |
uds3_ef_sd.adj
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uds3_ef_sd.adj.uds_neuropsych | numeric | 0.7280313 | 0.7615333 |
uds3_ef_Z
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uds3_ef_Z.uds_neuropsych | numeric | 0.0002432193 | -5.2101374529 |
uds3_ef
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| uds3_ef.uds_neuropsych | numeric | 0.0002508328 | -3.2307936664 |
udsbenrs
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| udsbenrs.uds_neuropsych | 0, 1 | numeric |
udsbentc
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsbentc.uds_neuropsych | numeric | 0 | 17 |
udsbentd
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsbentd.uds_neuropsych | numeric | 0 | 17 |
udsverfc
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsverfc.uds_neuropsych | numeric | 0 | 33 |
udsverlc
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsverlc.uds_neuropsych | numeric | 0 | 34 |
udsvertn
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| udsvertn.uds_neuropsych | numeric | 0 | 62 |
v_type
| Variable Name | Type |
|---|---|
| v_type.uds_neuropsych | character |
veg_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| veg_zscore.uds_neuropsych | numeric | 0.043 | -3.585 |
veg
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| veg.uds_neuropsych | numeric | 0 | 37 |
wais_zscore
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wais_zscore.uds_neuropsych | numeric | 0.009 | -4.975 |
wais
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| wais.uds_neuropsych | numeric | 0 | 98 |
vasc_burden
Description :
The Vascular Burden Score (VBS) includes the sum of four possible Vascular Risk Factors (e.g., hypertension, diabetes, hyperlipidemia, sleep apnea) and four possible Vascular Diseases (cardiac arrythmias [atrial fibrillation, pacemaker and/or defibrillator], coronary artery disease [angina, angioplasty/endarterectomy/stent, cardiac bypass procedure, heart attack/cardiac arrest], congestive heart failure, and cerebrovascular disease [TIA, stroke]). Range is 0-8.
References :
Takahashi, P. Y., Caldwell, C. R., & Targonski, P. V. (2012). Effect of vascular burden as measured by vascular indexes upon vascular dementia: a matched case-control study. Clinical interventions in aging, 7, 27–33. https://doi.org/10.2147/CIA.S28143
DeCarli, C., Villeneuve, S., Maillard, P., Harvey, D., Singh, B., Carmichael, O., Fletcher, E., Olichney, J., Farias, S., Jagust, W., Reed, B., & Mungas, D. (2019). Vascular Burden Score Impacts Cognition Independent of Amyloid PET and MRI Measures of Alzheimer’s Disease and Vascular Brain Injury. Journal of Alzheimer’s disease : JAD, 68(1), 187–196. https://doi.org/10.3233/JAD-180965
VBS
Description :
Sum of VDS + VRS
| Variable Name | Type |
|---|---|
| VBS.vasc_burden | numeric |
VDS
Description :
Sum of 4 possible vascular diseases: 1) cardiac arrythmias [atrial fibrillation, pacemaker and/or defibrillator], 2) coronary artery disease [angina, angioplasty/endarterectomy/stent, cardiac bypass procedure, heart attack/cardiac arrest], 3) congestive heart failure and 4) cerebrovascular disease [TIA, stroke])
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VDS.vasc_burden | 0, 1, 2, 3, 4 | numeric |
VRS
Description :
Sum of 4 possible vascular risk factors: hypertension, sleep apnea, diabetes, hyperlipidemia
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| VRS.vasc_burden | 0, 1, 2, 3, 4 | numeric |
virtual_bedside
behav1
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav1.virtual_bedside | 0 | numeric |
behav10
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav10.virtual_bedside | 0 | numeric |
behav2
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav2.virtual_bedside | 0 | numeric |
behav3
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav3.virtual_bedside | 0 | numeric |
behav4
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav4.virtual_bedside | 0 | numeric |
behav5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav5.virtual_bedside | 0 | numeric |
behav6
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav6.virtual_bedside | 0 | numeric |
behav7
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav7.virtual_bedside | 0 | numeric |
behav8
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav8.virtual_bedside | 0 | numeric |
behav9
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| behav9.virtual_bedside | 0 | numeric |
cv2b_r
| Variable Name | Type |
|---|---|
| cv2b_r.virtual_bedside | numeric |
cv2b_u
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2b_u.virtual_bedside | 0, 1, 8 | numeric |
cv2hit
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2hit.virtual_bedside | 12, 13, 14, 15, 16 | numeric |
cv2ldcc
| Variable Name | Type |
|---|---|
| cv2ldcc.virtual_bedside | numeric |
cv2ldci
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2ldci.virtual_bedside | 0, 1, 2, 3, 4 | numeric |
cv2lfrc
| Variable Name | Type |
|---|---|
| cv2lfrc.virtual_bedside | numeric |
cv2lfri
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2lfri.virtual_bedside | 0, 1, 2, 3, 20 | numeric |
cv2np
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2np.virtual_bedside | 0, 2, 6 | numeric |
cv2nu
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2nu.virtual_bedside | 0, 1 | numeric |
cv2sdcc
| Variable Name | Type |
|---|---|
| cv2sdcc.virtual_bedside | numeric |
cv2sdci
| Variable Name | Type |
|---|---|
| cv2sdci.virtual_bedside | numeric |
cv2sfrc
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| cv2sfrc.virtual_bedside | numeric | 5 | 16 |
cv2sfri
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2sfri.virtual_bedside | 0, 1, 2, 4 | numeric |
cv2t1c
| Variable Name | Type |
|---|---|
| cv2t1c.virtual_bedside | numeric |
cv2t1i
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t1i.virtual_bedside | 0, 1, 2 | numeric |
cv2t2c
| Variable Name | Type |
|---|---|
| cv2t2c.virtual_bedside | numeric |
cv2t2i
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t2i.virtual_bedside | 0, 1, 3, 4, 9 | numeric |
cv2t3c
| Variable Name | Type |
|---|---|
| cv2t3c.virtual_bedside | numeric |
cv2t3i
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t3i.virtual_bedside | 0, 1, 2, 3 | numeric |
cv2t4c
| Variable Name | Type |
|---|---|
| cv2t4c.virtual_bedside | numeric |
cv2t4i
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t4i.virtual_bedside | 0, 1, 2 | numeric |
cv2t5c
| Variable Name | Type |
|---|---|
| cv2t5c.virtual_bedside | numeric |
cv2t5i
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2t5i.virtual_bedside | 0, 1, 2, 3 | numeric |
cv2tb_c
| Variable Name | Type |
|---|---|
| cv2tb_c.virtual_bedside | numeric |
cv2tb_i
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| cv2tb_i.virtual_bedside | 0, 1, 2, 8 | numeric |
d_rule_v
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| d_rule_v.virtual_bedside | 0, 1, 2 | numeric |
dcorr
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| dcorr.virtual_bedside | numeric | 6 | 30 |
dreps
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| dreps.virtual_bedside | 0, 1, 2, 4 | numeric |
mintpcnc
| Variable Name | Type |
|---|---|
| mintpcnc.virtual_bedside | numeric |
mintpcng
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mintpcng.virtual_bedside | 0, 1, 2, 8 | numeric |
mintscnc
| Variable Name | Type |
|---|---|
| mintscnc.virtual_bedside | numeric |
mintscng
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mintscng.virtual_bedside | 0, 1, 2 | numeric |
minttots
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| minttots.virtual_bedside | 24, 29, 30, 31, 32 | numeric |
minttotw
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| minttotw.virtual_bedside | 24, 29, 30, 31, 32 | numeric |
mocaclock
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mocaclock.virtual_bedside | 3 | numeric |
mocacube
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mocacube.virtual_bedside | 0, 1 | numeric |
mocalanguage
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mocalanguage.virtual_bedside | 0, 2, 3 | numeric |
mod_rey
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| mod_rey.virtual_bedside | 13, 14, 15, 16 | numeric |
numb_loc
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| numb_loc.virtual_bedside | 8, 9, 10 | numeric |
repeat
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| repeat.virtual_bedside | 3 | numeric |
repeat5
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| repeat5.virtual_bedside | 4, 5 | numeric |
research_status
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| research_status.virtual_bedside | 1 | numeric |
rey_recg
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| rey_recg.virtual_bedside | 0, 1 | numeric |
rey10m
| Variable Name | Type |
|---|---|
| rey10m.virtual_bedside | numeric |
strp_cn_cor
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cn_cor.virtual_bedside | numeric | 63 | 114 |
strp_cn_err
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strp_cn_err.virtual_bedside | 0 | numeric |
strp_cor
| Variable Name | Type | Min Possible | Max Possible |
|---|---|---|---|
| strp_cor.virtual_bedside | numeric | 1 | 71 |
strp_err
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strp_err.virtual_bedside | 0, 1, 7, 50 | numeric |
strp_sce
| Variable Name | All Possible Values (Categorical) | Type |
|---|---|---|
| strp_sce.virtual_bedside | 0, 1, 2, 3 | numeric |
social_network_index
ExerciseFreq
ExerciseYN
SNI_HighContact
SNI_NumberPeople_socialmedia
SNI_NumberPeople